ID: 971263642

View in Genome Browser
Species Human (GRCh38)
Location 4:25078766-25078788
Sequence TGTGAAGACATACCATAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971263639_971263642 8 Left 971263639 4:25078735-25078757 CCCTGGTGTATTAGTCTGTTTTC 0: 10
1: 29
2: 145
3: 405
4: 928
Right 971263642 4:25078766-25078788 TGTGAAGACATACCATAGGCTGG No data
971263638_971263642 17 Left 971263638 4:25078726-25078748 CCTGCTGAGCCCTGGTGTATTAG No data
Right 971263642 4:25078766-25078788 TGTGAAGACATACCATAGGCTGG No data
971263640_971263642 7 Left 971263640 4:25078736-25078758 CCTGGTGTATTAGTCTGTTTTCA 0: 19
1: 127
2: 497
3: 1003
4: 1388
Right 971263642 4:25078766-25078788 TGTGAAGACATACCATAGGCTGG No data
971263637_971263642 18 Left 971263637 4:25078725-25078747 CCCTGCTGAGCCCTGGTGTATTA No data
Right 971263642 4:25078766-25078788 TGTGAAGACATACCATAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971263642 Original CRISPR TGTGAAGACATACCATAGGC TGG Intergenic
No off target data available for this crispr