ID: 971259494

View in Genome Browser
Species Human (GRCh38)
Location 4:25043402-25043424
Sequence AGGTAGAAGCTGAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971259482_971259494 30 Left 971259482 4:25043349-25043371 CCAGAGCTTTGCATGTTATAATG No data
Right 971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971259494 Original CRISPR AGGTAGAAGCTGAAAGAAGA TGG Intergenic
No off target data available for this crispr