ID: 971263639

View in Genome Browser
Species Human (GRCh38)
Location 4:25078735-25078757
Sequence GAAAACAGACTAATACACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1517
Summary {0: 10, 1: 29, 2: 145, 3: 405, 4: 928}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971263639_971263643 9 Left 971263639 4:25078735-25078757 CCCTGGTGTATTAGTCTGTTTTC 0: 10
1: 29
2: 145
3: 405
4: 928
Right 971263643 4:25078767-25078789 GTGAAGACATACCATAGGCTGGG No data
971263639_971263641 4 Left 971263639 4:25078735-25078757 CCCTGGTGTATTAGTCTGTTTTC 0: 10
1: 29
2: 145
3: 405
4: 928
Right 971263641 4:25078762-25078784 TGCTTGTGAAGACATACCATAGG No data
971263639_971263642 8 Left 971263639 4:25078735-25078757 CCCTGGTGTATTAGTCTGTTTTC 0: 10
1: 29
2: 145
3: 405
4: 928
Right 971263642 4:25078766-25078788 TGTGAAGACATACCATAGGCTGG No data
971263639_971263645 29 Left 971263639 4:25078735-25078757 CCCTGGTGTATTAGTCTGTTTTC 0: 10
1: 29
2: 145
3: 405
4: 928
Right 971263645 4:25078787-25078809 GGGCAATTTACAAAAGAAAGAGG 0: 1592
1: 1792
2: 1635
3: 5247
4: 9684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971263639 Original CRISPR GAAAACAGACTAATACACCA GGG (reversed) Intergenic
900728866 1:4238327-4238349 GAGAACAGGCCAATACAGCAAGG - Intergenic
900839961 1:5040514-5040536 GAGAACAGACTAATACTAAATGG + Intergenic
900879857 1:5373077-5373099 GAGAACAGACTAATACAGCATGG + Intergenic
901133408 1:6977105-6977127 CAGAACAGACTAATACACAGGGG + Intronic
901440805 1:9277075-9277097 GAAAACAGACTAATACACAGGGG - Intergenic
902039229 1:13480847-13480869 GAGAACAGACTAATACACCCAGG + Intronic
902137508 1:14322822-14322844 GAAAACAAACTAATACATGTGGG - Intergenic
902253984 1:15175527-15175549 GAGAACAGACTAATACACAGAGG - Intronic
902740351 1:18433581-18433603 GAAAACGGACTAATACAGGGAGG + Intergenic
902939745 1:19792171-19792193 GAAAATGGACTAATACACCAAGG + Intronic
903016606 1:20366017-20366039 GAAAACAGACTGAGAGACCCTGG - Intergenic
903604548 1:24566171-24566193 GAAAACAGACTAATGCTCCCAGG + Intronic
904198713 1:28805183-28805205 GAAAACCGACTAATACAGGGAGG - Intergenic
904721415 1:32512074-32512096 GAAAACCAACTAAGACATCAGGG + Intronic
904839486 1:33363149-33363171 GAAAGCAGACTGACACACAAAGG - Intronic
905009519 1:34737822-34737844 GAAAACAGACACAGACAGCATGG + Intronic
905290396 1:36917765-36917787 GAAAACGGACTAATACAGGGAGG + Intronic
907370918 1:54002861-54002883 GAGAAGAGGCTAATACACCATGG - Intergenic
907625427 1:56024680-56024702 GAGAACAGACTAATACAGCTGGG + Intergenic
907726057 1:57021684-57021706 GAGAATGGACTAATACACCCAGG + Intronic
907874423 1:58471939-58471961 AAGAACAGACTAATACAGCTGGG + Intronic
908012578 1:59795296-59795318 AAAAACAGACAGATAGACCATGG + Intergenic
908076245 1:60522584-60522606 GAAAGTGGACTAATACAACATGG - Intergenic
908391843 1:63690382-63690404 GAACCCTGACTAATACACCTTGG - Intergenic
908613409 1:65888295-65888317 AAAAACAAACACATACACCACGG - Intronic
908699470 1:66882146-66882168 GAAAACAGAGTAATACAGTTGGG + Intronic
908746652 1:67382999-67383021 GAGAACAGACTAATTCACATGGG - Intronic
908875838 1:68674685-68674707 GAAAACAGACTAATACATATAGG - Intergenic
908912192 1:69084930-69084952 GAAAATAAACTAATAGAGCAAGG - Intergenic
908967693 1:69786481-69786503 GAAAATAGACTAATACAGGGAGG - Intronic
909259787 1:73472770-73472792 GAGAACAGACTAACACATAAGGG - Intergenic
909518442 1:76539158-76539180 CAAAACAGACATATAGACCAAGG + Intronic
909848460 1:80429091-80429113 AAAAACAGACACATAGACCAAGG - Intergenic
909987067 1:82173880-82173902 AAAAACAGACACATAGACCAAGG + Intergenic
910028767 1:82690073-82690095 AAAAACAGACTAATACAACTGGG - Intergenic
910137473 1:83989504-83989526 AAAAACAGACACATAGACCAGGG - Intronic
910188271 1:84569002-84569024 GAGAACAAACTAATACACTCAGG + Intronic
910227913 1:84955296-84955318 GAGAACAGACTAATACAGAGGGG + Intronic
910705698 1:90127231-90127253 GAGAACAGACTAATACAATGTGG + Intergenic
911067625 1:93805260-93805282 GAATACTGACTAATACAGCAGGG + Intronic
911268997 1:95777717-95777739 GAAAACAGACTAATACAGGTGGG - Intergenic
911391884 1:97255665-97255687 GAAAACAGACTAATACAGAGGGG + Intronic
911628695 1:100157486-100157508 CAGAACAGACTAATACACAAGGG + Intronic
911629558 1:100167010-100167032 GAAAACAGACTAATACACCAGGG + Intronic
912071201 1:105811806-105811828 GAAAATGGACTAATACACCCTGG + Intergenic
912752586 1:112298071-112298093 AGAAACAGTCCAATACACCAAGG + Intergenic
912846856 1:113082377-113082399 TGCAAGAGACTAATACACCAGGG - Intronic
913041312 1:115027367-115027389 GTAAAAAGAATAATACATCATGG - Intergenic
913197615 1:116471086-116471108 CAAAATGGACTAAGACACCATGG + Intergenic
913254034 1:116938273-116938295 GAAAACGGACTAATATTCCTTGG - Intronic
913563698 1:120048815-120048837 AAATTAAGACTAATACACCAGGG + Intronic
913634426 1:120744748-120744770 AAATTAAGACTAATACACCAGGG - Intergenic
914284291 1:146208189-146208211 AAATTAAGACTAATACACCAGGG + Intronic
914545323 1:148658930-148658952 AAATTAAGACTAATACACCAGGG + Intronic
914621245 1:149411744-149411766 AAATTAAGACTAATACACCAGGG - Intergenic
914974479 1:152348397-152348419 GAAATAAGAATTATACACCATGG - Intergenic
915482516 1:156196660-156196682 CAACACAGACAAATACAGCAGGG - Intronic
915874944 1:159602463-159602485 AAGAACAGACTAATACATAAGGG + Intergenic
916147607 1:161754443-161754465 GAAAATAGACTAATACACGATGG - Intronic
916604131 1:166324357-166324379 CAAAGCAAACTAATACACCGTGG + Intergenic
916736213 1:167608992-167609014 GAGAACAGACTAATACACATGGG + Intergenic
916829403 1:168475534-168475556 GAGAACAGACTAATACAGAAGGG + Intergenic
916861836 1:168814183-168814205 AAAAACAGACACATAGACCAAGG + Intergenic
917089901 1:171342414-171342436 TAGAACAGACTAATACAATATGG + Intergenic
917103903 1:171473021-171473043 GAAAACGGACTAATACATGCAGG - Intergenic
917167534 1:172129439-172129461 GAAGACAGACTAATACAGTATGG - Intronic
917234834 1:172879961-172879983 AAAAACAGACACATAAACCATGG - Intergenic
917494206 1:175525332-175525354 GAGAACAGACTAATACACATAGG + Intronic
917731248 1:177877080-177877102 GAAAACGGACCGATACACTAGGG + Intergenic
917950489 1:180027804-180027826 AAAAACAGACTAATGCATAAAGG - Intronic
918152543 1:181810463-181810485 GAAAACAAACCACTGCACCATGG + Intergenic
918186786 1:182134607-182134629 GAGAACAGACTAATACAGTGGGG + Intergenic
918356567 1:183710499-183710521 GAAAATGGACTAATACACCTGGG - Intronic
918429554 1:184444586-184444608 GAAAATGGACTAATACAACTGGG + Intronic
918466591 1:184827213-184827235 GAAAACGGACTAATACAGTGGGG + Intronic
918701537 1:187615017-187615039 GAGAACAGACTAATACAAAGAGG - Intergenic
918759037 1:188377695-188377717 GAGAATAGACTAGTACAGCAAGG + Intergenic
918877798 1:190071876-190071898 AAAAACAGACATATAGACCAAGG - Intergenic
919133267 1:193477142-193477164 GAAAATAGACTAATACAGGGTGG + Intergenic
919160657 1:193825894-193825916 GAGAATGGACTAATACACCATGG + Intergenic
919349176 1:196427049-196427071 GAGAGCAGGCTAATACACCATGG + Intronic
919518956 1:198563459-198563481 CAAAACAGCATATTACACCAAGG + Intergenic
920556463 1:206908178-206908200 GAAAACTGACAAATACACAGAGG + Intronic
920628798 1:207631266-207631288 GAAAAGTAACTAGTACACCAGGG + Intronic
920909936 1:210206831-210206853 GAAAATAGACTAATACACAGAGG + Intergenic
921275925 1:213520134-213520156 GAAAATGGACTAATACACAGAGG - Intergenic
921452218 1:215322911-215322933 GAGAACAGACTAATAGAGTATGG - Intergenic
921457159 1:215385962-215385984 GAAAACAGGCTAATACAGATGGG - Intergenic
921494064 1:215814792-215814814 GAAAACGAACTAAGACACCTGGG + Intronic
921671016 1:217924147-217924169 AATAACTTACTAATACACCATGG + Intergenic
921894062 1:220380548-220380570 GAAAATGGACTAATATACCTGGG + Intergenic
922357319 1:224788694-224788716 GAAAACAGACTAATACACTCAGG + Intergenic
922666285 1:227472173-227472195 GAGAACAGACTAATACAGTTGGG + Intergenic
922679788 1:227583891-227583913 GAGATCAAACTAATACAGCATGG + Intronic
923311488 1:232739799-232739821 GAAAACAGACTAATATAGCAGGG + Intergenic
923769158 1:236922240-236922262 GAGAACAGACTAATACAATGTGG + Intergenic
923886232 1:238159702-238159724 AAAAACAGACACATAAACCAAGG - Intergenic
923977892 1:239285347-239285369 GAAAACAGACTAATGCAGCATGG - Intergenic
924007008 1:239623470-239623492 AAAAAAAAACTTATACACCATGG - Intronic
924166386 1:241287585-241287607 GAAAACAGACTAACACGCCCTGG + Intronic
924205043 1:241703679-241703701 GAAAATGGATTAATACACAACGG - Intronic
924315372 1:242789959-242789981 GAGAACGGACTAATTCAACAAGG - Intergenic
924603956 1:245516259-245516281 AAAAACAGACTCTAACACCATGG - Intronic
1063752676 10:8968841-8968863 GAAAACATACTAATACACCTAGG - Intergenic
1063809137 10:9682763-9682785 GAGAACAGCCTAATACATGACGG + Intergenic
1063982238 10:11463415-11463437 GAGAACTGCCAAATACACCATGG - Exonic
1064097167 10:12432324-12432346 GACAACAGACAAATAAACCTTGG - Intronic
1064508841 10:16066917-16066939 GAGAGCAGACTAATACATCTGGG - Intergenic
1064777010 10:18789774-18789796 GAAAACAGACTAATACAGTAGGG + Intergenic
1064791569 10:18962412-18962434 GAAAATGGACTAATACAGGAGGG - Intergenic
1064810880 10:19196926-19196948 GAAAACAGACTAATTCAGGGTGG - Intronic
1064930886 10:20625283-20625305 GAAAATGGACTAATACAGAAAGG - Intergenic
1065139413 10:22705821-22705843 GAGAACAGACTAATACAATGGGG - Intronic
1065376691 10:25050283-25050305 GAGAACAGACTAATACAAAATGG - Intronic
1065386668 10:25140540-25140562 GAGAACAGATGAATACACTAGGG + Intergenic
1065453319 10:25881086-25881108 GAGAACAAACTAATACATGAAGG + Intergenic
1065601330 10:27371771-27371793 GAAAACAGACTAATACAGAGGGG + Intergenic
1065639722 10:27769287-27769309 GAGAACAGACTAATACATCCAGG + Intergenic
1065751232 10:28889869-28889891 GAAAATGGACTAATACACACAGG - Intergenic
1065963211 10:30750876-30750898 GACAACAAACTAAGTCACCAAGG + Intergenic
1066113886 10:32222623-32222645 GAGAACAGACTAATACAGCATGG - Intergenic
1066191993 10:33064515-33064537 GAAAATGAACTAATACACAAGGG + Intergenic
1066228351 10:33407019-33407041 GAGAACAGACTAATACATTAGGG + Intergenic
1066229955 10:33422555-33422577 GAAAACACACACATACACAAGGG - Intergenic
1066277278 10:33881376-33881398 GAGAACAGACTAATATATCTTGG - Intergenic
1066281473 10:33922310-33922332 GAAAATGGACTAATACAGAACGG + Intergenic
1066416417 10:35225530-35225552 GAGAACAGACTAATACAGATAGG + Intergenic
1066484689 10:35832095-35832117 GAAAACAGACTAATACACTGGGG - Intergenic
1067144530 10:43684902-43684924 GAGAACAGACTAATACATATTGG + Intergenic
1067305288 10:45058658-45058680 GAAAACAGACTAATACACTGGGG - Intergenic
1067457952 10:46436828-46436850 GAGAACAGATTAATACAACAGGG - Intergenic
1067512655 10:46908771-46908793 CAAAACAGACTAAGACACCCAGG + Intergenic
1067629248 10:47947806-47947828 GAGAACAGATTAGTACAACAGGG + Intergenic
1067649589 10:48143051-48143073 CAAAACAGACTAAGACACCCAGG - Intergenic
1067723177 10:48745559-48745581 GAAAACTGACAAATACACAGAGG - Intronic
1067736964 10:48863712-48863734 GAAAACGGACTAATACAAAAAGG - Intronic
1068048593 10:51919193-51919215 GGAAACAGACTTATACCCCCTGG - Intronic
1068049187 10:51927460-51927482 GAAAATGGACTAATACAATAGGG + Intronic
1068099792 10:52537986-52538008 AAAAACAGACACATAGACCAAGG - Intergenic
1068122505 10:52797449-52797471 GTAAACAGACTAATACACTTTGG + Intergenic
1068229691 10:54156274-54156296 GAAAACAGACTAATACAGATGGG - Intronic
1068264423 10:54627638-54627660 GAAAATGGACTAATACAGCCAGG + Intronic
1068289812 10:54988211-54988233 CAAAACAGACATATAGACCAAGG - Intronic
1068301234 10:55143255-55143277 GAAAACAGACTAATACAATGAGG + Intronic
1068343673 10:55742269-55742291 GAAAACAGACTAAGACAAGTAGG - Intergenic
1068510791 10:57963443-57963465 GAAAAGGAACTAATACACCCAGG - Intergenic
1068570738 10:58625570-58625592 GAAAACTGACCTATAAACCATGG + Intronic
1068924899 10:62526261-62526283 GAAAATGGACTAATACAGAAGGG - Intronic
1069078992 10:64068001-64068023 CAAAACAAACTAAGACACCATGG + Intergenic
1069198578 10:65585152-65585174 GAAAACAAAGTAAGACACTAAGG + Intergenic
1070472078 10:76790892-76790914 GAAAACAGACACATAGACCAAGG - Intergenic
1070521547 10:77257951-77257973 GAAAACGGACTAATATAACCAGG + Intronic
1070590251 10:77795923-77795945 GAACTCAGACTAACACAACACGG + Intronic
1070679686 10:78439828-78439850 GAGAACGGACTAATAGACTAGGG - Intergenic
1070895160 10:79977106-79977128 GAAAACAGACTAATACAGTGGGG + Intronic
1071799740 10:89045367-89045389 AAAAACAGACACATAGACCAAGG - Intergenic
1071989140 10:91082847-91082869 GAGAACAGACTAATACAAACTGG + Intergenic
1072403822 10:95131087-95131109 AAAAACAGACTAATACACTCTGG + Intergenic
1072538957 10:96383976-96383998 GAAAACAGACTAATACAATGTGG + Intronic
1072550849 10:96476089-96476111 AAAAATAGACTAATACACAGAGG + Intronic
1073080376 10:100856151-100856173 GAAGACAGAATAATACACTTGGG + Intergenic
1073571383 10:104583596-104583618 GAAAATGGACTAATACAGCAGGG + Intergenic
1073591610 10:104762891-104762913 GAAAATAGACAAATACACCTGGG + Intronic
1073785665 10:106886351-106886373 AAAAATGGACTAATACACCATGG + Intronic
1073920423 10:108451871-108451893 CAAAACAAAATAAAACACCATGG + Intergenic
1073942080 10:108711215-108711237 GAGAACAGACTAATACAGGGTGG - Intergenic
1073956893 10:108882969-108882991 CAGAACAGACTAATACAGAAAGG + Intergenic
1074045280 10:109832357-109832379 GAGAACAGACTAATAAACCTGGG - Intergenic
1074170970 10:110936651-110936673 GAAAACTGACAAATACACAGAGG - Intronic
1074287354 10:112110634-112110656 GGAAATGGACTAATACACCCAGG + Intergenic
1074581295 10:114721822-114721844 AACAACAGACTAATCCAACATGG - Intergenic
1074662528 10:115677731-115677753 GAAAACAGACTAATAGAGCAAGG + Intronic
1074940662 10:118233569-118233591 GAAAACGGACTAATACACAAGGG - Intergenic
1074995246 10:118751555-118751577 GAGAACAGAAAAATAGACCAAGG - Intronic
1075081945 10:119390194-119390216 GAAAACGGACTAATACAGACGGG - Intronic
1075189295 10:120291703-120291725 AAGAAAAGACTAATACAACAGGG - Intergenic
1075225568 10:120625803-120625825 GAGAACAGACTCATACAGTATGG - Intergenic
1075427685 10:122354468-122354490 CAAAACAGACTAAGACACATGGG + Intergenic
1075535905 10:123271953-123271975 GAAAAGGAACTAATACACTATGG + Intergenic
1075629047 10:123989027-123989049 GAGAACAGACTATTACATAAGGG + Intergenic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1075927714 10:126266579-126266601 GAGAACGGACTAATACATAAGGG - Intronic
1076118292 10:127916526-127916548 GAAAACAGACTAATACAAGCAGG + Intronic
1076494719 10:130889450-130889472 GAGAACAGACTCATACACTAAGG - Intergenic
1076689917 10:132217910-132217932 GAAAATAGACTAATACAGATGGG + Intronic
1077180809 11:1214283-1214305 GAAAATGGACTAATACAGAACGG - Intergenic
1077398962 11:2343518-2343540 AATAACAGACTAATACACCCAGG - Intergenic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078397139 11:10991277-10991299 GAACCCAGACTAATACAGTAGGG + Intergenic
1078408185 11:11089470-11089492 GAAAAGGGACTAATACGCCGTGG + Intergenic
1079538200 11:21540453-21540475 GAGAACAGACTAATACAGCCAGG - Intronic
1079542790 11:21595275-21595297 GAAAACAAACTAGTACAACAAGG + Intergenic
1079552442 11:21716322-21716344 AAGAACAGACTAATATACCATGG + Intergenic
1079554243 11:21739792-21739814 GAAAATAGACTAATACAGTGGGG - Intergenic
1079579940 11:22051490-22051512 AAAAACAGACACATAGACCAAGG - Intergenic
1079650548 11:22923002-22923024 AAAAACAAACAAATACACAAGGG + Intergenic
1079687263 11:23375313-23375335 AAAAACAGACACATAGACCAAGG + Intergenic
1079725903 11:23880320-23880342 GAGAACAGAATAATACACTGTGG - Intergenic
1079848852 11:25503780-25503802 AAAAACAGACACATAGACCAAGG - Intergenic
1080194702 11:29595485-29595507 GAGAATGGACTAATACACCAAGG + Intergenic
1080976342 11:37345207-37345229 TAGAGCAGACTAATACACCTGGG + Intergenic
1081444263 11:43115183-43115205 GAGAACGGACTAATATATCAGGG - Intergenic
1081583944 11:44371419-44371441 GAAAACAGACAAATACAAGGGGG + Intergenic
1081753117 11:45526156-45526178 GAAAACAGGCAAATACAACCGGG + Intergenic
1081769203 11:45636988-45637010 GAAAACAGACTAATATACCAAGG + Intergenic
1081776999 11:45682433-45682455 GAAAACAGAGAACTAGACCAAGG + Intergenic
1082277852 11:50240970-50240992 TAAAACAAACTAATAAAACATGG + Intergenic
1084551733 11:69847600-69847622 GAAAACAGACTAATACACACTGG - Intergenic
1085617868 11:78015348-78015370 GAAAACAGACTAATACAGATGGG + Intergenic
1085732325 11:79010446-79010468 GATAACAGACTAATACCCTAAGG - Intronic
1085755193 11:79196200-79196222 GAAAACAGACTAATGCAAGAGGG + Intronic
1085799878 11:79579629-79579651 GAAAATGGACTAATACACATGGG - Intergenic
1085855951 11:80176238-80176260 AAAAACAGACACATAGACCAAGG - Intergenic
1085976203 11:81659069-81659091 AAGAACAGCCTAATACACCTGGG - Intergenic
1086277567 11:85149097-85149119 CAAAACAGACATATAGACCAAGG - Intronic
1086994571 11:93341481-93341503 GAAAACAAACTAATACAGGCAGG + Intronic
1087047753 11:93857553-93857575 AAAAACAAACAAACACACCATGG + Intergenic
1087497750 11:98911266-98911288 GAAAACAGACTAATACAAATAGG + Intergenic
1087503773 11:98994633-98994655 GAACCCTGACTAATACACGAAGG - Intergenic
1087526579 11:99321292-99321314 GAACACTGACTAATACAGAAAGG + Intronic
1087630990 11:100649797-100649819 GAGAACAGACTAATACACCCTGG + Intergenic
1087650902 11:100866456-100866478 GAGAATAGACTAATACAATAAGG - Intronic
1088326127 11:108603221-108603243 GAGAACAGACTAATACAATAGGG + Intergenic
1088385042 11:109244866-109244888 AAAAACAGACACATAGACCAAGG + Intergenic
1088591798 11:111409678-111409700 ACAAACAGACTAAGACACTAGGG + Intronic
1088733344 11:112703550-112703572 GAATATGGACTAATACACCTGGG + Intergenic
1088934664 11:114387607-114387629 GAAAATGGACTAAGACACCTTGG + Intergenic
1089147670 11:116341820-116341842 GAGAACAGACTAATACAAATGGG + Intergenic
1089732607 11:120528535-120528557 GAAAACAGACTAATACAGATGGG - Intronic
1089985086 11:122805026-122805048 GAAAACGAACTAACACAGCATGG - Intronic
1090345438 11:126065526-126065548 AGAAACAGACTAAGACACTATGG + Intergenic
1091092321 11:132783370-132783392 CATAACAGACTAATATCCCAAGG + Intronic
1091501849 12:1025723-1025745 GAGAACAGACTAATACAGTGAGG - Intronic
1091758434 12:3071560-3071582 GAAAACTGACAAATACACAGGGG - Intergenic
1091854574 12:3728978-3729000 CAAAAGAGACAAATACGCCATGG - Intronic
1091858570 12:3758557-3758579 GAGAAGAGACTAATACAGAAGGG - Intronic
1092347512 12:7728145-7728167 GAACACACACAAAGACACCAGGG - Intergenic
1092349420 12:7743789-7743811 AAAAACGGACTAATACAAGATGG - Intronic
1092795268 12:12104502-12104524 CAAAATGGACTAATACAGCAGGG + Intronic
1092921053 12:13232261-13232283 GAAAACAGGCTAATACACATGGG + Intergenic
1093037885 12:14350712-14350734 GAGAACAGACTAATACAAAAAGG - Intergenic
1093130841 12:15390256-15390278 GAAAACAGACTAATACACCATGG - Intronic
1093185587 12:16015601-16015623 GAAAACGGACTAATACAATTTGG + Intronic
1093315759 12:17647671-17647693 GAAAATGGACTAATACACTGGGG + Intergenic
1093324601 12:17758987-17759009 GAAAACGAACTAATACAGGAAGG - Intergenic
1093570872 12:20664243-20664265 GAGAATGGACTAATACACCAGGG + Intronic
1093780741 12:23133886-23133908 GAGAACAGAGTAATACATTAGGG + Intergenic
1093964912 12:25313841-25313863 GAACCCTGACTAATACAACAAGG + Intergenic
1093975151 12:25413405-25413427 GAATACAGTCTAATATTCCATGG - Intronic
1094133974 12:27104476-27104498 GAAAACAGATTAATTCATGATGG - Intergenic
1094223671 12:28022927-28022949 AAGAACAGACTAATACACACAGG - Intergenic
1094236889 12:28178159-28178181 GAAAATGGACTAATACACTTGGG + Intronic
1094282278 12:28753456-28753478 GCAAACAGACTAGTATAGCAGGG + Intergenic
1094372915 12:29757639-29757661 GAAAACAGACTAATACAACCTGG - Intronic
1094558977 12:31531991-31532013 GAAAATAAAAAAATACACCAGGG + Intronic
1094564132 12:31584455-31584477 GAAAACAGACTAAGACACTGTGG - Intronic
1094638975 12:32254831-32254853 CAAAACAGACTAATTAAACAAGG - Intronic
1095168515 12:39004723-39004745 GAAAAGAGGCAAATTCACCAAGG + Intergenic
1095249983 12:39968050-39968072 GAGAATAGACTAATACAGGAGGG - Intronic
1095489415 12:42717589-42717611 TAAAACAGACTAGAAAACCAAGG - Intergenic
1095510553 12:42947228-42947250 GAGAGCAGACTAATTCACCAAGG - Intergenic
1095601762 12:44021460-44021482 CAAATCAAGCTAATACACCAGGG - Intronic
1095611784 12:44137502-44137524 GAAAATGGACTAAGACAACATGG - Intronic
1095627497 12:44333741-44333763 GAGAACAAACTAATACACATAGG + Intronic
1095826589 12:46536293-46536315 GAGAACAGACTAATACAACCGGG - Intergenic
1096031746 12:48422598-48422620 GAAAACATACTCATTCACAATGG + Intergenic
1096306077 12:50477294-50477316 TAAAACAGATTAACACAACACGG - Exonic
1097692795 12:62748951-62748973 GAAAACAGTCTGATACACACTGG + Intronic
1097841644 12:64327241-64327263 GAAAACAGACTGAGATACCAGGG + Intronic
1097933023 12:65211964-65211986 GAGAACAGACTAATACAACTTGG - Intronic
1097955656 12:65483140-65483162 GAAAATGGACTAATACAGCCTGG + Intronic
1098317379 12:69207026-69207048 GAAGACAGACTAATACAACAAGG - Intergenic
1098327172 12:69315340-69315362 GAGAACAGACTAATACCCAAAGG - Intergenic
1098373457 12:69785319-69785341 GAACCCTGACTAAAACACCAAGG - Intronic
1098396630 12:70025965-70025987 GAAAACTAACTAAAACAGCATGG + Intergenic
1098472240 12:70858627-70858649 GAAAATAGAATAATAGATCATGG - Intronic
1098546226 12:71714590-71714612 AAAGACAGACAAATAGACCAAGG + Intergenic
1098696190 12:73558909-73558931 AAAAACAGACACATAAACCAAGG + Intergenic
1099396665 12:82148187-82148209 GAAAACAGACTAATACACACAGG + Intergenic
1099443353 12:82724663-82724685 GAAAACGGACTAATACAACTTGG + Intronic
1099500690 12:83410646-83410668 GAAAACAGACTAATACAGTGGGG - Intergenic
1099654909 12:85478152-85478174 GAAAACGAACTAATACAACTTGG - Intergenic
1099696771 12:86033112-86033134 CAAAACAGACACATAGACCAAGG - Intronic
1099763764 12:86955533-86955555 AAAAACAGACACATAGACCAAGG - Intergenic
1099783514 12:87231324-87231346 CTGGACAGACTAATACACCATGG - Intergenic
1099859521 12:88209430-88209452 GAAAACAGACTAATACAGTAAGG - Intergenic
1100026603 12:90136531-90136553 GAAAACTGACTAATACAATGAGG - Intergenic
1100273221 12:93046018-93046040 GAGAACAGACTAATACACATAGG + Intergenic
1100905888 12:99298559-99298581 GAGAACAGACTAATACAACCAGG + Intronic
1101260824 12:103027866-103027888 GAGAACGGACTAATACAGCAAGG - Intergenic
1101404064 12:104412761-104412783 GAGAACAGGCTAATACAGCTGGG + Intergenic
1101500436 12:105299105-105299127 GAAAATAGACTAATACCACATGG + Intronic
1102392635 12:112561901-112561923 GAGAACGGACTAATACACATTGG + Intergenic
1102528830 12:113531420-113531442 GAAAATGGACTAATACACATGGG + Intergenic
1102716536 12:114978291-114978313 GAAAATGGACTAATACACTGAGG - Intergenic
1102825588 12:115945496-115945518 GAGAACAGACTAATACAGAAGGG + Intergenic
1102877948 12:116462258-116462280 CAAAACAGACTAAGACACCAGGG - Intergenic
1102891815 12:116565197-116565219 GAAAACAGACTAAGACACCCTGG - Intergenic
1103174867 12:118854091-118854113 GAGAACAGACTAATACAGTCTGG + Intergenic
1103178947 12:118890892-118890914 CCAAACAGACTAAGACAACAGGG - Intergenic
1103183617 12:118936689-118936711 GAGAACAGACTGATACAACAGGG + Intergenic
1103237510 12:119385652-119385674 GAAAACAGACTAATACAAAAGGG + Intronic
1103567582 12:121824307-121824329 CAAATCAGTCTAATACAGCAGGG - Intronic
1104110192 12:125697503-125697525 AAGAACAGATTAATACACCATGG + Intergenic
1104155995 12:126132910-126132932 GAGAACAGATGAATACACCAGGG + Intergenic
1104205906 12:126638232-126638254 AAGAACTGACTAATACACCTAGG - Intergenic
1104304832 12:127600219-127600241 GAAAATGGACTAATACAAAAAGG + Intergenic
1104413995 12:128582797-128582819 GAAAACAGACTGATATACCCAGG + Intronic
1104493982 12:129219420-129219442 GAGAACAGACTAATATGTCAGGG + Intronic
1104505775 12:129330817-129330839 GAAAATAGACAAATACACCAAGG + Intronic
1104525414 12:129516330-129516352 GAAAACAGACTAATACATGGTGG - Intronic
1104532925 12:129589429-129589451 GAAAACAGACTAATACATGGGGG + Intronic
1104548125 12:129731058-129731080 GAACCCTGATTAATACACCAGGG + Intronic
1104742595 12:131189313-131189335 GAAAACAGACTAATACAATGAGG - Intergenic
1104928749 12:132327514-132327536 TAAAACAGACCATAACACCATGG + Intronic
1105451861 13:20507190-20507212 GAAAACAGACTAATACCGGATGG + Intronic
1105697029 13:22898913-22898935 AAAAATACACTAATACACTAAGG + Intergenic
1105950221 13:25223496-25223518 GAGAACAGACTAATACACAAGGG - Intergenic
1105977272 13:25482952-25482974 GAAAACGGACTAATACAGAAGGG + Intronic
1105991487 13:25626690-25626712 GAAAACAGACTAATACACTAAGG - Intronic
1106228415 13:27802446-27802468 GAAAGCAGACTAAGACACTTGGG + Intergenic
1106309827 13:28544428-28544450 TAAAACGGACTAATACAGAAGGG - Intergenic
1106915955 13:34514761-34514783 GAAAACAGACTAATACAGTTGGG - Intergenic
1107120335 13:36789005-36789027 GAAAATGGACTAAGACACCCAGG - Intergenic
1107336298 13:39359443-39359465 GAAAATATACAAATACCCCATGG + Intronic
1107509811 13:41072264-41072286 AAGAACTGACTAATACACCTGGG - Intronic
1107656083 13:42593026-42593048 GAAAACAGACTAATACAGGCTGG + Intronic
1108263879 13:48685020-48685042 GAGAATGGACTAATACAGCAGGG - Intronic
1108460906 13:50666424-50666446 AAGAACAGACTAATACACTGGGG + Intronic
1108586880 13:51877926-51877948 GAAAACAAACTAATACAAGGAGG - Intergenic
1108612577 13:52098177-52098199 GAGAACAGACTAATACATCCAGG + Intronic
1108680230 13:52773750-52773772 GAGAACAGACTAATACAATGAGG - Intergenic
1109401120 13:61829785-61829807 GATAACAGGCTAATACAACCAGG + Intergenic
1109588702 13:64446444-64446466 GAAAATGGACTAATACAACAGGG - Intergenic
1109642093 13:65203764-65203786 GAAAACAGATTAATACAACTAGG + Intergenic
1109649537 13:65308731-65308753 GAAAGCAGACTAATAGACCTTGG - Intergenic
1109810888 13:67510428-67510450 GAAAACAGACTAATACAATATGG + Intergenic
1109867653 13:68286546-68286568 GGAAACAGACTAATACACTTAGG - Intergenic
1109879475 13:68451857-68451879 GAAAACAGACTAATACACATGGG + Intergenic
1109910373 13:68903473-68903495 AAAAACAGACACATAGACCAAGG - Intergenic
1109946652 13:69442966-69442988 CAAAACAGACTAATACAGTGAGG + Intergenic
1110062535 13:71061403-71061425 GAGAACAGACTAATACACCTTGG - Intergenic
1110161651 13:72385690-72385712 GAGAACAAACTAATACAATATGG - Intergenic
1110178296 13:72584541-72584563 GAAAACAGACTAATACAGTGGGG - Intergenic
1110263512 13:73512925-73512947 GAGAACAGAATAATACACCCAGG + Intergenic
1110334550 13:74312094-74312116 GAACCCTGACTAATACACCAAGG + Intergenic
1110361556 13:74631059-74631081 AAAAATGGACTAATACACCCTGG + Intergenic
1110378007 13:74815505-74815527 GAAAATGGACTAATACACCTAGG + Intergenic
1110449391 13:75624523-75624545 GAAAACAGACTAATACAGGTGGG - Intronic
1110500706 13:76224479-76224501 GAGAACAGACTAATACACCCGGG + Intergenic
1110543619 13:76732906-76732928 GAGAACAGACTAATACACTTGGG - Intergenic
1110683230 13:78341325-78341347 GAAAACAGACTAATACACCAAGG - Intergenic
1110741984 13:79008337-79008359 GAGAACGGACTAATACAGAAGGG - Intergenic
1110802481 13:79715400-79715422 GAAAATGGACTAATACACTTTGG - Intergenic
1110827843 13:79993720-79993742 GAAAACAGAATTGTACACCAGGG - Intergenic
1110832211 13:80044449-80044471 AAAAACAGACTAATTCACATGGG + Intergenic
1110849566 13:80230062-80230084 GAAAATAGATTATTATACCAGGG - Intergenic
1110917902 13:81046472-81046494 GAGAACAGACTAATACAAAGAGG - Intergenic
1111007931 13:82274538-82274560 CAGAACAGACTAAGACACCTAGG - Intergenic
1111107138 13:83661216-83661238 GAAAACAGACTAATACACTTTGG + Intergenic
1111172696 13:84549676-84549698 GAGAACAGACTAATACATGGTGG - Intergenic
1111221467 13:85209661-85209683 GAGAAAAGACTAATACAGAAAGG + Intergenic
1111288622 13:86130707-86130729 GAAAACAAACTAATACACTCAGG + Intergenic
1111314085 13:86529066-86529088 GAAAATGGACTAATACACTGTGG + Intergenic
1111344197 13:86926935-86926957 AAAAATGGACTAATACAGCAGGG - Intergenic
1111364325 13:87222086-87222108 AAAAACAGACAAACACAGCAAGG + Intergenic
1111388183 13:87557003-87557025 GAACACAGACTAATACAGGTAGG + Intergenic
1111439819 13:88266453-88266475 GCATACATACAAATACACCATGG - Intergenic
1111655763 13:91150229-91150251 GAAAATTGACTAATACATCAAGG + Intergenic
1111802261 13:92995464-92995486 GAAAACAGACTAATAGAGTGGGG + Intergenic
1111968081 13:94881254-94881276 CAAAACAGACTGATACACTAAGG - Intergenic
1112080336 13:95962767-95962789 GAAAACAGACTAATACAATCAGG - Intronic
1112099061 13:96167104-96167126 GAGAACAGACTAATAATACAGGG + Intronic
1112120514 13:96405150-96405172 GAAAACGAACTAATACAGCAGGG + Intronic
1112626632 13:101111885-101111907 GAAAACAGATTAATACACACAGG + Intronic
1112656820 13:101460590-101460612 CAAAACAGACTAAGAAACCATGG - Intronic
1113023721 13:105917816-105917838 GCAAACTGATTAATACACCATGG + Intergenic
1113538457 13:111086536-111086558 GAGAACAGACTAATACACCCAGG + Intergenic
1113693504 13:112328535-112328557 GAAAACAGACTAATACACCTTGG - Intergenic
1113813474 13:113156035-113156057 GAGAACAGACTAATACAGGAAGG - Intergenic
1113819129 13:113199384-113199406 GAACCCAGACTAACACACAATGG + Intronic
1113915436 13:113868260-113868282 GAAAATTGACTAATACACTTGGG + Intergenic
1114158466 14:20134152-20134174 GAGAACAGACTAATACAGAAGGG + Intergenic
1114701517 14:24683220-24683242 GAAAACAGACTGAGAAACCATGG - Intergenic
1114795539 14:25711441-25711463 GAGAATAGACTAATACACATAGG - Intergenic
1114846204 14:26325639-26325661 GAAAACATAGTAAAACTCCAGGG + Intergenic
1114939740 14:27593468-27593490 CAAAAAAGAAAAATACACCATGG + Intergenic
1114955045 14:27806529-27806551 GAAAACAGACTAATACAGCTAGG + Intergenic
1114960254 14:27878567-27878589 AAAAACAGACACATAAACCAAGG - Intergenic
1114966322 14:27965584-27965606 AAAAACAGACAGATAAACCAAGG - Intergenic
1115318725 14:32054870-32054892 GAAAACAGACTAATATGGGAGGG + Intergenic
1115430944 14:33317810-33317832 GAGAATGGACTAATACACCAAGG + Intronic
1115806990 14:37062877-37062899 GAGAATGCACTAATACACCAGGG - Intronic
1115943488 14:38634762-38634784 AAAAACAGACACATAGACCAAGG + Intergenic
1116024893 14:39503095-39503117 AAAAACAGACACATAGACCAAGG - Intergenic
1116098751 14:40407316-40407338 GAAAACAGACTAATACATGTGGG - Intergenic
1116233577 14:42249158-42249180 CAAAACAGACTAAGACACTCTGG + Intergenic
1116367837 14:44090720-44090742 TAAAACTGACTAAGAAACCAAGG - Intergenic
1116642889 14:47486916-47486938 GAAAAAAGACTAATACACAAGGG + Intronic
1116802659 14:49459289-49459311 GAAAACAGACTAATACAGACTGG + Intergenic
1116854875 14:49943360-49943382 GAAAATAGACTAATACAGCTGGG + Intergenic
1117001966 14:51379761-51379783 GCAGACAGATTAATACACCAGGG - Intergenic
1117079279 14:52134778-52134800 AAAAACAGACAAATACACCATGG + Intergenic
1117110065 14:52443436-52443458 GAAACCTGACTAATACAGTAGGG + Intronic
1117197875 14:53359643-53359665 GAAAACAGACTAATACACTGAGG - Intergenic
1117676843 14:58163959-58163981 CCTAACAGACTAATACACCCTGG + Intronic
1117725402 14:58668204-58668226 GAAAGCAGACTAACACAGTAAGG - Intergenic
1117749388 14:58904182-58904204 GAAAACAGACTAATACAGGGAGG + Intergenic
1117977573 14:61313560-61313582 GAGAACAGACTAATACAGAGTGG - Intronic
1118234422 14:63988604-63988626 GAAAACAAACTAATATACATGGG - Intronic
1119132923 14:72191394-72191416 GAGAAAGGACTAATACAACATGG - Intronic
1119639104 14:76301036-76301058 AAAAACAGACATATAAACCATGG + Intergenic
1120178621 14:81321051-81321073 GAAAACGCACTAATACTGCAGGG + Intronic
1120208710 14:81613262-81613284 GAAAACGGACTAATACAAGGGGG - Intergenic
1120395320 14:83960644-83960666 CAAATAAAACTAATACACCAGGG + Intergenic
1120407972 14:84113517-84113539 CAAAACAGACTCAGACAACACGG + Intergenic
1120799954 14:88676777-88676799 AAAAACAGACACATAGACCAAGG + Intronic
1121130373 14:91440330-91440352 GAGAACAGACTAAAACACTTTGG + Intergenic
1121446647 14:93983027-93983049 GAGAATAGACTAGTACACCTGGG - Intergenic
1121470768 14:94152500-94152522 GAAAACAGACTTATACAATGGGG + Intronic
1121483664 14:94297309-94297331 GAAAATGGACTAATACACTGTGG - Intergenic
1121701716 14:95959679-95959701 AAAAATGGCCTAATACACCAGGG + Intergenic
1121832025 14:97060810-97060832 GAAAACAAACTAAGACACTGTGG + Intergenic
1121839410 14:97120312-97120334 GAAAACAGACTAATACACCAGGG + Intergenic
1121840872 14:97132714-97132736 GAAAAGAGACTAATACACCAAGG - Intergenic
1121952621 14:98184790-98184812 GAAAAAAAAGTAATAAACCACGG - Intergenic
1122054697 14:99086354-99086376 GAGAACAGACTAATACAGTTGGG + Intergenic
1122431265 14:101647875-101647897 GAAAACAGATAAATTCACTAAGG + Intergenic
1123114395 14:105887748-105887770 GAGAACAGACAAATAAACGATGG - Intergenic
1123120831 14:105916035-105916057 GAAAACAGGCAAATAAACGATGG - Intergenic
1123124447 14:105936254-105936276 GAAAATGGACTAATACACTATGG - Intergenic
1123403546 15:20007608-20007630 GAAAACAGGCAAATAAACGATGG - Intergenic
1123512882 15:21014253-21014275 GAAAACAGGCAAATAAACGATGG - Intergenic
1123716155 15:23034104-23034126 CTAAACAGACTAGTACAACATGG - Intronic
1123803135 15:23842532-23842554 CAAAACAGACATATAGACCAAGG - Intergenic
1124686377 15:31786258-31786280 GAAAACAAACTAATACAGCTGGG + Intronic
1125153752 15:36563019-36563041 GAGAACAGTCTAATACACTGAGG + Intergenic
1125270022 15:37928764-37928786 GAAAACAGACTAATACACTGGGG - Intronic
1125687850 15:41574028-41574050 GAAAAGAGACTGATAGACAAAGG - Intronic
1125884355 15:43217447-43217469 GAGAACCGACTAATACAAGAGGG + Intronic
1126236132 15:46386707-46386729 GAAAACAGACTGATTTAGCAAGG + Intergenic
1126816146 15:52456613-52456635 AAAAACAGACACATAGACCAAGG + Intronic
1126909073 15:53399364-53399386 GAGAATGGACTAATATACCAGGG - Intergenic
1127129095 15:55843239-55843261 GAAAACGGACTAAAACAGCCAGG + Intronic
1128461107 15:67868428-67868450 CAAAACAGACCAATAGACCATGG + Intergenic
1128709982 15:69864471-69864493 GAGAACAGACTAATACACCATGG - Intergenic
1128718470 15:69927823-69927845 GAAAATGGACTAATCCACAAGGG - Intergenic
1129637598 15:77337872-77337894 GAGAACAGACTAATATGACAAGG - Intronic
1129809918 15:78501942-78501964 GAGAACAAACAAATACACCTGGG - Intergenic
1129819351 15:78586952-78586974 GAGAACGGACTAATACTACAGGG - Intronic
1129900319 15:79143229-79143251 AAGAACAGACTAATACACTATGG - Intergenic
1129926880 15:79372411-79372433 GAGAACAGACTAATACAGGGAGG - Intronic
1129990164 15:79955108-79955130 GAAAATTGACTAATGCAGCATGG - Intergenic
1130421866 15:83756221-83756243 GAAAACAGACTAATACAGTGAGG - Intronic
1130792947 15:87175606-87175628 AAAAACAGACACATAGACCATGG + Intergenic
1130923047 15:88365184-88365206 GGAAACAGACAAATCCACAATGG - Intergenic
1131463999 15:92639933-92639955 AAGAACAGACTAATACACAGTGG + Intronic
1131556672 15:93405383-93405405 GAAAATGGACTAATACACCTGGG + Intergenic
1131582225 15:93655414-93655436 GAGAACAGACTAATACAAGGGGG + Intergenic
1131597943 15:93817952-93817974 AAAAACAGACATATAGACCAAGG + Intergenic
1131677877 15:94689667-94689689 GAAAAGAGACTAATACAGAGTGG + Intergenic
1131800250 15:96060923-96060945 GAAAACAGACTAATACAGTAAGG + Intergenic
1131852553 15:96558116-96558138 GAAAATGGACTAATACAAAAAGG + Intergenic
1132112695 15:99114090-99114112 GAAAACACACTAACACATCCTGG - Intronic
1132890544 16:2202196-2202218 GAAAATGGACTAATACTCCATGG - Intergenic
1133388724 16:5391720-5391742 GAAAACAGACACATACAGAAGGG - Intergenic
1133691590 16:8220823-8220845 GAAAACAAACTAATACAATTGGG + Intergenic
1133721974 16:8503012-8503034 AAGAACAGACTAATACAGCAAGG + Intergenic
1134213142 16:12294831-12294853 GAAAACAGGCTAATACAGGAAGG - Intronic
1134374735 16:13661241-13661263 GAGAACAGACTAATACAAAAAGG + Intergenic
1134569254 16:15277562-15277584 GAAAACAGACTAATACATGGGGG - Intergenic
1134601276 16:15535719-15535741 GAAAATGGACTAATACAAAATGG - Intronic
1134606180 16:15573076-15573098 GAAAATGGACTAATACAACTAGG + Intronic
1134733123 16:16478483-16478505 GAAAACAGACTAATACATGGGGG + Intergenic
1134768459 16:16783043-16783065 GAAAATGGACTAATACACCTGGG + Intergenic
1134782610 16:16912021-16912043 GAAAATGGACTAACACACAAGGG + Intergenic
1134804161 16:17110617-17110639 GAGAACAGACAAATACAGCTAGG + Intronic
1134821145 16:17248357-17248379 GAGAACAGACTAATACAGGGGGG + Intronic
1134934316 16:18233490-18233512 GAAAACAGAGTAATACATGGGGG - Intergenic
1135049075 16:19178016-19178038 GAAAACAAACTAATACAGGTTGG - Intronic
1135073438 16:19372562-19372584 GAAAACAGACTAATACACCAAGG - Intergenic
1135630098 16:24029588-24029610 GAAAGCAGACTAATACAGTATGG + Intronic
1135789322 16:25379173-25379195 GAAAATAGACTAAGACACTCAGG - Intergenic
1135915821 16:26604588-26604610 GAGAACAGACTAATACAGGATGG + Intergenic
1135922296 16:26662120-26662142 CAAAACAGACACATAGACCAAGG - Intergenic
1135987506 16:27194769-27194791 GAGAACAGACGAATACACGGAGG - Intergenic
1137448632 16:48549873-48549895 GAACACAGGCGAAAACACCAGGG + Intronic
1137502877 16:49024817-49024839 GAAATCAGACTCATAACCCAAGG + Intergenic
1137697953 16:50475037-50475059 GAGAACAGACTAATACAGATGGG + Intergenic
1137868773 16:51929483-51929505 GAGAAAGGACTAATACAACAGGG - Intergenic
1138088564 16:54155621-54155643 AAGAATGGACTAATACACCAGGG - Intergenic
1138301355 16:55932371-55932393 GAAAACAGACTAAGACACTGGGG + Intronic
1138380042 16:56593801-56593823 GAAAACAAACTAATACAAGGTGG + Intergenic
1138799016 16:60002976-60002998 GAGAACAGACTAATACAAGGAGG + Intergenic
1138861334 16:60762028-60762050 GAGAACAGACTAATACAGCCAGG - Intergenic
1138908999 16:61373916-61373938 GAAAATGGACTAATACACCAAGG + Intergenic
1138910580 16:61393191-61393213 AAAAACAGAATAATATACAAGGG + Intergenic
1138981442 16:62273790-62273812 GATAACAGACTAATACATTAGGG - Intergenic
1139032379 16:62900592-62900614 GAGAATGGACTAATACACCATGG + Intergenic
1139134024 16:64179426-64179448 GAAAATGGACTAATACACCCTGG + Intergenic
1139299540 16:65933678-65933700 GAAAATGGACTAATACAGAAGGG + Intergenic
1139794794 16:69473791-69473813 GAAAACAGACTAATACATACTGG - Intergenic
1140247768 16:73266940-73266962 GAAAACATACCAATACACTTGGG + Intergenic
1140277372 16:73522708-73522730 GAGAACAGACTAATACACCTTGG - Intergenic
1140336800 16:74114739-74114761 GAACCCTGACTAATACAGCAAGG + Intergenic
1140356947 16:74314594-74314616 GAAAACGGACTAATACATAAGGG - Intergenic
1140823995 16:78689096-78689118 GAGAACAGACTAATACAGTCAGG + Intronic
1140824370 16:78692138-78692160 GAAAACGGACTAATACAGTGAGG + Intronic
1140831942 16:78760018-78760040 GAACACAGACAAATACATCCTGG - Intronic
1140873316 16:79126664-79126686 AAGAACAGACTAATACAGCAAGG + Intronic
1140998117 16:80280792-80280814 GAGAACTGACTAATACAGCTGGG - Intergenic
1141231673 16:82172895-82172917 GAACACAGACTGGTACAACAGGG - Intergenic
1141411277 16:83834801-83834823 GAAAATGGACTAATACATAAGGG + Intergenic
1142503328 17:346295-346317 GAAAACGGACTAACACAACTGGG - Intronic
1143210676 17:5185163-5185185 GAAAACGGACTAATCCACTGGGG - Intronic
1143316052 17:6034319-6034341 GAAAACAGACTAATACAGGATGG - Intronic
1144241579 17:13317979-13318001 GAAAATAGACTAATCCACTAAGG - Intergenic
1144337908 17:14288112-14288134 GGGAAGAGAGTAATACACCAAGG + Intergenic
1144810523 17:17995934-17995956 GAAAACAGACTAATACAGATAGG - Intronic
1145406545 17:22602416-22602438 GAAAACAGACTAAGACAAGTAGG - Intergenic
1145823476 17:27858584-27858606 GAGAACAGACTAATACAGTTGGG + Intronic
1146098527 17:29955590-29955612 GAGAGCAGACTAATACACCAAGG + Intronic
1146468313 17:33104560-33104582 GAAAACAGACAAAAGCAACATGG - Intronic
1147504796 17:41005070-41005092 GAGAACAGACTAATACAGTATGG - Intergenic
1148529203 17:48373058-48373080 GAAAATGGACTAATACAACCTGG - Intronic
1148966575 17:51440914-51440936 GAAAACAGACTAAGACACCTGGG - Intergenic
1149079301 17:52634283-52634305 AAAAACAGATCTATACACCAGGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1150189987 17:63228278-63228300 AAAAACAGACACATAGACCATGG - Intronic
1150476836 17:65482088-65482110 GAGAACAGACTAATACAGTTTGG + Intergenic
1150723822 17:67635727-67635749 GAAAACACAGAAATGCACCAAGG + Intronic
1150732076 17:67704398-67704420 GAGAACAGACTAATACAATGAGG - Intergenic
1150856199 17:68755416-68755438 GAAAACGGACTAATACAGAGAGG - Intergenic
1150971363 17:70031925-70031947 GAAAACGGCCTAATACATCTGGG - Intergenic
1151039272 17:70839879-70839901 GAAAACAGACTAATACAGATGGG - Intergenic
1151143439 17:72016984-72017006 GAAAACAGACTAATACACCATGG - Intergenic
1151172761 17:72261495-72261517 GAGAACAGACTAATACAGGTGGG - Intergenic
1151280545 17:73070942-73070964 GAAAATGAACTAATACACCTAGG + Intronic
1151504601 17:74518956-74518978 GAAAACAGGCTAATACACAATGG + Intergenic
1151810313 17:76436503-76436525 AAGAACAGACTATTACACCTGGG + Intronic
1151874843 17:76861860-76861882 GAAAACAGACTAATACAGCCAGG - Intergenic
1151980449 17:77505341-77505363 TACAACAGACTATTCCACCATGG - Intergenic
1152010070 17:77707560-77707582 GAAAACGGACTAATACACTTTGG + Intergenic
1153097035 18:1418724-1418746 AAAAACAGACTAACACAACGAGG + Intergenic
1153124568 18:1775602-1775624 GGGAACAGACTAATACAGCCAGG - Intergenic
1153349737 18:4065959-4065981 CAAAACAGACACATAGACCAAGG + Intronic
1153625274 18:7017177-7017199 GAGAACAAACTAATACACTTGGG + Intronic
1153840522 18:9003727-9003749 GAGAACAGACTAATACAGGTAGG + Intergenic
1153965546 18:10178263-10178285 GAAAACGAACTAACACACAAGGG - Intergenic
1155021543 18:21901342-21901364 GAGAACGGACTAACACACCAGGG + Intergenic
1155767048 18:29649009-29649031 GAAAATAAACTAATACAGGAAGG + Intergenic
1155822983 18:30401783-30401805 AAAAACAGACTAATAGAAAATGG - Intergenic
1155847647 18:30729710-30729732 CAAAACAGACACATAGACCAAGG - Intergenic
1156013030 18:32515752-32515774 GAAAACAAACTAATACATCAAGG + Intergenic
1156090848 18:33466805-33466827 GAGAACAGACTAATGTGCCAGGG + Intergenic
1156127712 18:33927142-33927164 GAAAACAGAGTAGTACACTCTGG - Intronic
1156199316 18:34812381-34812403 GAAAAGAGACTAACACAGAAGGG - Intronic
1156568071 18:38218945-38218967 GAGAATGGACTAATACACCAGGG + Intergenic
1156651280 18:39229181-39229203 GAAAATAGACTAATACAAAAGGG + Intergenic
1156782775 18:40870924-40870946 GAAAAGAGACTAAGAGACCAAGG - Intergenic
1157155766 18:45264466-45264488 AAAAACGGACTAATACACTAAGG - Intronic
1157166452 18:45362301-45362323 GAAAACAAACTAACACAACTGGG + Intronic
1157378002 18:47183479-47183501 GAAAAGGGACTAATACACGCTGG + Intergenic
1157454303 18:47812415-47812437 GAGATCAGACTAATACAGCTGGG + Exonic
1157469320 18:47976429-47976451 GAGGACAGACTAATACACTCTGG + Intergenic
1157508367 18:48248344-48248366 GAGAACAAACTAATACACTCAGG + Intronic
1157698904 18:49747012-49747034 GAAAATGGACTAATACAGGAGGG + Intergenic
1157718533 18:49906073-49906095 GAAAAGAGACCAATACAGCCTGG - Intronic
1158013731 18:52760040-52760062 GAGAACAGACTAATACAGGAAGG - Intronic
1158092043 18:53726430-53726452 GAGAACAGACTAATACACCTAGG - Intergenic
1158130101 18:54142937-54142959 GAAAATAGACTAATACAACTGGG + Intergenic
1158195218 18:54877304-54877326 GAGAACAGACTAATGCACTGTGG + Intronic
1158628869 18:59094993-59095015 AAAAACAGACTAATACACCTTGG - Intergenic
1158727766 18:59989804-59989826 AGAAATGGACTAATACACCAGGG + Intergenic
1158748513 18:60229384-60229406 GAAAACAGATTAACACACTCTGG + Intergenic
1158855570 18:61540341-61540363 GAAAATGGACTAATACATGAAGG - Intronic
1158879966 18:61768635-61768657 AAAAATGGACTGATACACCAAGG + Intergenic
1158946019 18:62447623-62447645 GAAAACAGACTAATACAAACAGG + Intergenic
1159106450 18:64006442-64006464 GAAGAGAGACTAACACACCGAGG + Intergenic
1159376119 18:67595811-67595833 AAAAACAGACATATAGACCAAGG - Intergenic
1159378329 18:67623720-67623742 GCTAACAAACTAATACACCAGGG - Intergenic
1159749572 18:72283531-72283553 GAAAATGGACTAATACAGAAAGG - Intergenic
1160243638 18:77140352-77140374 GAGAACAGACTAATACACCATGG + Intergenic
1160244238 18:77144469-77144491 GAAAACGGACTAATACGCTTTGG + Intergenic
1160249455 18:77188653-77188675 GAAAACAGACTAATACATACAGG + Intergenic
1160290291 18:77586808-77586830 GAAAATAGACTAATACACCTGGG + Intergenic
1161371390 19:3913877-3913899 GAAAACAGACTAATACGGCGGGG - Intronic
1161663588 19:5561579-5561601 GAAAACAGCCAAATTCACCAGGG - Intergenic
1161972394 19:7590000-7590022 AAAAACTGAGTCATACACCAAGG - Intergenic
1163180163 19:15593741-15593763 GAAAACAGACTAATACAATAGGG + Intergenic
1163300714 19:16444278-16444300 TAAAACAGACAAAGACATCATGG + Intronic
1164021647 19:21312463-21312485 CAAAACAAACAAATACAACATGG + Intronic
1164577242 19:29412706-29412728 GAAAATGGACTAATACACTTGGG + Intergenic
1164815985 19:31203853-31203875 GAAAACAGGCTAATACAGGAGGG - Intergenic
1165180429 19:33962788-33962810 GAGAACAGACTAACACAAGAGGG + Intergenic
1165259447 19:34599331-34599353 GAAAAGAGACTAATACAGATGGG - Intronic
1165478426 19:36046379-36046401 GAGAACAGACTAAGACACATAGG + Intronic
1165558049 19:36653436-36653458 GAGAGCAGACTAATACACCTTGG - Intronic
1166526672 19:43514810-43514832 GAGAACAGACTAATACAGAAGGG + Intronic
1166968755 19:46547877-46547899 GAAAATGGTCTAATACACCAGGG + Intronic
1166969751 19:46558346-46558368 GAAAACAGACTCATACACATGGG - Intronic
1167519273 19:49943340-49943362 AAAAACAGACACATAGACCAGGG + Intronic
1167602088 19:50460158-50460180 GAAAGCAGACAAAAAAACCATGG + Exonic
1168387570 19:55978350-55978372 GAAAACAGACTAAGACAGATAGG - Intronic
1168648069 19:58074048-58074070 GTAAACAGACTAACACAGCCAGG + Intronic
924963517 2:56421-56443 GAAAACAAACTCATACACCTGGG - Intergenic
925083347 2:1087542-1087564 GGAAACAGAAGAAAACACCATGG - Intronic
925117895 2:1395994-1396016 GAAAACAGACTAATACAATGAGG + Intronic
925229145 2:2216222-2216244 AAGAACAGCCTAATACACCAAGG + Intronic
925360130 2:3273299-3273321 GAAAACAAAATGATAAACCACGG + Intronic
925437116 2:3848040-3848062 GAGAACAGACTAATACAGCTGGG + Intergenic
925475568 2:4210719-4210741 GAAAACGGACTAATACACCTGGG - Intergenic
925507102 2:4579361-4579383 GAAAAGGGACTAAGACAACAAGG - Intergenic
925547331 2:5031174-5031196 GAAAACAGACCAATTTTCCAAGG + Intergenic
925660259 2:6194723-6194745 GAAAACAGACTAATACACAGGGG + Intergenic
925669322 2:6294169-6294191 GAAAACAGATTAATACAAGTAGG + Intergenic
925857595 2:8145354-8145376 AAAAATGGACTAATACACCAAGG - Intergenic
925879615 2:8341177-8341199 GAGAACAGACTAATACATGCAGG + Intergenic
926458303 2:13096543-13096565 GAGAACAGATTAATACACCTTGG + Intergenic
926506369 2:13721328-13721350 GAAAAGAAACTAATACACCTGGG - Intergenic
926629697 2:15125160-15125182 GAGAACAGACTAATACAGGTGGG - Intergenic
926663954 2:15499251-15499273 GAGAACAGACTAATACACTGGGG + Intronic
926688204 2:15714776-15714798 GAGAACAGACTAATAGACTAGGG - Intronic
926729535 2:16025788-16025810 GAAAACGGACTAATACATATGGG - Intergenic
926932844 2:18057452-18057474 GAGAACAGACTAATATGCCTGGG + Intronic
927098764 2:19770525-19770547 GAAAATGGACTAATACAACATGG - Intergenic
928133790 2:28672852-28672874 GAGAATGGACTAATACAGCATGG + Intergenic
928178000 2:29047980-29048002 GAGAACAGGCTAATACAGCAGGG - Intronic
928464835 2:31514059-31514081 GAGAACAGACTAATACAGAGGGG - Intergenic
929019724 2:37539491-37539513 GAGAACAGACTAATACACCTGGG + Intergenic
929113028 2:38421322-38421344 GAGAACCGACTAATACAGTAGGG - Intergenic
929229006 2:39540095-39540117 GAAAAAAGAGTGATTCACCAAGG + Intergenic
929269050 2:39952675-39952697 GAAAACAGACGAAGACAGAAAGG + Intergenic
929273982 2:40005753-40005775 GAAAATGGACTAATACACCAGGG - Intergenic
929865784 2:45716187-45716209 GAGAACGAAGTAATACACCATGG - Intronic
930803765 2:55469618-55469640 AAGAGCAGACTAATACACCCAGG + Intergenic
930979336 2:57503761-57503783 GAGAACAGACTAATACAGCAGGG - Intergenic
931120669 2:59215636-59215658 GAGAACAGATTAATACACCCTGG - Intergenic
931814396 2:65886423-65886445 GAGAACAGACTAATACAATATGG + Intergenic
932059116 2:68477632-68477654 GAGAACAGACTAATACAGACAGG - Intronic
932061033 2:68497618-68497640 GAAAACAGACTAATACAGTGTGG + Intronic
932461933 2:71887902-71887924 GAGAACGGACTAAGACAACAAGG + Intergenic
932657472 2:73622669-73622691 GAAAATGGACTAATACACATGGG + Intergenic
932664138 2:73682936-73682958 GAAAATGGACTAATACACATGGG + Intergenic
932879451 2:75487292-75487314 GAAAACAGAATAATACAGGTTGG + Intronic
933128042 2:78635656-78635678 TGAAATAGACTAATACACCATGG - Intergenic
933359427 2:81260431-81260453 TAAAACAGACTAAGACAAGAAGG + Intergenic
933716304 2:85363589-85363611 GAAAACGGACTAATACAATGGGG - Intronic
933943834 2:87267356-87267378 GAAAATGGACTAACACAACAGGG + Intergenic
934473239 2:94574635-94574657 GAGAACAGACTAATACAGCATGG + Intergenic
934482301 2:94662992-94663014 GAAAACAGACCAATACAGCTAGG - Intergenic
934880845 2:97977320-97977342 GAAAATAGCCTAATAAAACATGG + Intronic
934926654 2:98386619-98386641 GAGAACAGACTAATACAGGTAGG + Intronic
935026980 2:99286278-99286300 GAAAACAGACTAAGACAACTAGG + Intronic
935340399 2:102054520-102054542 GAAAAGATGCTAAGACACCATGG - Intergenic
935491534 2:103726588-103726610 CAAAAGAGACTCATAGACCAAGG - Intergenic
935755426 2:106272887-106272909 GAAAACAGCCCATTACTCCAAGG - Intergenic
935887670 2:107640809-107640831 TAAAACAGACTTACAAACCATGG - Intergenic
935970203 2:108523799-108523821 GAAAACAGACGAATGTACAAGGG - Intergenic
936336386 2:111594223-111594245 GAAAATGGACTAACACAACAGGG - Intergenic
936815075 2:116450493-116450515 GAATACAGGCTGATAAACCAGGG - Intergenic
937345012 2:121120027-121120049 GAAAATGGACTAATACAGTAGGG - Intergenic
937374350 2:121325384-121325406 GAGAACAGACTAATACAACAGGG - Intergenic
937448453 2:121978651-121978673 GAAAATGGACTAATACACCTGGG - Intergenic
937468027 2:122152041-122152063 AAGAACAGACTAATACAACTGGG + Intergenic
937496430 2:122425421-122425443 TGAAACAGACTAATACAGGAAGG - Intergenic
937498220 2:122448859-122448881 GAGAACAGATTAATACACTAGGG - Intergenic
938142808 2:128810778-128810800 GAGAACAGACTAATACACAGAGG + Intergenic
938165536 2:129022361-129022383 GAAAACAGACTAATACATGGGGG + Intergenic
938216211 2:129518912-129518934 GAGAATGGACCAATACACCAGGG - Intergenic
938943808 2:136192569-136192591 GAACTCTGACTAATACAGCATGG - Intergenic
938982032 2:136536226-136536248 GAAAACAGACTAATACAGGTGGG - Intergenic
939576349 2:143900204-143900226 GAATCCTGACTAATAGACCAGGG - Intergenic
939703118 2:145419396-145419418 GAAAACAGGCTAATACGCTGGGG - Intergenic
939820199 2:146948146-146948168 GAGAACAGACTAATACACAGGGG - Intergenic
939835362 2:147123963-147123985 GAGAACAGACTAATACAGGTAGG - Intergenic
940064126 2:149607736-149607758 GAAAACAGGCTAATACAGGTGGG + Intergenic
940198034 2:151117684-151117706 TAAAATAGACTAACACACCAAGG + Intergenic
940720993 2:157281377-157281399 AAAAATGGCCTAATACACCAAGG + Intronic
940860975 2:158770559-158770581 GAACTCTGACTAATACACCAAGG - Intergenic
941399991 2:165019205-165019227 AAAAAGAGACTGATACAACATGG - Intergenic
941524770 2:166593211-166593233 GAGAACAGAATAATACACCATGG + Intergenic
942140024 2:172968317-172968339 AATACAAGACTAATACACCAAGG - Intronic
942250290 2:174041897-174041919 GAGAACAGACTAATACGAAAGGG - Intergenic
942283142 2:174387916-174387938 GAAAACACACTAATACACAGTGG + Intronic
942339912 2:174932936-174932958 GAGAACAGACTAATACAGTTAGG + Intronic
942557410 2:177186119-177186141 GAAAACAGACTAATACAGTTTGG - Intergenic
942570657 2:177310875-177310897 AAAAACAGACTAATACAAACAGG - Intronic
942759132 2:179377800-179377822 AAAAACAGACACATAGACCAAGG - Intergenic
942831641 2:180243664-180243686 GAAAACAAACTATTACACCCGGG - Intergenic
943227987 2:185205808-185205830 GAGAACAGACGAATACACATGGG + Intergenic
943339144 2:186656502-186656524 AAAAACAGAAAAATACACAAAGG + Intronic
943438077 2:187892134-187892156 GAAAACAGACTAATACACTTGGG + Intergenic
943788318 2:191902544-191902566 GAAAACGGACTAATACAAGTAGG + Intergenic
943880849 2:193141992-193142014 GAAAATGGACTAATACTCCAAGG + Intergenic
943925661 2:193775494-193775516 AAAAACAGACACATAGACCAAGG - Intergenic
943943269 2:194026083-194026105 GAGAACAGACCAATACACCTAGG - Intergenic
944578271 2:201110935-201110957 CAAAACAGACTAAGACAGCTGGG - Intergenic
944827826 2:203503276-203503298 GAAAACAGACTAATACAGATGGG - Intronic
945157873 2:206858612-206858634 GAAAACAGACTAATACACCTTGG + Intergenic
945166488 2:206952751-206952773 GAGAACAGACTAATACACCATGG - Intronic
945212288 2:207396021-207396043 GAAGACAGAATACTACACCATGG + Intergenic
945328201 2:208507796-208507818 AAAAACAGACACATAGACCAAGG - Intronic
945347325 2:208733392-208733414 GATAACGGACTAATACAGTATGG - Intronic
945358039 2:208861503-208861525 GAAAATGGACTAATACACTTGGG + Intergenic
945396137 2:209321276-209321298 GAACTCTGACTAATACAGCAGGG - Intergenic
945480527 2:210339835-210339857 GAGAACGCACTGATACACCATGG - Intergenic
945570397 2:211459783-211459805 GAAAATGGACTAATACAGGAGGG + Intronic
945572089 2:211480639-211480661 GAGAACAGACTAATACACTTGGG + Intronic
945582997 2:211620667-211620689 GAAAACAGCCCAATACTCAAAGG + Intronic
945642528 2:212446662-212446684 GAACCCTGACTAATACACCAGGG + Intronic
945740915 2:213660197-213660219 GAATACAGAATAATGCACAAAGG + Intronic
945792339 2:214320466-214320488 GAAAATGGACTAATACAACCAGG - Intronic
946132357 2:217616596-217616618 CAAAATAGACTAAGACACAAAGG - Intronic
946169913 2:217888844-217888866 GAAAATGGACTAATACACCAGGG + Intronic
946483105 2:220075353-220075375 GAAAACAGACTAATATAGGCAGG + Intergenic
946492625 2:220164935-220164957 GAAAACAGACAAATACAGTAGGG - Intergenic
946519343 2:220448432-220448454 GTAAGCAGACTAATACATGAAGG + Intergenic
946531380 2:220574063-220574085 GAAAATGGACTAATACAGAAGGG - Intergenic
946696328 2:222363272-222363294 GAGAACAGACTAATACAGGGAGG + Intergenic
946832031 2:223736941-223736963 GAAAATGGACTAATACATAAAGG + Intergenic
947049605 2:226027463-226027485 GAGAACAGACTAATACATGGGGG - Intergenic
947208098 2:227680920-227680942 GAGAACAGACTAATACAGGTTGG - Intergenic
947237092 2:227952193-227952215 GAAAACAGGCTAATACACTGAGG + Intergenic
947381858 2:229552752-229552774 GAAAACTGACTAATACAGGTGGG + Intronic
947449223 2:230190904-230190926 CAAAACAGACATATAGACCATGG - Intronic
947466438 2:230352242-230352264 GAGAATGAACTAATACACCAAGG - Intronic
947513187 2:230777833-230777855 GGAAACAGACAAGTACACAAAGG - Intronic
947782841 2:232785142-232785164 CAAAATGGACTAATAAACCAAGG + Intronic
947912428 2:233810193-233810215 TAACACGAACTAATACACCACGG - Intronic
948034862 2:234850192-234850214 GAGAACAGACCAACACACCTGGG - Intergenic
948173424 2:235924864-235924886 GTAAACAGACTGGTACAACAGGG - Intronic
948240721 2:236431207-236431229 GAGAATGGACTAATACACCTGGG - Intronic
948310704 2:236983814-236983836 GAAAATGGACTAATACAACCAGG + Intergenic
948450400 2:238066739-238066761 GAGAACAGACTAATACACTCAGG - Intronic
948532419 2:238618281-238618303 AAAAACAGACTCATATAGCAAGG - Intergenic
948551264 2:238774446-238774468 GAAAATGGACTAATACAGCAGGG - Intergenic
948783245 2:240337607-240337629 GAAAACAGACTAAAACAACCAGG - Intergenic
948898194 2:240938093-240938115 GAGAACAGACTGATACACCTGGG + Intronic
1168827963 20:826678-826700 GAAAACGAACTAATACAGCACGG + Intergenic
1169261412 20:4141156-4141178 GAAAAGACACTAATAGACCCAGG - Intronic
1169498165 20:6134294-6134316 GAAAATGAACTAATACACCCTGG + Intergenic
1169770088 20:9190553-9190575 GAGAACAGACTAATAGAGCTGGG + Intronic
1169847318 20:10008526-10008548 GAGAACAGACTAATATACCAGGG + Intronic
1170213923 20:13872588-13872610 GAGAACGGACTAATACAGAAGGG + Intronic
1170532577 20:17309462-17309484 GAGAACATACTAATACACTATGG - Intronic
1170560017 20:17549244-17549266 GAGTACAGACTAATACAACCAGG - Intronic
1171007807 20:21484415-21484437 AAAAACAGATTAAGACCCCAAGG + Intergenic
1171092085 20:22294785-22294807 GAAAATGGACTAATACAGAAGGG + Intergenic
1171093782 20:22312001-22312023 GAGAACAGGCTAATACAGCGTGG - Intergenic
1171232349 20:23497535-23497557 GAGAACAGACTAATACATATAGG - Intergenic
1172909968 20:38401346-38401368 GAAAATGGACAAATACACTATGG - Intergenic
1173079458 20:39851762-39851784 GAAAGCAGTCAAATACTCCACGG - Intergenic
1173172196 20:40736453-40736475 GAGAATGGACTAATACAGCAAGG - Intergenic
1173317958 20:41961845-41961867 GAGAACAGACTAATACAGCTAGG + Intergenic
1173393622 20:42657296-42657318 GAGGACGGACTAATACACCAAGG + Intronic
1173413359 20:42835279-42835301 GAAAACAAAATAATAAAGCAAGG + Intronic
1173492917 20:43497921-43497943 GAAAACAGACTAAGACAGGTGGG + Intergenic
1173584170 20:44169502-44169524 CAAAATTGACTAAGACACCAAGG + Intronic
1173946664 20:46956739-46956761 GAGAACAGACTAATACAGGCAGG - Intronic
1173964715 20:47103425-47103447 GAAAATGGACTAATACACAATGG - Intronic
1174532421 20:51224652-51224674 GAAAACACACTAATACTTCCTGG + Intergenic
1174666216 20:52260462-52260484 GAACCCTGACTCATACACCAGGG + Intergenic
1175024236 20:55884788-55884810 GAAAACAGACAAATACAGATGGG + Intergenic
1175290507 20:57872035-57872057 GAGAACAAACTAATACAGTAGGG - Intergenic
1175611851 20:60358239-60358261 GGAAACAGACTATTACAGCAGGG + Intergenic
1175767399 20:61601009-61601031 GAGAACAGACTAACACACAAGGG - Intronic
1176424062 21:6536980-6537002 GAAAACGGACTAATATACCCAGG + Intergenic
1177028875 21:15956551-15956573 GAACCCTGACTAATACATCATGG + Intergenic
1177347331 21:19890735-19890757 GAAAACAGACTGTTACACTCAGG + Intergenic
1177446252 21:21200113-21200135 GAGAAGAGAGTAATAAACCAAGG + Intronic
1177686109 21:24439360-24439382 GAAAACAGACTAATGCAACATGG - Intergenic
1177686701 21:24446913-24446935 GAACACAGACTAATACATGGAGG - Intergenic
1177784259 21:25653395-25653417 GAAAACAGACTAATACACCAGGG - Intronic
1177784617 21:25657675-25657697 GAAAAAAGACTCATACAATAAGG - Intronic
1177828468 21:26109600-26109622 GAGAACAGACTAATACACCCTGG + Intronic
1177842104 21:26246087-26246109 GAAAACAAACTAATATACCCAGG + Intergenic
1177871734 21:26580941-26580963 GAGAATAGACTAATGCACCAGGG + Intergenic
1177877016 21:26646141-26646163 GAGAACAGACTAATACACCAAGG - Intergenic
1177925701 21:27211808-27211830 GAAAATGGACTAATACACAAGGG + Intergenic
1178028567 21:28496820-28496842 GAGAACAGACTAATACAGCTGGG - Intergenic
1178122637 21:29484876-29484898 AAAAACGGACTAATACAACAGGG - Intronic
1178251423 21:31007143-31007165 GAGAGCAGACTAATATACCAGGG - Intergenic
1178261506 21:31104354-31104376 AAGAACAGACTAATACACGGGGG - Intergenic
1178365247 21:31984828-31984850 GAGAACAGACTAATAGACCTGGG - Intronic
1178374719 21:32057212-32057234 GAGAACGGACTAATACAGTAAGG - Intergenic
1178638753 21:34329125-34329147 AAGAACAGACTAATACACCTAGG - Intergenic
1178683681 21:34694748-34694770 GAGAATGGACTAATACACCTTGG + Intronic
1178694648 21:34782258-34782280 GAAAACAGACTAATACAGACTGG + Intergenic
1178696255 21:34795235-34795257 AAAAACAGATTAATCCACCTTGG - Intronic
1178774197 21:35533523-35533545 GAGAACAAACTAATACAAGAGGG + Intronic
1179699555 21:43145295-43145317 GAAAACGGACTAATATACCCAGG + Intergenic
1179899788 21:44384237-44384259 TAAAACAGACTAACACATCTAGG - Intronic
1180168241 21:46041138-46041160 GAGAACAGACAAATACACAGGGG + Intergenic
1180686332 22:17669960-17669982 GAAAATGGACTAATACACATGGG + Intronic
1181278186 22:21700091-21700113 GTCAACAGACTTATACACTAAGG - Exonic
1181393136 22:22598574-22598596 GAACATGGACTAAAACACCAGGG - Intergenic
1181875879 22:25940479-25940501 GAGAACAGACTAATACGCATGGG + Intronic
1182029346 22:27145416-27145438 GAAAACAGGAGAATTCACCATGG + Intergenic
1182364749 22:29770980-29771002 GAAAATGGACTAATACACAAGGG + Intergenic
1182811610 22:33121684-33121706 AAGAACAGACTAATACAGAAGGG - Intergenic
1183029338 22:35091672-35091694 GAAAACATGCTAATACAGAATGG - Intergenic
1184312096 22:43652464-43652486 GAAAACGGACTGATACACCCAGG + Intronic
1184350204 22:43938325-43938347 GAGAACAAACTAATGCACCTGGG - Intronic
1184559765 22:45255405-45255427 CAAAACAGACCAAAACACCAGGG - Intergenic
1184837396 22:47032055-47032077 GAAAACAGACAACTCTACCACGG - Intronic
1184891689 22:47383369-47383391 GAGAACAGACTAATACACCAAGG + Intergenic
1185102475 22:48849021-48849043 ACAAACAGACAAACACACCAGGG + Intronic
1185124412 22:48999284-48999306 GAAAACAGACAAATACACCATGG - Intergenic
949204045 3:1416896-1416918 GAGAACAGACTAATACAACTGGG - Intergenic
949236810 3:1818914-1818936 GAAAACAGTCAAATGGACCAGGG + Intergenic
949363156 3:3253086-3253108 GAAAACGGACTAATACAGTGTGG - Intergenic
949400842 3:3663992-3664014 GAGAACAGACTAATACACATGGG + Intergenic
949607934 3:5675070-5675092 AAGAACGGACTAATGCACCAAGG - Intergenic
949693128 3:6663336-6663358 GAAAACAGAGTAATACGGCTGGG - Intergenic
949745946 3:7292139-7292161 GAAAACACACTAATACAGGAGGG + Intronic
949834322 3:8251639-8251661 GAGAACAGAGTGATACAACACGG - Intergenic
950315329 3:11996906-11996928 GAAAACAGAGTCATAGTCCAAGG - Intergenic
951236991 3:20248390-20248412 GAGAACAGACTCATACACGTGGG - Intergenic
951292253 3:20886613-20886635 AAAGACAGACTAATAGATCAAGG - Intergenic
951693108 3:25417696-25417718 GAAAATAGACTAATACAGCCTGG + Intronic
952081638 3:29765737-29765759 GAAAACAAACTAATACAATAGGG - Intronic
952141491 3:30483735-30483757 AAAAACAGACACATAGACCAAGG + Intergenic
952170107 3:30798233-30798255 GAAAACAGACTAAAACAGAAGGG - Intronic
952546585 3:34426647-34426669 AAAAACAGACACATAGACCAAGG + Intergenic
952620171 3:35328744-35328766 GTGAACAGACTAATACACATGGG - Intergenic
953081264 3:39620843-39620865 CAAAACAGACTAATACACTATGG - Intergenic
953537982 3:43790308-43790330 GAAGACAGACGGATACACCCTGG + Intergenic
953542133 3:43830191-43830213 GAAAACAGACGAATGCAATAAGG - Intergenic
953864161 3:46569668-46569690 AAAAACAGACACATAGACCATGG + Intronic
955146733 3:56327109-56327131 GAAAATGGACTAATACACATTGG - Intronic
955471728 3:59293826-59293848 GAAAATAGACTAATACACCAAGG - Intergenic
955834938 3:63044463-63044485 GAGAACAAACTAATATACCCGGG - Intergenic
955868886 3:63416585-63416607 GAAAACGGACTAATACACTGAGG - Intronic
955931811 3:64065028-64065050 GAACCCGGACTAATACCCCATGG - Intergenic
956035869 3:65091138-65091160 AAAAACAAACTAAAACAGCAAGG - Intergenic
956256461 3:67288309-67288331 GAAAACAGACTAATACAATTAGG + Intergenic
956268345 3:67423393-67423415 GAGAATGGACTAATACACCTAGG + Intronic
956284155 3:67590761-67590783 AAGAACAGACTAACACAACAGGG + Intronic
956550762 3:70456430-70456452 GGAAACGAACTAATACAACAAGG - Intergenic
957166167 3:76676469-76676491 GAAAACGGACTAATACAACAAGG + Intronic
957280595 3:78146321-78146343 AAAAACAGACACATAGACCAAGG - Intergenic
957307329 3:78474430-78474452 GAAAACAGAAAAAAAAACCAGGG + Intergenic
957475287 3:80714538-80714560 CAAAACAGATATATACACCATGG + Intergenic
957489869 3:80909785-80909807 CAAAACAGATATATACACCATGG + Intergenic
957555305 3:81759169-81759191 GAAAACGGACTAATACAGAAGGG + Intronic
957561441 3:81826810-81826832 GAAAACGGACTAATGCAACATGG + Intergenic
957604773 3:82382890-82382912 GAATGCAGACTGGTACACCAGGG + Intergenic
958543582 3:95511137-95511159 GAAAACATACTAATACAGTTGGG + Intergenic
958569867 3:95865168-95865190 CAAAACAGACATATAGACCAAGG + Intergenic
958602288 3:96312003-96312025 CAAAACAGACTAAGACATCTAGG - Intergenic
958736632 3:98016566-98016588 ACAAACAGACTAAGACAACAAGG + Intronic
958832887 3:99110999-99111021 GAGAACAGACTAATACATCTGGG - Intergenic
959113650 3:102151122-102151144 GAGAACAGACTAATACACTGGGG - Intronic
959214661 3:103436580-103436602 GAAAACGGACTAATACAGAGAGG - Intergenic
959252381 3:103965320-103965342 GAAAACATACATATACAACATGG + Intergenic
959492052 3:107001982-107002004 GAGAACAGACTAATACAAGAGGG - Intergenic
960009408 3:112817048-112817070 GAGAACAGACTAATACAACCAGG + Intronic
960139457 3:114138283-114138305 GAAAACAGGCTAATACACTCAGG - Intronic
960502350 3:118453431-118453453 GAAAACAAACTAATACACTGGGG + Intergenic
960660857 3:120056806-120056828 GAAAACAGCATAATACACAAGGG + Intronic
961050145 3:123738845-123738867 GAGAACAGACTAATACAGGCTGG + Intronic
961108373 3:124261452-124261474 GAAAACAGGCTAATCTTCCAAGG - Intronic
961398753 3:126618363-126618385 GAAAACAGACACATAGACTATGG + Intronic
961503937 3:127357724-127357746 GAGAACAGACTAATACAGTAAGG - Intergenic
961788406 3:129361039-129361061 GAAAACAGACTAATACACTCAGG - Intergenic
962322500 3:134403449-134403471 GAAAATGAACTAATACACCATGG + Intergenic
962461824 3:135621307-135621329 GAAAACAGACTGTTAAAACATGG + Intergenic
962509658 3:136085449-136085471 GAGAACAGACTAATACAGATGGG + Intronic
962635047 3:137322687-137322709 GAAAACAGACTAATGCAGGCAGG - Intergenic
963022410 3:140885288-140885310 GAGAACAGACTAATACAGTAAGG + Intergenic
963062204 3:141234070-141234092 GAACTCAGACTAATTCACCGGGG - Intronic
963083868 3:141418985-141419007 GAAAACAGACTAATACAATATGG - Intronic
963267148 3:143250760-143250782 GGAAATGGACTAATACACAAGGG + Intergenic
963333743 3:143947526-143947548 GACAACAGACTAATACATGCTGG - Intergenic
963419027 3:145035499-145035521 GAGAACAGACTAATACAACATGG + Intergenic
963471466 3:145747419-145747441 GAAAATGAACTAATACAGCATGG - Intergenic
963572712 3:147017218-147017240 GAGAACAGACTAATACAAAGTGG + Intergenic
963913696 3:150838546-150838568 GAACACTGACTAATAAAACAGGG - Intergenic
963916521 3:150863964-150863986 GAAAATGGACTAATACACCCAGG - Intergenic
964252366 3:154733281-154733303 AAAAACAGACTAATACACAGGGG + Intergenic
964600182 3:158491935-158491957 GAAAATGGACTAATACACACAGG - Intronic
964605925 3:158559898-158559920 GAAAACAGACTAATACAAATAGG + Intergenic
964654715 3:159053151-159053173 GAAAACGAACTAATACACCTGGG + Intronic
965087649 3:164119940-164119962 GAAAATAAATTAATACAACAAGG + Intergenic
965131883 3:164711440-164711462 GAAAACAGACACACAGACCAAGG + Intergenic
965152906 3:165005208-165005230 GAAAATAGACTAATACAGCAGGG + Intronic
965581961 3:170278331-170278353 CAAAACAGACTAACACACAAGGG - Intronic
965632170 3:170744275-170744297 GAGAACAGACTAATACATCAAGG - Intronic
965978202 3:174652351-174652373 GAGAACAAACTAATACATTATGG - Intronic
966314651 3:178632308-178632330 GAGAATGGACTAATACACCATGG - Intronic
966466103 3:180232814-180232836 GAAAACAGACTACTACATGTGGG - Intergenic
966627708 3:182036634-182036656 GAAAATGGACTAATACAGAAAGG - Intergenic
966644100 3:182223829-182223851 AAAAACAGACACATAGACCAAGG - Intergenic
966824557 3:183952825-183952847 AAAAATGGACTAATACACAACGG + Intronic
967406361 3:189119852-189119874 GAGAACAGACTAATACACGCAGG + Intronic
967551673 3:190802073-190802095 GCAAACAGACTAATACACAAAGG + Intergenic
967698365 3:192562017-192562039 AAAAACAAATAAATACACCATGG + Intronic
968483263 4:846379-846401 GAGAACAGACTAACACACCTGGG + Intergenic
968524973 4:1052060-1052082 TAGAACAGACTAATACAGCAGGG + Intergenic
968789896 4:2652368-2652390 AAGAATGGACTAATACACCAGGG - Intronic
968937380 4:3618610-3618632 GAGAAAGGACTAATACACCATGG - Intergenic
969049773 4:4364445-4364467 GAAAATTGACTAATAAACTAGGG - Intronic
969074861 4:4569901-4569923 GAAAACAGACAAATACAGATAGG - Intergenic
969081753 4:4624539-4624561 GAAAACAAACTAATACAGATGGG - Intergenic
969120704 4:4908788-4908810 GAAGACAGACACATAGACCAAGG + Intergenic
969333208 4:6491946-6491968 GAGAACAGACTAATACAGCCGGG + Intronic
969863478 4:10055984-10056006 GAAAACAGACTAATACAAGTGGG + Intergenic
969883664 4:10196513-10196535 GAAAAGAGACTCTTACACCTTGG - Intergenic
970026272 4:11627359-11627381 GATAACAGACTGATACACAGGGG - Intergenic
970279933 4:14443884-14443906 GAAAATGGACTAATACATCTGGG + Intergenic
970313532 4:14807782-14807804 GAAAAGGGACTAATACACCATGG - Intergenic
970381982 4:15517714-15517736 GATAACAGATTAATACACCCAGG - Intronic
970416348 4:15861571-15861593 GAGAACAGACTAATACAACATGG + Intergenic
970419153 4:15888810-15888832 GAGAACTGACTAATACAACAGGG + Intergenic
970482231 4:16487949-16487971 GAGAACAGACTAATCCAGGAGGG - Intergenic
970745550 4:19290660-19290682 AAAAACAGACACATAGACCAGGG - Intergenic
970799703 4:19958120-19958142 GAAAATGGACTAATACACCCAGG - Intergenic
970991529 4:22218675-22218697 GAAAACAGACTAATACACCCAGG - Intergenic
971036660 4:22700810-22700832 GAAAGCAGACTAATACAGTCAGG + Intergenic
971042755 4:22772829-22772851 GAGAACAGACTAATACAATGTGG - Intergenic
971070128 4:23081462-23081484 GAAAATGGACTAATACAACTGGG + Intergenic
971251248 4:24975244-24975266 CAAAACAGACTAAAACAGGAAGG + Intronic
971263639 4:25078735-25078757 GAAAACAGACTAATACACCAGGG - Intergenic
971533169 4:27714847-27714869 GAAAACAGACTAATACAAGTTGG + Intergenic
971670106 4:29545631-29545653 GAAAATAGACTAATACAATCAGG - Intergenic
972296630 4:37745508-37745530 GAGAATAGACTAATACAGCAGGG - Intergenic
972300398 4:37780288-37780310 GAGAACAGACTAATACATAAGGG - Intergenic
972384433 4:38550859-38550881 GAAAACAGACTAATACGCCATGG + Intergenic
972568102 4:40286860-40286882 GAGAACAAACTAATACACATGGG - Intergenic
972664391 4:41150023-41150045 GAAAATGGACTAATACACTGGGG + Intronic
972688900 4:41377586-41377608 GAAAACAAACCAAGGCACCAAGG - Intronic
972792560 4:42387112-42387134 GAAAATGTACTAATACACCATGG - Intergenic
972832074 4:42826061-42826083 TAAAACAGTCTAAAACACTATGG - Intergenic
972871186 4:43300781-43300803 GAAAACTGATTAACACAGCAGGG - Intergenic
973529921 4:51826252-51826274 AAAAACAGACACATAGACCAAGG - Intergenic
974022903 4:56707449-56707471 GAGAACGGACTAATACATGAGGG - Intergenic
974321898 4:60361233-60361255 GAAAACACAATAATAAAGCAAGG + Intergenic
974465036 4:62244363-62244385 GAAAACAGACTAATACAAATGGG - Intergenic
974606654 4:64160388-64160410 GAAAACGGACTAATCCAATATGG + Intergenic
974913949 4:68156762-68156784 AAAAACAGACAAATAGACCAGGG - Intergenic
975213509 4:71728308-71728330 GAGAATAAACTAATACACCTGGG + Intergenic
975237191 4:72013304-72013326 GAGAATGGACTAATACAGCATGG - Intergenic
975253810 4:72211984-72212006 GAAAATGGACCAATACACCTGGG - Intergenic
975312476 4:72918078-72918100 CCAAACAGACTAAGACACTAAGG - Intergenic
975327872 4:73080488-73080510 GAAAACAGACAAAAACTACAAGG + Intronic
975367202 4:73543962-73543984 GAAAACTGACAAATACACAGAGG + Intergenic
975422748 4:74188180-74188202 TGAAGCAGACTAATACACCACGG - Intronic
975438100 4:74377572-74377594 GAAAACAAACTAATACAACCAGG - Intronic
975636811 4:76458149-76458171 AAGAACGGACTAATACAACATGG + Intronic
975876026 4:78837969-78837991 GAAAATGGACTAATACAGCAAGG - Intronic
976214313 4:82701270-82701292 GAAAATAGACTTATACAAAATGG + Intronic
976259723 4:83134446-83134468 GAAAACAGACTAATACAAGTGGG - Intronic
976364966 4:84222972-84222994 GAAAACAGACTAATACAATGGGG - Intergenic
976395598 4:84551686-84551708 GAGAACAGACTAATACACTGGGG - Intergenic
976750477 4:88447275-88447297 GAGAACAGACTAATAGAGCTGGG - Intergenic
976769855 4:88639384-88639406 CAAAACAGACTTATAGACAATGG + Intronic
976947661 4:90790587-90790609 GAAAACAAACACATAGACCAAGG - Intronic
977013949 4:91669451-91669473 GAAAATGGACTAATACATGAAGG - Intergenic
977028758 4:91855794-91855816 GAAAACACAGTAAGACATCATGG - Intergenic
977051862 4:92138246-92138268 GAGAACAGACTAATACAAATAGG - Intergenic
977053524 4:92161245-92161267 GAGAACAGACTAATACAACCAGG - Intergenic
977221591 4:94344309-94344331 GAAAGCAGAGTAACACATCAAGG + Intergenic
977235946 4:94507272-94507294 GAACCCTGACTAATACACCCTGG + Intronic
978154146 4:105471129-105471151 GAAAACCTAATAATATACCATGG + Intronic
978176495 4:105738236-105738258 AAAAACAGACACATAGACCAAGG - Intronic
978396026 4:108281074-108281096 GAAAATGGACTAATACACATTGG - Intergenic
978690062 4:111497256-111497278 GAGAACAGACTAATACAGGCTGG + Intergenic
978969313 4:114783657-114783679 GGAAACAGACAAATACACTTAGG + Intergenic
979046632 4:115873960-115873982 GAGAACAGACTAATACACCCAGG - Intergenic
979090040 4:116471387-116471409 GAGAACAGACTAATACAACTTGG + Intergenic
979203284 4:118005021-118005043 GAGAATGGACTAATACACCCTGG - Intergenic
979366255 4:119827934-119827956 AAGAACAGACTAATACAATATGG - Intergenic
979590274 4:122471010-122471032 GAGAATAGACTAATACACCATGG + Intergenic
979799430 4:124889746-124889768 GAGAACAGACTAATACAACCAGG + Intergenic
979856040 4:125636131-125636153 GAAAACTGACTAATACAGTTGGG - Intergenic
979899952 4:126203206-126203228 GAAAGCAGACTAATACGCAGAGG - Intergenic
980001449 4:127493841-127493863 GAAAACAGACAAATACATTTTGG - Intergenic
980096732 4:128499484-128499506 GAAAACAAACTAATACAAGAAGG - Intergenic
980476773 4:133328579-133328601 GAGAACAGACTAATACAATGTGG - Intergenic
980616203 4:135229025-135229047 GAAAACAGACTAAGACAGAAGGG - Intergenic
980746242 4:137020399-137020421 GAAAATTGACCAGTACACCAGGG + Intergenic
981277180 4:142914301-142914323 AAACCCTGACTAATACACCAAGG - Intergenic
981392591 4:144209374-144209396 GAAAACAGACTAATACACTCAGG - Intergenic
981422138 4:144563401-144563423 CAAAACAGACTAAGACCTCAGGG - Intergenic
981422564 4:144567825-144567847 GAAAACAGACTAATGCACCTAGG + Intergenic
981427112 4:144616325-144616347 GAGAACAGACTAATACACATGGG + Intergenic
981530004 4:145743204-145743226 CAAAACAGACTAAGACAGAAGGG - Intronic
981694791 4:147549418-147549440 GAAAACGGACTAATACATATGGG + Intergenic
981724527 4:147833514-147833536 GAAAACAGACTAATTCATGTGGG + Intronic
981780247 4:148421023-148421045 AAGAACAGACTAATACACCCAGG + Intronic
981878410 4:149577578-149577600 AAAAACAGACATATAGACCAAGG - Intergenic
982302528 4:153894474-153894496 GAAAACGGACTAATATACTCAGG - Intergenic
982320623 4:154073214-154073236 GAGAACAGACTAATACAGCATGG - Intergenic
982392753 4:154883876-154883898 GAAAATGGTCTAATATACCATGG - Intergenic
982417391 4:155151995-155152017 GAAAACAAACTAATACACAGAGG - Intergenic
982829390 4:160042175-160042197 GAAAATGAACTAATACACCAGGG - Intergenic
982977797 4:162089263-162089285 AAACACCGACTAAGACACCAAGG + Intronic
982995770 4:162342969-162342991 GAGAACAGACTAATACAGGTGGG - Intergenic
983578870 4:169287993-169288015 GAAAACAGACTAATACAGGGGGG - Intergenic
983645390 4:169985209-169985231 AAAAACATACTAATCAACCAAGG + Intergenic
983772537 4:171569721-171569743 GAAAATGGACTAATACACTTGGG - Intergenic
983967407 4:173829727-173829749 TAGAACAGACTAACACACCTGGG + Intergenic
984065926 4:175048062-175048084 GAGAGCAGACTAATACATGAGGG + Intergenic
984403643 4:179299449-179299471 GAACCCTGACTAATACACCAAGG - Intergenic
984553155 4:181184407-181184429 GAAAACGGACCAGTACACCCAGG - Intergenic
984753191 4:183298448-183298470 GAAAAGAGACTATAACAGCAAGG + Intronic
984818472 4:183859325-183859347 GAAAACAGACAAATGCAACAGGG + Intronic
984946362 4:184971718-184971740 GAAAACAGACTAATACACCATGG + Intergenic
986029659 5:3882487-3882509 GAGAACAGACTAATACACTGAGG + Intergenic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986080961 5:4394026-4394048 GAAAACAGACTAATACAAGTGGG - Intergenic
986085053 5:4436794-4436816 GAAAATGGACTAATACAAAAGGG - Intergenic
986173006 5:5328775-5328797 GAAAACGGACGAATACACCCTGG - Intergenic
986289878 5:6391192-6391214 GAGAACAGACTAACACACCCAGG + Intergenic
986305385 5:6510467-6510489 GAGGACAGACTAATACAGGAGGG - Intergenic
986424296 5:7614874-7614896 GAGAACAGACTAATACAAGGAGG - Intronic
986878943 5:12146742-12146764 GAGAACAGACTAATACAGCCAGG - Intergenic
986993866 5:13584126-13584148 AAAAACAGACTCATAGACCAAGG - Intergenic
987006610 5:13716896-13716918 GAAAACATACGAATGCATCAAGG - Intronic
987047435 5:14120886-14120908 GAAAACAGCCTAATACAGGAGGG - Intergenic
987097757 5:14565369-14565391 GAAAACAGAGTAATACATAGTGG - Intergenic
987441650 5:17964414-17964436 GAAAACAGACTAATACAGTTTGG - Intergenic
987717624 5:21592733-21592755 GAAAACAGACTAATACACACAGG - Intergenic
987718513 5:21604722-21604744 GAAAACGAACTAATACAATATGG - Intergenic
987908920 5:24116231-24116253 AAAAACAGACACATAGACCAAGG - Intronic
988137959 5:27199947-27199969 GAAAACAGACTAATACACTTGGG - Intergenic
988274839 5:29068188-29068210 GAGAATGGACTAATACACTAGGG - Intergenic
988275922 5:29080889-29080911 GAAAACAGACTGATACAGGGTGG + Intergenic
988376794 5:30446690-30446712 GAAATTAGACTAAAACATCAAGG + Intergenic
988421428 5:31010378-31010400 GAGAACAGACTAATACACAAAGG + Intergenic
988425331 5:31057196-31057218 GAAAACAGACTAATACATTATGG - Intergenic
988679338 5:33469445-33469467 GAACCCTGACTAATACACAAGGG + Intronic
988701460 5:33679275-33679297 GAAAATGGACTAATACAGGAAGG - Intronic
989000284 5:36752689-36752711 GAATCCTGACTAATACACCCTGG + Intergenic
989003511 5:36784997-36785019 GAAAACAGACTAACACATTTAGG - Intergenic
989212390 5:38868702-38868724 GAAAACTGACTAATATAGTAGGG + Intronic
989297518 5:39847285-39847307 GAAAATATACATATACACCACGG - Intergenic
989476429 5:41879291-41879313 CAAAACAGACTAAGATAACAAGG + Intergenic
989651453 5:43695648-43695670 GAAAATGGACTAATACACCTTGG - Intronic
989751331 5:44897230-44897252 GAAAATAGACTAATACAAAATGG + Intergenic
989752605 5:44913833-44913855 GAAAACAGACTAATACATCTGGG - Intergenic
989985668 5:50694638-50694660 GAACCCAGACTAATACAGCCAGG - Intronic
990092091 5:52064325-52064347 GAGAACAGACTAATAGACAAAGG + Intronic
990105724 5:52257155-52257177 TAAAACAGCAAAATACACCATGG - Intergenic
990144644 5:52745279-52745301 GAACCCTGACTAATACACTAGGG - Intergenic
990304370 5:54480331-54480353 GAAAACAGACTAATACAACAGGG + Intergenic
990728598 5:58784223-58784245 GAGAACAGACTAATACACCCAGG - Intronic
990849954 5:60191627-60191649 GAAAACAAACTAATAATACAGGG + Intronic
990891591 5:60656520-60656542 GAAAACAGACTAATACAGTGGGG - Intronic
991038689 5:62154169-62154191 GGAAACAGACTAATACAATGTGG - Intergenic
991111498 5:62905162-62905184 GAAAACAGACTAATATACAAGGG - Intergenic
991158506 5:63467000-63467022 GAAAACGGACTAATACATCAGGG + Intergenic
991429631 5:66530770-66530792 GAGAATAGACTAATATAGCAAGG - Intergenic
991518382 5:67465844-67465866 CAAAACAGACTAAGACAACTAGG + Intergenic
992336780 5:75778924-75778946 AAAAACTGACAAATACACAAGGG + Intergenic
992458840 5:76941590-76941612 GAGAACAGAGTAGTACACAAGGG + Intergenic
992631962 5:78690360-78690382 GAAACCGGACTAATACACTAAGG + Intronic
992721034 5:79561489-79561511 AAGAACAGACTAATACAGTAGGG - Intergenic
992830047 5:80585187-80585209 GGAAACAGACCAATACAACTGGG + Intergenic
992903531 5:81322624-81322646 GAGAACAGACTAATACACCAAGG - Intergenic
993127121 5:83849155-83849177 GGGAACAGACTAATACAATAGGG + Intergenic
993283368 5:85957925-85957947 GAAAACAGATTAATACACCATGG + Intergenic
993404523 5:87494783-87494805 GGGAACAGACTAATACACCTGGG + Intergenic
994081973 5:95717032-95717054 GAGAACAGACTAATACAGCTGGG + Intronic
994146944 5:96405958-96405980 AAACACAGACTACTACCCCAGGG - Intronic
994614089 5:102081590-102081612 GAAAACAGACTAATACAGGTTGG - Intergenic
994864767 5:105253177-105253199 GAAATCAGACTAATATAGGAGGG + Intergenic
994919929 5:106031014-106031036 GAAAACAGACTAATACACCCAGG - Intergenic
995181950 5:109237806-109237828 GAGAACAGACTAATACATGTGGG + Intergenic
995244338 5:109919533-109919555 GAAAATGGACTAATACACCCTGG + Intergenic
995357690 5:111258349-111258371 GAAAACAAACTAATACAAATAGG - Intronic
995415884 5:111912396-111912418 GAAAACAGACTAGTAGTCAAGGG - Intronic
995621515 5:114031034-114031056 GAAAACAGACTACTACACTTGGG - Intergenic
995703920 5:114965414-114965436 GAGAACAGACTAATAAAACCAGG + Intergenic
996010252 5:118474454-118474476 GAGAACAGACTAATACAACTGGG - Intergenic
996282719 5:121750880-121750902 GAAAACAGACTAATGCAATATGG - Intergenic
996333134 5:122353826-122353848 GAAAATGGACTAATACGGCAGGG + Intronic
996768160 5:127056308-127056330 GAAAACGGACTAATTCATCATGG - Intronic
996774590 5:127120108-127120130 GAGAACAGACTAATACACCTTGG - Intergenic
996872121 5:128203250-128203272 GAAAACGGACTAATGCACAGGGG + Intergenic
996975812 5:129433188-129433210 GAGAACAGACTACTACAACCTGG - Intergenic
997065471 5:130554382-130554404 GAGAATGGACTAATGCACCAAGG - Intergenic
997147663 5:131454438-131454460 GAAAACAGATTAAGACCCAAAGG + Intronic
997188729 5:131909210-131909232 AAAAACAGACACATAGACCAAGG + Intronic
997222877 5:132183741-132183763 AAGAACAGACCAATGCACCATGG - Intergenic
997652151 5:135530417-135530439 GAAAACTGACTAATACAGATGGG - Intergenic
997770078 5:136545600-136545622 AAAAACAGGCATATACACCAAGG - Intergenic
998256014 5:140589093-140589115 AATCACAGATTAATACACCAGGG - Intronic
998631776 5:143906605-143906627 GAAAACAGACGAGTACACTTGGG - Intergenic
998687716 5:144548750-144548772 GAGAATGGACTAATACAGCATGG + Intergenic
999406399 5:151310753-151310775 AAAAACAAACAAAAACACCATGG - Intergenic
999425674 5:151486005-151486027 GCAAATGGACTAACACACCAGGG - Intronic
999504249 5:152179048-152179070 GAAAACTGACTAATACAAGTGGG - Intergenic
999589670 5:153131206-153131228 GAGAACAGACTAATATGCCAGGG - Intergenic
999918657 5:156292558-156292580 GAAGAGATATTAATACACCAAGG - Intronic
1000032169 5:157412178-157412200 AAAAACAGACACATAGACCAAGG + Intronic
1000672783 5:164083013-164083035 GAAAACCAAATAATACAACATGG - Intergenic
1000973036 5:167735985-167736007 GAGAACAGACTAATACACTTTGG - Intronic
1001216757 5:169863707-169863729 GAAAACAACCCAACACACCAGGG + Intronic
1001500113 5:172224806-172224828 GAAAACAGACTAATACAGAGAGG + Intronic
1001607611 5:172973639-172973661 GAAAACAAGCTAATACCCCATGG - Intergenic
1001627579 5:173149181-173149203 GAAAACAGACTAATACAGATGGG - Intronic
1001739331 5:174037694-174037716 ACAAAAAGAATAATACACCATGG - Intergenic
1002463024 5:179386044-179386066 GAGAACAGCCTAATACAGCAAGG + Intergenic
1003705426 6:8523022-8523044 GATAACAGAGACATACACCATGG + Intergenic
1003811718 6:9790023-9790045 AAAAACAAACTAAGACACAAGGG + Intronic
1003857303 6:10289639-10289661 GAAAACAGACTAATACAGGCAGG - Intergenic
1003897825 6:10624203-10624225 GAAAACGGACTAATACACCTTGG - Intronic
1003977863 6:11360794-11360816 GAGAACTGACTAATACATCAGGG + Intronic
1004173542 6:13318265-13318287 AAAAACAGACTAATACAATGAGG + Intronic
1004181297 6:13382594-13382616 GAGAACAGACTAATACAAGTTGG + Intronic
1004189259 6:13449865-13449887 GAAAACATACTAATACACTAAGG + Intronic
1004711403 6:18174144-18174166 AAAAACAGATTAATGCAACAGGG - Intronic
1004858389 6:19775372-19775394 GAAAACAGACTAATACAGTATGG - Intergenic
1004951214 6:20673903-20673925 GAAAACAGACTAATACACGATGG + Intronic
1004993856 6:21169291-21169313 GAAAACAGATGAACCCACCAAGG - Intronic
1005331434 6:24754443-24754465 GAAAACAGACCAATACAAGGTGG - Intergenic
1005802794 6:29444370-29444392 GAAAACAGACTAATACACCTTGG + Intronic
1005819176 6:29582972-29582994 GAAAACTGACAAATACACACAGG + Intronic
1005982830 6:30850565-30850587 GAAAACGGACTAATACGGCTGGG + Intergenic
1006721551 6:36156326-36156348 AAGAACGGACTAATGCACCAGGG - Intergenic
1007004580 6:38348591-38348613 GGAAACAGACTGTTACACTATGG - Intronic
1007289304 6:40773203-40773225 GAAAACAAACTAATACAGAGGGG - Intergenic
1007965486 6:46000514-46000536 GAAAACAAACCAATACACCAGGG - Intronic
1008025775 6:46634392-46634414 GAAAACGGACTAATACAAATAGG + Intronic
1008345466 6:50421442-50421464 TAAAACAGAGTAATACAGCCAGG + Intergenic
1008840027 6:55891618-55891640 TAAAACAGACACATAGACCAAGG - Intergenic
1009327630 6:62373638-62373660 GAAAACGGACTAATACAAGTTGG - Intergenic
1010263906 6:73846088-73846110 GAAAACAGACTAGTACATATGGG + Intergenic
1010330557 6:74618677-74618699 GAAAACGAACTAGTACACCTGGG - Intergenic
1010473998 6:76263669-76263691 AAAAACTGACTAATACACTGTGG + Intergenic
1010810255 6:80292237-80292259 GAGAATAGACTAATACACCAAGG - Intronic
1010929389 6:81782361-81782383 GAGAACACACTAATACAGCCGGG - Intergenic
1010951717 6:82044983-82045005 GAGAACAGACTAATACACTGGGG - Intergenic
1011117993 6:83916080-83916102 TAAAACAGAATAATAAGCCATGG - Intronic
1011348860 6:86400906-86400928 GAAAACAGAGTAATACACTTGGG - Intergenic
1011382632 6:86759499-86759521 GAGAACAGGCTAATACACCTAGG - Intergenic
1011740121 6:90351061-90351083 GAGAACAGACTAATACAACAAGG + Intergenic
1011821368 6:91256909-91256931 GAATACAGACTAATACAGAAGGG + Intergenic
1011890056 6:92147039-92147061 GAAAACGGACTAATACACGGTGG + Intergenic
1011902407 6:92315105-92315127 GAAAACAAACTAATACAAACAGG + Intergenic
1011926989 6:92658079-92658101 GAAAACAAGGTAATACACCTGGG - Intergenic
1012096489 6:94969053-94969075 AAAAACAGACATATAGACCAAGG + Intergenic
1012107571 6:95183165-95183187 GAAAACAGACTAATACAACATGG + Intergenic
1012124583 6:95412012-95412034 GAAATCAGACTAACATACTAGGG + Intergenic
1012143549 6:95652770-95652792 CATAACAGACTGATACTCCAGGG + Intergenic
1012194998 6:96330455-96330477 GAAAACAGACTAAAATACAAGGG + Intergenic
1012213599 6:96555890-96555912 GAAAACGGACTAATACACTCTGG - Intergenic
1012226243 6:96705963-96705985 GAGAACGGACTAATACACCGTGG + Intergenic
1012715379 6:102661631-102661653 GAAAACAGACTAATACAAAAGGG + Intergenic
1012783306 6:103590733-103590755 CAAAACAGAGAAATAGACCAAGG - Intergenic
1012797809 6:103785586-103785608 GAAAACAGACTAATACAAGCAGG - Intergenic
1012865239 6:104610971-104610993 GAGAATGGACTAATACACCCAGG - Intergenic
1012918197 6:105193592-105193614 CAAAACAGACTAATACACAAAGG + Intergenic
1013071778 6:106736087-106736109 GGAAACAGACTAAGACACAAGGG + Intergenic
1013084936 6:106848348-106848370 GAGAATAGACTAATACAACTGGG + Intergenic
1013086753 6:106863869-106863891 GAAAACAGACTAATACAACTGGG + Intergenic
1013378806 6:109545684-109545706 GAAAATGGACTAATACACCAAGG + Intronic
1013461990 6:110383574-110383596 CAAAACAGACATATAGACCAAGG + Intergenic
1013477638 6:110523805-110523827 GAGAACAGACTAATACAATCTGG + Intergenic
1014328286 6:120027599-120027621 GAGAACACACTAATACAACATGG - Intergenic
1014342433 6:120227183-120227205 GAGAACAGACTAATACATTGGGG - Intergenic
1014348855 6:120313353-120313375 GAGAACGGACTAATACAATATGG - Intergenic
1014389472 6:120843032-120843054 GAAAACAAACAAACAAACCAAGG - Intergenic
1014619411 6:123647160-123647182 GAGAACAAACTAATACACTATGG - Intergenic
1014690426 6:124556667-124556689 GAAAACAGACTAAGACAGTAGGG + Intronic
1014701958 6:124699824-124699846 AAAAACGGACTAATACACCTTGG + Intronic
1014875693 6:126655721-126655743 GAAAACAGACTAATACACTGGGG + Intergenic
1015278895 6:131410963-131410985 GAGAACAGACTAATACACTTGGG + Intergenic
1015279467 6:131418119-131418141 AAGAACAGACTAATACAGGAGGG - Intergenic
1015523341 6:134152735-134152757 GAAAAAAGACTAACACAATAGGG + Intergenic
1015879439 6:137856500-137856522 GAGAACAGACTAATACAATTGGG + Intergenic
1016124998 6:140389244-140389266 GAAAACAGACTAATACAGTGTGG - Intergenic
1016200163 6:141396052-141396074 GAGAACGAACTAATACACCAGGG + Intergenic
1016237551 6:141886871-141886893 GAGAATGGACTAATACAGCATGG - Intergenic
1016499937 6:144708727-144708749 AAAGACAGACTAAAACACCAAGG - Intronic
1016513111 6:144865083-144865105 AAAAACAGACTAATACATCAGGG + Intergenic
1016579877 6:145617396-145617418 GAACACAGACTAATACAAAGAGG + Intronic
1016598292 6:145826296-145826318 AAGAACAGACTAATACACTTAGG + Intergenic
1016611794 6:145998709-145998731 GAGAACAGACTAATACACCAGGG - Intergenic
1016632713 6:146250601-146250623 GAAAACACACTAATACAATTAGG - Intronic
1016778031 6:147927012-147927034 AAAAACAGACACATAGACCATGG - Intergenic
1016783771 6:147988338-147988360 GAAAACGGACTAATATCTCATGG - Intergenic
1016911571 6:149204523-149204545 GAGAACAGACTAATACAAATGGG - Intergenic
1017123752 6:151047791-151047813 GAGAACAGACCAATACAGCATGG - Intronic
1017763474 6:157588974-157588996 GAAAATAGACTAATACAGATGGG - Intronic
1017794991 6:157835875-157835897 GAAAACAGACTAATACAGTCTGG + Intronic
1017797431 6:157858620-157858642 GAGAACATGCTAATACATCAAGG - Intronic
1017812911 6:157996963-157996985 GAGAACAGACTAGTACACCAAGG + Intronic
1018425625 6:163677759-163677781 GAACCCTCACTAATACACCAGGG + Intergenic
1018554732 6:165037499-165037521 GAAAACGGACTAATATAGCAGGG + Intergenic
1018585706 6:165355870-165355892 GAAAATGGACTAATACAGCAAGG - Intronic
1018645470 6:165943933-165943955 GAGAACAGACTAATACAGAAGGG - Intronic
1018985579 6:168634154-168634176 GAGAACGGACTAATACACACAGG + Intronic
1019022304 6:168929576-168929598 GAAAACACACTAATACAGGTAGG + Intergenic
1019150703 6:170003739-170003761 GAGAATGGACTAATACAGCAAGG - Intergenic
1019816334 7:3203855-3203877 GAGAACAGACTCATACAACTGGG - Intergenic
1019896767 7:3989102-3989124 GAAAACCGACTAATACAGATAGG - Intronic
1020345234 7:7154989-7155011 GAAAATGGACTAATACACATGGG + Intergenic
1020546242 7:9535286-9535308 AAAAACAGACACATAGACCAAGG - Intergenic
1020730322 7:11871061-11871083 GAGAAAAGACTAATACAGTATGG + Intergenic
1020774403 7:12435347-12435369 GAAAACAGACTAATACATATGGG - Intergenic
1020890765 7:13875565-13875587 CAAAACAGACTAATACAGTAGGG - Intergenic
1021041766 7:15871725-15871747 GAAAGCAGACTACTAATCCAAGG - Intergenic
1021071216 7:16243362-16243384 GAAAACAGACTAACAGATGATGG + Intronic
1021124231 7:16832120-16832142 AAAAACAGACACATAGACCAAGG + Intronic
1021324907 7:19254973-19254995 GAAAACAGACTAATACAATAAGG - Intergenic
1021665592 7:22975069-22975091 GAAAATGGACTAATACACTCAGG + Intronic
1021787522 7:24166123-24166145 GAGAACAGAGTAATACACAGAGG + Intergenic
1021956246 7:25827527-25827549 TAAAACAGACACATAGACCAGGG + Intergenic
1022240563 7:28508098-28508120 GAAAACAGACAGTTACAACATGG - Intronic
1022292231 7:29015685-29015707 AAGAACAGACTAATACAGCGGGG + Intronic
1022377047 7:29824002-29824024 GAGAACAGACTAATACACCAAGG + Intronic
1022416395 7:30181337-30181359 CAAAGCAGACTAAGACAACACGG - Intergenic
1022454935 7:30550366-30550388 GACAACAGACTAATACAGGCAGG + Intronic
1022549882 7:31228438-31228460 GAAAACAAACTAATACAGTTGGG + Intergenic
1022620215 7:31975961-31975983 GAAAAGAGACAAAGATACCATGG - Intronic
1023265124 7:38396506-38396528 GAAAATGGACTAATACAATATGG + Intronic
1023496910 7:40807669-40807691 GAACCCTAACTAATACACCATGG - Intronic
1023633922 7:42190299-42190321 CACAACAAACTAAAACACCACGG + Intronic
1024001634 7:45193779-45193801 GAGAACAGGCTAATACAGTAGGG + Intergenic
1024110017 7:46135089-46135111 GAGAACAGACTAATACATAAAGG - Intergenic
1024207717 7:47178030-47178052 GAAAACTGACTAATACATGAAGG + Intergenic
1024378145 7:48662642-48662664 GAAAACAGACTAATACAATTGGG + Intergenic
1024383377 7:48724369-48724391 GAAAATAGACTAATACAGCCAGG - Intergenic
1024684770 7:51733544-51733566 GAAAATGGATTAATACACCAGGG - Intergenic
1024747555 7:52425848-52425870 GAATACAAACCAATTCACCATGG - Intergenic
1025616949 7:63128183-63128205 GAAAACATACATATACACCATGG + Intergenic
1025734465 7:64134878-64134900 GAGAACAGACTAACACACCAAGG + Intronic
1026295107 7:69044775-69044797 GAAAATGGACTAATACACCTGGG - Intergenic
1026500267 7:70937752-70937774 GAAAATAGACTAAGACACTAGGG - Intergenic
1026559222 7:71434295-71434317 GAACCCTCACTAATACACCAAGG + Intronic
1026703831 7:72672311-72672333 GAAAATGGACTAATACCCAAGGG + Intronic
1026800098 7:73394855-73394877 GAAAACAGACTAATACAGAATGG + Intergenic
1027048484 7:75006954-75006976 GAGAACAGACAAATACACCTGGG + Intronic
1027419480 7:78005557-78005579 GAAAACGGACTAATACACTCAGG + Intergenic
1027584645 7:80043683-80043705 GAGAACGGACTAATACAACATGG - Intergenic
1027733755 7:81907000-81907022 GAAATCGGACTAATACACAATGG + Intergenic
1028011101 7:85645460-85645482 GAAAACGAACTAATACACTGAGG + Intergenic
1028042075 7:86064934-86064956 GAAAACAGACTAATACAAGAAGG + Intergenic
1028201631 7:87968744-87968766 AAGAACAGACTAATACACTTGGG - Intronic
1029042264 7:97588908-97588930 AAAAATAGACTCATAGACCAGGG - Intergenic
1029210400 7:98903680-98903702 GAAAACAGACTAATACAGGGAGG - Intronic
1029303211 7:99600425-99600447 GAGAACAGACTAATACACCTGGG - Intronic
1029384527 7:100234695-100234717 GAGAACAGACAAATACACCTGGG - Intronic
1029814309 7:103077321-103077343 GAAAATGGACTAATACAGTAAGG - Intronic
1030249834 7:107429936-107429958 GAAAACGGACTAATACAGTTGGG + Intronic
1030521159 7:110599683-110599705 GTGATGAGACTAATACACCAAGG + Intergenic
1030532567 7:110729176-110729198 AAAAACAGACTAATACGGCTGGG - Intronic
1030554534 7:111006995-111007017 GAAAACTGACTAATACAAGTAGG - Intronic
1030787016 7:113674828-113674850 GAAAATGGACTAATACACAGGGG - Intergenic
1030795680 7:113784307-113784329 GAGAACAGACCAATACAACCTGG - Intergenic
1030803630 7:113886547-113886569 GAAAATAGACTAATACAGGTGGG + Intronic
1030956211 7:115855847-115855869 GAAAATGGACTAATACACCCAGG - Intergenic
1030990563 7:116294290-116294312 GAGAACAGACTAATACAGTCAGG - Intronic
1031045652 7:116884643-116884665 GTGAACAGACAAATAAACCATGG - Intronic
1031138781 7:117918436-117918458 AAACACTGACTAATACACAAAGG - Intergenic
1031175908 7:118350073-118350095 GAAAATTGACTAATACAATATGG - Intergenic
1031432051 7:121683991-121684013 GAAAATAGACTAATACAGAAGGG - Intergenic
1031579869 7:123459695-123459717 GAAATCTGACTAATACAACATGG + Intronic
1031623248 7:123961699-123961721 GAAAATGGACTAATACACATAGG - Intronic
1031732475 7:125315822-125315844 GATAAGAGACTGATAGACCAAGG - Intergenic
1031875146 7:127130992-127131014 GATAACAGACTAATACAAAAAGG + Intronic
1031961179 7:127991340-127991362 CAACTCAGGCTAATACACCAAGG - Intronic
1032473235 7:132193436-132193458 GTAAACAGACTAAGACACTGGGG + Intronic
1032549053 7:132767246-132767268 CCAAACAGACTAATACACCAGGG + Intergenic
1032572538 7:133015735-133015757 AAGAACAGACTAATACACCAAGG - Intronic
1032582169 7:133113479-133113501 GAGAACAGACTAATACAGCGAGG - Intergenic
1032726594 7:134595357-134595379 GAGAACAGACTAATACACAAGGG - Intergenic
1032796321 7:135279201-135279223 GAAAACAGACTAATACATAAGGG + Intergenic
1033716933 7:144011779-144011801 AAAAACAGACTAATACAGCAGGG + Intergenic
1034081711 7:148284506-148284528 GAAAACAGACTAATACATGGAGG + Intronic
1034083610 7:148303124-148303146 GAAAATGGACTAATACACCATGG + Intronic
1034204186 7:149301426-149301448 AAAAATGGACTAATACACCATGG + Intergenic
1034296715 7:149979421-149979443 AAAGACAGACAAAGACACCAAGG + Intergenic
1034679894 7:152920640-152920662 GAAAACAGACTAATACACAGTGG - Intergenic
1034809314 7:154117408-154117430 AAAGACAGACAAAGACACCAAGG - Intronic
1034882034 7:154770119-154770141 GAAAATAGACAAATACATAAGGG - Intronic
1034943273 7:155245694-155245716 GAGAATGGACTAATACATCAAGG - Intergenic
1035371159 7:158379756-158379778 GAAAAAGGACTAATACAGCTAGG - Intronic
1035825249 8:2638177-2638199 GGAAACAGACCAGTACACTATGG - Intergenic
1036573547 8:10003019-10003041 GAAAACAGACTAATACGCTAGGG + Intergenic
1036941981 8:13060465-13060487 GAAAACAGATTAATACACCCTGG - Intergenic
1037107854 8:15131490-15131512 GAAAATGGACTAATACACTAAGG + Intronic
1037452123 8:19025866-19025888 GGGAACAGACTAACACACCATGG - Intronic
1037461103 8:19110218-19110240 GTAAACAGACTTAGACCCCAAGG - Intergenic
1037622611 8:20578050-20578072 GAGAACGGACTAATACAGTAAGG + Intergenic
1038167615 8:25101014-25101036 GAAAATGAACTAATATACCAGGG - Intergenic
1038376102 8:27041915-27041937 GACAACAGACTAATAGAGTAAGG - Intergenic
1038522461 8:28244911-28244933 GAAAATAGACTAATACAGATGGG - Intergenic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1039018582 8:33180706-33180728 GAAAACAGACTACTACACAGGGG + Intergenic
1039099861 8:33929267-33929289 GAGAACAGACTAATACACCCTGG + Intergenic
1039192465 8:34992507-34992529 GAAAACAGACTAATTCAGGGTGG - Intergenic
1039211371 8:35218774-35218796 GAAAACAGACTAAGACAGATGGG + Intergenic
1039438890 8:37580986-37581008 GAGAACAGACTAATACACTGTGG + Intergenic
1039444487 8:37620195-37620217 GAAAACAAAATAAAACTCCATGG + Intergenic
1039671171 8:39600880-39600902 GAGAACAGACTAATACAAATAGG - Intronic
1039858693 8:41437995-41438017 GAAAACGGAGTAATACACCATGG + Intergenic
1040805062 8:51385986-51386008 GAAAATGGACTAATAGACCATGG + Intronic
1040997757 8:53419004-53419026 AAGAACAGACTAATACACTGGGG + Intergenic
1041153435 8:54959277-54959299 GAGAACACACTAATACAGCATGG + Intergenic
1041213466 8:55576367-55576389 CAAAACAGATAAATAGACCAAGG + Intergenic
1041288073 8:56281347-56281369 GAGAATGGACCAATACACCATGG - Intergenic
1041850003 8:62379775-62379797 GAGAACAGACTAATACACATAGG + Intronic
1041919272 8:63164743-63164765 AAAAACAGACTAATACAAATGGG + Intergenic
1042029898 8:64464545-64464567 GAGAACAGACTAATACACCAGGG - Intergenic
1042085249 8:65100228-65100250 GTAAATGGACTAATACCCCAAGG + Intergenic
1042501832 8:69516988-69517010 GAAAATGGACTAAGACAGCAGGG - Intronic
1042606101 8:70548257-70548279 CAAAACACACTAATACACCTGGG + Intergenic
1043302823 8:78755178-78755200 AAAAACAGACACATAGACCAAGG - Intronic
1043439587 8:80265557-80265579 GAAAACTGACAAATACACAGAGG - Intergenic
1043587996 8:81792134-81792156 AAAAACAGACACATACACCATGG - Intergenic
1044010269 8:86985293-86985315 GAAAGCAGGCTAATACATTAAGG + Intronic
1044529506 8:93291361-93291383 GAAAATGGACTAACACACCCGGG - Intergenic
1044541501 8:93413508-93413530 GAAAACGGACTAATACAGCAGGG - Intergenic
1044548175 8:93482588-93482610 CCAAACAGCCTAAGACACCAAGG + Intergenic
1044610967 8:94091796-94091818 GAAAACAGACTAATAGAGTTAGG + Intergenic
1044640522 8:94375611-94375633 GAAAACAGACTAATATAGTGGGG + Intronic
1044664248 8:94619827-94619849 GAAAACAAACTAATACAAGAGGG + Intergenic
1044744089 8:95355429-95355451 GAAGACAGACTAATACAAAGGGG + Intergenic
1044942452 8:97357102-97357124 GAAAACAGACTAATACATGTAGG - Intergenic
1045169470 8:99647973-99647995 GAATACAGTGTAATATACCAAGG + Intronic
1045448040 8:102287777-102287799 GTCAACAGACTAGTACATCAGGG + Intronic
1045678841 8:104637175-104637197 GAATCCTGACTAATACAACATGG - Intronic
1046267448 8:111848684-111848706 GAACCCTGACTAATACACTAAGG - Intergenic
1046276701 8:111971025-111971047 GAAAACAGACTACTACAGATGGG - Intergenic
1046710424 8:117505277-117505299 GAGAACAGACTAATACAAGATGG + Intergenic
1046776383 8:118168204-118168226 GAAAATAGACTAATACACAATGG + Intergenic
1046977859 8:120302588-120302610 AAAAACAGACACATAGACCAGGG - Intronic
1047050147 8:121102084-121102106 GAAAACCAGCTAATACACTACGG + Intergenic
1047565743 8:126041593-126041615 TGAAACAGACTAATACACCTCGG + Intergenic
1047582257 8:126229075-126229097 GAGAACAAACTAATACACAAGGG - Intergenic
1047620285 8:126599661-126599683 GAAAACAGAATAATATAGCCAGG - Intergenic
1047941030 8:129827385-129827407 GAAAACAAACTAATACAACAGGG - Intergenic
1048026075 8:130588133-130588155 GAAAACGGACTAATATACCATGG - Intergenic
1048079088 8:131105146-131105168 GAGAACAGACTAATACAAAGGGG + Intergenic
1048121240 8:131583827-131583849 GAGAACAGACTAATACAGAGAGG - Intergenic
1048367737 8:133753161-133753183 GAAAACAGATTAATACAGAAGGG - Intergenic
1048418993 8:134258470-134258492 GAGAACAGACTAATACAGGGTGG + Intergenic
1048499449 8:134962344-134962366 GAACACTGACTAATACACCTGGG + Intergenic
1048542617 8:135356068-135356090 GAAAACAGACTAATACACAGGGG + Intergenic
1048595760 8:135864016-135864038 GAAAACAAACTAATACATATAGG - Intergenic
1048622888 8:136153892-136153914 GAGAATGGACTAATACACCATGG + Intergenic
1048644910 8:136409360-136409382 TAAATCAGGCTAAGACACCATGG - Intergenic
1048655689 8:136533566-136533588 GAAAGAAGATTAATAAACCATGG - Intergenic
1048659122 8:136575879-136575901 CAAAACAGACTAATACAATTGGG - Intergenic
1048744814 8:137602295-137602317 GAAGCCAGAGTAATACACTATGG + Intergenic
1048895607 8:138989689-138989711 GAAAACAGACTAATACAAACAGG - Intergenic
1049049386 8:140182292-140182314 GAAAACAGTTGAATAGACCAAGG - Intronic
1049871747 8:144984495-144984517 GAAAACAGACTAATACACTAGGG + Intergenic
1049979828 9:893878-893900 GAAAAAAGAAAAATACAACATGG - Intronic
1050014292 9:1217385-1217407 TAAAACATACTAAAAGACCAAGG + Intergenic
1050104242 9:2149047-2149069 GAAAACAGACTAATACAGGCAGG - Intronic
1050156842 9:2676343-2676365 GAGAACAGACTAATACAACCTGG + Intergenic
1050280730 9:4047362-4047384 GAAAACGGACTAATACAATTGGG + Intronic
1050579443 9:7035833-7035855 AAAAACAGACACATACATCAAGG - Intronic
1050594005 9:7187933-7187955 GAAAAAAGACTAACACGCCCAGG - Intergenic
1050654964 9:7818036-7818058 CAAAATAGACTAAGGCACCAAGG - Intronic
1050675423 9:8047196-8047218 CAAAACAGACACATAGACCAGGG - Intergenic
1051242555 9:15075252-15075274 GAGAACGGACTAATACAGGATGG - Intergenic
1051890655 9:21939278-21939300 GAAAACGGACTAATGCACATGGG + Intronic
1051975256 9:22941205-22941227 GAAAACAGACTAATACAACATGG - Intergenic
1052185215 9:25585688-25585710 AAAAACAGACACATAGACCAAGG + Intergenic
1052213858 9:25940661-25940683 GAACCCTGACTAATACACCATGG + Intergenic
1052577544 9:30308935-30308957 GAGATCAGACTAATACACAGCGG + Intergenic
1052667343 9:31512085-31512107 GGAAACAGACTAATACAGTTGGG + Intergenic
1052671381 9:31561665-31561687 AAAAACAGACACATAGACCAGGG + Intergenic
1052688523 9:31783952-31783974 GAAAATGGACTAATACACTGAGG - Intergenic
1052701492 9:31942505-31942527 GAAAATGGACTAATACACTTGGG + Intergenic
1053115710 9:35500142-35500164 AAAAACAGACTAATACAGTAAGG - Intronic
1053119867 9:35538516-35538538 GAAAACAGAGTCATTCACAATGG + Intronic
1053594643 9:39547147-39547169 GAGAACAGACTAATACAGTAGGG + Intergenic
1053675534 9:40421741-40421763 GAAAACAGACTAATACAGCTAGG + Intergenic
1053685096 9:40513884-40513906 GAGAACAGACTAATACAACATGG - Intergenic
1053852419 9:42302180-42302202 GAGAACAGACTAATACAGTAGGG + Intergenic
1053925328 9:43048079-43048101 GAAAACAGACTAATACAGCTAGG + Intergenic
1053935059 9:43142170-43142192 GAGAACAGACTAATACAACATGG - Intergenic
1054278632 9:63111079-63111101 GAGAACAGACTAATACAACATGG + Intergenic
1054288810 9:63260267-63260289 GAAAACAGACTAATACAGCTAGG + Intergenic
1054298188 9:63349341-63349363 GAGAACAGACTAATACAACATGG - Intergenic
1054386632 9:64561804-64561826 GAAAACAGACTAATACAGCTAGG + Intergenic
1054396206 9:64653858-64653880 GAGAACAGACTAATACAACATGG - Intergenic
1054430849 9:65159053-65159075 GAGAACAGACTAATACAACATGG - Intergenic
1054453775 9:65419062-65419084 GAGAACGGACTAATACACCATGG + Intergenic
1054499532 9:65862468-65862490 GAGAACAGACTAATACAACATGG + Intergenic
1054509088 9:65954551-65954573 GAAAACAGACTAATACAGCTAGG - Intergenic
1054571619 9:66817825-66817847 GAGAACAGACTAATACAGTAGGG - Intergenic
1055067316 9:72131827-72131849 GAAAACAGACTAATATAAAGGGG - Intronic
1055330367 9:75177398-75177420 GAACACACACGAAGACACCAGGG - Intergenic
1055330921 9:75183291-75183313 GAAAACGGACTAATGCATCTTGG - Intergenic
1055379502 9:75690595-75690617 GAAAACAGATTAATACAGGAGGG - Intergenic
1055791075 9:79923792-79923814 GAACCCTGACTAATACACCTGGG + Intergenic
1055970043 9:81902787-81902809 GAACACTGACTAATACAGTAAGG - Intergenic
1056252308 9:84762212-84762234 GAGAACAGACTAATAAACAAGGG + Intronic
1056957404 9:91093126-91093148 GAGAACAGACTAATACAAGAGGG + Intergenic
1057233466 9:93339667-93339689 GAAAACAGACAAATACACTAGGG + Intronic
1057541226 9:95973407-95973429 GAAAACAGATTAATTCACCTGGG - Intronic
1057641809 9:96831020-96831042 GAAAACAGACTAACGCCACAGGG + Intronic
1058083088 9:100719617-100719639 GAAAACGGACTAATACATTCAGG - Intergenic
1058086301 9:100752157-100752179 GAAAATGGACTAACACATCAAGG - Intergenic
1058513794 9:105749216-105749238 GAGAACAGACTAACACAGTATGG - Intronic
1058611484 9:106781025-106781047 AAAAACAAACAAATAAACCAAGG - Intergenic
1058847085 9:108971743-108971765 GAGAACAGACTAATACAGTTGGG + Intronic
1059001830 9:110356561-110356583 GAGAACAGACTAATACTTCTTGG + Intergenic
1059719502 9:116945815-116945837 GAAAACAGACTAATACAGGTGGG - Intronic
1059744591 9:117187811-117187833 GAAAACAGACTAAGACACAATGG + Intronic
1059789091 9:117620318-117620340 GAGAACAGACAAACAAACCATGG - Intergenic
1059878084 9:118658453-118658475 GAGAACAGACTAATACAAAAGGG + Intergenic
1059990190 9:119858093-119858115 GGGAACAGACTAATACATCTGGG - Intergenic
1060361856 9:122966705-122966727 GAAAACGAAGTAATACACCCGGG - Intronic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1060774348 9:126360367-126360389 GAAAACATAATAATATACAATGG - Intronic
1061154951 9:128853630-128853652 GAACACATACTAATTTACCAGGG + Intronic
1061429453 9:130522085-130522107 GAAAACAGACTAATACAATGGGG - Intergenic
1062143534 9:134974467-134974489 GAACACTTCCTAATACACCAAGG + Intergenic
1062486966 9:136782833-136782855 GAGAACACACTAATTTACCAGGG - Intergenic
1185516701 X:704678-704700 AAAAACAGACTAAGACAGGAAGG + Intergenic
1185561604 X:1064211-1064233 GAACACAGACTAACACAGCTGGG + Intergenic
1185663368 X:1744641-1744663 GAGAACAGACTAATACAGAACGG + Intergenic
1185849207 X:3469612-3469634 GACAGCAGACTAATACAGCCTGG - Intergenic
1185861214 X:3581331-3581353 GAAAACAGACTAATACAAAAGGG + Intergenic
1185952963 X:4456666-4456688 GAAAACAGACTAATACAATGGGG + Intergenic
1186032364 X:5383353-5383375 GAAAACACACTAATAAACTTGGG - Intergenic
1186152178 X:6687005-6687027 GAGAACAGACAAATACACCAAGG + Intergenic
1186188546 X:7045335-7045357 GAAAACAGACCAATACACGCTGG + Intergenic
1186233584 X:7483309-7483331 GAGAACAGACTAATACAGGCAGG - Intergenic
1186233683 X:7484109-7484131 GAAAATGGACTGATACACTAAGG - Intergenic
1186656172 X:11614251-11614273 GAGAACGGACTAATACACAGGGG - Intronic
1186734455 X:12446806-12446828 GAAGGCTGACTAATACACCAGGG + Intronic
1187133431 X:16524971-16524993 GAAAATGGACTAATACACTTAGG - Intergenic
1187241181 X:17514679-17514701 GAACGTTGACTAATACACCAGGG + Intronic
1187440327 X:19312295-19312317 GAGAACAGACTAATACAATTTGG - Intergenic
1187742367 X:22369846-22369868 GAGAACAGACTAATACAATGAGG + Intergenic
1187927696 X:24264941-24264963 GAGAACAGACTAATACAGGCTGG - Intergenic
1188356917 X:29203032-29203054 CAAGACAGACTACTACAACAGGG + Intronic
1188775764 X:34216364-34216386 GAAACTTGACTAATACACCAAGG + Intergenic
1188897566 X:35687292-35687314 AAAAACAGACACATAGACCAAGG - Intergenic
1188985292 X:36763549-36763571 GAAAACAGACTAATACAGTAGGG - Intergenic
1189371458 X:40432589-40432611 GAAAACGGACTAATATACCCTGG + Intergenic
1189407972 X:40742988-40743010 GAAATCAGAGTAAGACACCAGGG + Intergenic
1189769074 X:44404602-44404624 AAAAACAGACACATAGACCAAGG - Intergenic
1190169502 X:48100749-48100771 GAGAACAGACTAATACAGGAGGG - Intergenic
1190409382 X:50120282-50120304 AAAAACAGACACATAGACCAAGG + Intergenic
1190499860 X:51063632-51063654 GATAACAGACTAATATACCAAGG + Intergenic
1190607349 X:52158798-52158820 AAAAACAGACATATAGACCAAGG + Intergenic
1190898858 X:54649342-54649364 GAAAACAAATTAATAAACCTTGG - Intergenic
1191972544 X:66832909-66832931 GAGAACAGACTAATACACCCAGG + Intergenic
1192291356 X:69798992-69799014 TAAAACAGACACATAGACCAAGG + Intronic
1192404828 X:70874280-70874302 GCAAACAGCCTAATGCAGCATGG + Intronic
1192676420 X:73201842-73201864 GAAAATGGACTAATACACTATGG - Intergenic
1192753717 X:74023157-74023179 GAAAACATACATGTACACCATGG + Intergenic
1192837588 X:74818265-74818287 AAAAACAGACACATAGACCAAGG + Intronic
1192942185 X:75924331-75924353 AAAAACAGACAAATAGACAAAGG + Intergenic
1193003965 X:76595632-76595654 GAAAACGGACTAATACAGATGGG - Intergenic
1193271976 X:79538760-79538782 GAAAACAGACTAATACAGGGTGG + Intergenic
1193421519 X:81289068-81289090 AAAAACAAACACATACACCAAGG + Intronic
1193479244 X:82007063-82007085 GTCAAAAGGCTAATACACCATGG - Intergenic
1193490037 X:82137844-82137866 AAAAACAGACAAATATACCAAGG + Intergenic
1193504740 X:82328489-82328511 GAAAATATACATATACACCATGG + Intergenic
1193622852 X:83777930-83777952 GAAAACAGATATATAGACCAAGG - Intergenic
1193808172 X:86017671-86017693 GAAAACAGACTAATACAACAAGG + Intronic
1193840527 X:86403776-86403798 GAAAACAGACTAATACACCATGG - Intronic
1193889521 X:87027510-87027532 GAAAATGGACTAATACAGTATGG + Intergenic
1193998678 X:88399914-88399936 GAAAACAAACTAATACAACATGG - Intergenic
1194126833 X:90029053-90029075 TAAAATGGACTAATACAGCAAGG - Intergenic
1194329575 X:92564410-92564432 AAAAACAGACACATAGACCAAGG + Intronic
1194334820 X:92632282-92632304 GAAAACAAATTAATACAATAGGG - Intergenic
1195122483 X:101769574-101769596 AAAAACAGACACATAGACCAAGG - Intergenic
1195140835 X:101957933-101957955 GAAAACAGACTAATACAGGGAGG + Intergenic
1195313994 X:103659969-103659991 GAGAACAGACTAATACAGGTGGG + Intergenic
1195458656 X:105099218-105099240 GAAAACAGACTGATACAATGGGG - Intronic
1195565386 X:106333767-106333789 GAAAATAGACTAATACAGGAGGG + Intergenic
1195586543 X:106571453-106571475 AAAAACAGAATAAAATACCAAGG + Intergenic
1195812950 X:108854087-108854109 GAGAACAGACTAATACAACAAGG + Intergenic
1196294870 X:113985990-113986012 GAAAACTGACTAATACAGAGGGG - Intergenic
1196301471 X:114053654-114053676 GAAAATGGACTAATACACTCAGG - Intergenic
1196302673 X:114064699-114064721 GAAAACAAACTAATACACCAAGG + Intergenic
1196310060 X:114153430-114153452 AAGAACAAACTAATACAACATGG + Intergenic
1196480625 X:116142652-116142674 GAAAATGGACTAATACACCCAGG + Intergenic
1196512237 X:116525340-116525362 GAAACCTGACTAATACACGATGG - Intergenic
1196609927 X:117700876-117700898 AACAACAGACAAATAGACCAAGG + Intergenic
1196903062 X:120405281-120405303 AAAAACTGAATACTACACCAGGG - Intergenic
1196914705 X:120520755-120520777 CAAAACAGACATATAGACCAAGG + Intergenic
1196995332 X:121376805-121376827 GAAAACAGACTAATACAGGGGGG - Intergenic
1197430160 X:126352548-126352570 GAAAACAGACTAATACAGGCTGG + Intergenic
1197568374 X:128117028-128117050 GAAAATGAACTAATACACAAAGG + Intergenic
1197608968 X:128617139-128617161 GAAAACAGACTAATACACCCTGG - Intergenic
1197625304 X:128795352-128795374 CAAAACAGACATATAGACCAAGG + Intergenic
1197633223 X:128886242-128886264 GAACCCTGACTAATACACCCAGG - Intergenic
1198003665 X:132468481-132468503 AAGAACAGACTAATAAAACATGG + Intronic
1198430385 X:136560120-136560142 AAAAACAGACACATAGACCAAGG - Intergenic
1198493044 X:137163045-137163067 GATAACAGCATAATACCCCAGGG + Intergenic
1198607261 X:138355633-138355655 AAGAACAGACTAATACAAAAGGG - Intergenic
1198648932 X:138839336-138839358 GAAAACAGACTAAGACAGAGGGG + Intronic
1198778741 X:140210618-140210640 AAGAACGGACTAATACAACATGG + Intergenic
1199112301 X:143949313-143949335 GAGAACATACTAATACAGTAGGG - Intergenic
1199207501 X:145165719-145165741 GAGAACAGACCAATACACTTGGG + Intergenic
1199287880 X:146074114-146074136 GAGAACAGACTAATACAAATGGG - Intergenic
1199304137 X:146247134-146247156 AAAAACAGACTATTATAACACGG + Intergenic
1199338854 X:146651714-146651736 GAGAACGGACTAATACACCATGG - Intergenic
1199373665 X:147082567-147082589 GAAAACAGACTAATACATTTGGG + Intergenic
1199387506 X:147240378-147240400 GAAAATGGACTAACACAACAAGG - Intergenic
1199420510 X:147638242-147638264 GAAAACAGACTAATACATGGGGG + Intergenic
1199432849 X:147780181-147780203 CAAAGCTGACTAATACACAAGGG + Intergenic
1199462815 X:148102356-148102378 GAAAACAGCCTAATACAACATGG + Intergenic
1199581957 X:149369184-149369206 GAGAACAGACTAATACACATGGG + Intergenic
1199644648 X:149894752-149894774 GAAAAAACACTAAAACACTAAGG - Intergenic
1199925516 X:152459342-152459364 GAAAACGGACTAATACAATAGGG - Intergenic
1199945541 X:152663323-152663345 GAAAACATACATATACACCATGG - Intergenic
1200638276 Y:5683608-5683630 AAAAACAGACACATAGACCAAGG + Intronic
1200643296 Y:5749336-5749358 GAAAACAAATTAATACAATAGGG - Intergenic
1200803785 Y:7411366-7411388 GAAAACAGACCAATACAGAAGGG - Intergenic
1200908223 Y:8507565-8507587 GAAAACACACTTATTAACCATGG - Intergenic
1201720196 Y:17088855-17088877 GAGAACGGACTAATACACAGGGG - Intergenic
1201980070 Y:19897531-19897553 AAAAACAGACATATAGACCAAGG + Intergenic