ID: 971265575

View in Genome Browser
Species Human (GRCh38)
Location 4:25093759-25093781
Sequence CCTCCTGGTGCTCCACATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971265568_971265575 18 Left 971265568 4:25093718-25093740 CCACGCAGCTCAGGAAAGCAGAG No data
Right 971265575 4:25093759-25093781 CCTCCTGGTGCTCCACATGCAGG No data
971265567_971265575 19 Left 971265567 4:25093717-25093739 CCCACGCAGCTCAGGAAAGCAGA No data
Right 971265575 4:25093759-25093781 CCTCCTGGTGCTCCACATGCAGG No data
971265566_971265575 23 Left 971265566 4:25093713-25093735 CCAACCCACGCAGCTCAGGAAAG No data
Right 971265575 4:25093759-25093781 CCTCCTGGTGCTCCACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971265575 Original CRISPR CCTCCTGGTGCTCCACATGC AGG Intergenic
No off target data available for this crispr