ID: 971265528

View in Genome Browser
Species Human (GRCh38)
Location 4:25093461-25093483
Sequence TGGGATTACCATGATGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971265520_971265528 24 Left 971265520 4:25093414-25093436 CCTAGCTGCAAGAGAGGCTGGTA No data
Right 971265528 4:25093461-25093483 TGGGATTACCATGATGGGCTAGG No data
971265525_971265528 -7 Left 971265525 4:25093445-25093467 CCTTAGCAAAGGAGGATGGGATT No data
Right 971265528 4:25093461-25093483 TGGGATTACCATGATGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971265528 Original CRISPR TGGGATTACCATGATGGGCT AGG Intergenic
No off target data available for this crispr