ID: 971268730

View in Genome Browser
Species Human (GRCh38)
Location 4:25117435-25117457
Sequence CTTTAGCCAGTTTCTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971268730_971268735 21 Left 971268730 4:25117435-25117457 CCTTGCTCAGAAACTGGCTAAAG No data
Right 971268735 4:25117479-25117501 CAGGCTTGAGCTAACCTTGAAGG No data
971268730_971268732 -10 Left 971268730 4:25117435-25117457 CCTTGCTCAGAAACTGGCTAAAG No data
Right 971268732 4:25117448-25117470 CTGGCTAAAGGCCATGACTTTGG No data
971268730_971268734 2 Left 971268730 4:25117435-25117457 CCTTGCTCAGAAACTGGCTAAAG No data
Right 971268734 4:25117460-25117482 CATGACTTTGGCTCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971268730 Original CRISPR CTTTAGCCAGTTTCTGAGCA AGG (reversed) Intergenic
No off target data available for this crispr