ID: 971260485

View in Genome Browser
Species Human (GRCh38)
Location 4:25052468-25052490
Sequence CTTCTCTAGCAGAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971260481_971260485 4 Left 971260481 4:25052441-25052463 CCATTCTTACAGACTAGATATTA No data
Right 971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971260485 Original CRISPR CTTCTCTAGCAGAGGCTGGG AGG Intergenic
No off target data available for this crispr