ID: 971263640

View in Genome Browser
Species Human (GRCh38)
Location 4:25078736-25078758
Sequence TGAAAACAGACTAATACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971263640_971263643 8 Left 971263640 4:25078736-25078758 CCTGGTGTATTAGTCTGTTTTCA No data
Right 971263643 4:25078767-25078789 GTGAAGACATACCATAGGCTGGG No data
971263640_971263645 28 Left 971263640 4:25078736-25078758 CCTGGTGTATTAGTCTGTTTTCA No data
Right 971263645 4:25078787-25078809 GGGCAATTTACAAAAGAAAGAGG No data
971263640_971263641 3 Left 971263640 4:25078736-25078758 CCTGGTGTATTAGTCTGTTTTCA No data
Right 971263641 4:25078762-25078784 TGCTTGTGAAGACATACCATAGG No data
971263640_971263642 7 Left 971263640 4:25078736-25078758 CCTGGTGTATTAGTCTGTTTTCA No data
Right 971263642 4:25078766-25078788 TGTGAAGACATACCATAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971263640 Original CRISPR TGAAAACAGACTAATACACC AGG (reversed) Intergenic