ID: 971263638 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:25078726-25078748 |
Sequence | CTAATACACCAGGGCTCAGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
971263638_971263641 | 13 | Left | 971263638 | 4:25078726-25078748 | CCTGCTGAGCCCTGGTGTATTAG | No data | ||
Right | 971263641 | 4:25078762-25078784 | TGCTTGTGAAGACATACCATAGG | No data | ||||
971263638_971263643 | 18 | Left | 971263638 | 4:25078726-25078748 | CCTGCTGAGCCCTGGTGTATTAG | No data | ||
Right | 971263643 | 4:25078767-25078789 | GTGAAGACATACCATAGGCTGGG | No data | ||||
971263638_971263642 | 17 | Left | 971263638 | 4:25078726-25078748 | CCTGCTGAGCCCTGGTGTATTAG | No data | ||
Right | 971263642 | 4:25078766-25078788 | TGTGAAGACATACCATAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
971263638 | Original CRISPR | CTAATACACCAGGGCTCAGC AGG (reversed) | Intergenic | ||