ID: 971267468

View in Genome Browser
Species Human (GRCh38)
Location 4:25107966-25107988
Sequence CAGCTGAGCTTACTATTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971267459_971267468 22 Left 971267459 4:25107921-25107943 CCAAGCATTGAGAGTGCTCCCCT No data
Right 971267468 4:25107966-25107988 CAGCTGAGCTTACTATTGAATGG No data
971267464_971267468 2 Left 971267464 4:25107941-25107963 CCTCCTACAGGATTTGTCCTGGA No data
Right 971267468 4:25107966-25107988 CAGCTGAGCTTACTATTGAATGG No data
971267462_971267468 3 Left 971267462 4:25107940-25107962 CCCTCCTACAGGATTTGTCCTGG No data
Right 971267468 4:25107966-25107988 CAGCTGAGCTTACTATTGAATGG No data
971267461_971267468 4 Left 971267461 4:25107939-25107961 CCCCTCCTACAGGATTTGTCCTG No data
Right 971267468 4:25107966-25107988 CAGCTGAGCTTACTATTGAATGG No data
971267465_971267468 -1 Left 971267465 4:25107944-25107966 CCTACAGGATTTGTCCTGGAACC No data
Right 971267468 4:25107966-25107988 CAGCTGAGCTTACTATTGAATGG No data
971267458_971267468 25 Left 971267458 4:25107918-25107940 CCTCCAAGCATTGAGAGTGCTCC No data
Right 971267468 4:25107966-25107988 CAGCTGAGCTTACTATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971267468 Original CRISPR CAGCTGAGCTTACTATTGAA TGG Intergenic
No off target data available for this crispr