ID: 971263638

View in Genome Browser
Species Human (GRCh38)
Location 4:25078726-25078748
Sequence CTAATACACCAGGGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971263638_971263641 13 Left 971263638 4:25078726-25078748 CCTGCTGAGCCCTGGTGTATTAG No data
Right 971263641 4:25078762-25078784 TGCTTGTGAAGACATACCATAGG No data
971263638_971263643 18 Left 971263638 4:25078726-25078748 CCTGCTGAGCCCTGGTGTATTAG No data
Right 971263643 4:25078767-25078789 GTGAAGACATACCATAGGCTGGG No data
971263638_971263642 17 Left 971263638 4:25078726-25078748 CCTGCTGAGCCCTGGTGTATTAG No data
Right 971263642 4:25078766-25078788 TGTGAAGACATACCATAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971263638 Original CRISPR CTAATACACCAGGGCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr