ID: 971265540

View in Genome Browser
Species Human (GRCh38)
Location 4:25093548-25093570
Sequence CCCTTCCCTGCTCTCCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971265540_971265546 29 Left 971265540 4:25093548-25093570 CCTCAATGGAGAGCAGGGAAGGG No data
Right 971265546 4:25093600-25093622 ACACTTCTGCATCTACCCGCTGG No data
971265540_971265544 -10 Left 971265540 4:25093548-25093570 CCTCAATGGAGAGCAGGGAAGGG No data
Right 971265544 4:25093561-25093583 CAGGGAAGGGGTATCAGGAGTGG No data
971265540_971265545 -9 Left 971265540 4:25093548-25093570 CCTCAATGGAGAGCAGGGAAGGG No data
Right 971265545 4:25093562-25093584 AGGGAAGGGGTATCAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971265540 Original CRISPR CCCTTCCCTGCTCTCCATTG AGG (reversed) Intergenic
No off target data available for this crispr