ID: 971268734

View in Genome Browser
Species Human (GRCh38)
Location 4:25117460-25117482
Sequence CATGACTTTGGCTCAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971268730_971268734 2 Left 971268730 4:25117435-25117457 CCTTGCTCAGAAACTGGCTAAAG No data
Right 971268734 4:25117460-25117482 CATGACTTTGGCTCAAAGACAGG No data
971268728_971268734 15 Left 971268728 4:25117422-25117444 CCTTATATCTGCGCCTTGCTCAG No data
Right 971268734 4:25117460-25117482 CATGACTTTGGCTCAAAGACAGG No data
971268727_971268734 16 Left 971268727 4:25117421-25117443 CCCTTATATCTGCGCCTTGCTCA No data
Right 971268734 4:25117460-25117482 CATGACTTTGGCTCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971268734 Original CRISPR CATGACTTTGGCTCAAAGAC AGG Intergenic
No off target data available for this crispr