ID: 971268728

View in Genome Browser
Species Human (GRCh38)
Location 4:25117422-25117444
Sequence CTGAGCAAGGCGCAGATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971268728_971268732 3 Left 971268728 4:25117422-25117444 CCTTATATCTGCGCCTTGCTCAG No data
Right 971268732 4:25117448-25117470 CTGGCTAAAGGCCATGACTTTGG No data
971268728_971268731 -9 Left 971268728 4:25117422-25117444 CCTTATATCTGCGCCTTGCTCAG No data
Right 971268731 4:25117436-25117458 CTTGCTCAGAAACTGGCTAAAGG No data
971268728_971268734 15 Left 971268728 4:25117422-25117444 CCTTATATCTGCGCCTTGCTCAG No data
Right 971268734 4:25117460-25117482 CATGACTTTGGCTCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971268728 Original CRISPR CTGAGCAAGGCGCAGATATA AGG (reversed) Intergenic
No off target data available for this crispr