ID: 971261557

View in Genome Browser
Species Human (GRCh38)
Location 4:25061946-25061968
Sequence CAGAATAAGGAAATGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971261557_971261564 16 Left 971261557 4:25061946-25061968 CCTTCATCCATTTCCTTATTCTG No data
Right 971261564 4:25061985-25062007 GAGCCTATGTCAGGTCCTGGAGG No data
971261557_971261563 13 Left 971261557 4:25061946-25061968 CCTTCATCCATTTCCTTATTCTG No data
Right 971261563 4:25061982-25062004 TCAGAGCCTATGTCAGGTCCTGG No data
971261557_971261562 7 Left 971261557 4:25061946-25061968 CCTTCATCCATTTCCTTATTCTG No data
Right 971261562 4:25061976-25061998 TGTGAGTCAGAGCCTATGTCAGG No data
971261557_971261565 17 Left 971261557 4:25061946-25061968 CCTTCATCCATTTCCTTATTCTG No data
Right 971261565 4:25061986-25062008 AGCCTATGTCAGGTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971261557 Original CRISPR CAGAATAAGGAAATGGATGA AGG (reversed) Intergenic
No off target data available for this crispr