ID: 971272455

View in Genome Browser
Species Human (GRCh38)
Location 4:25163343-25163365
Sequence CTGACTATACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 16, 2: 50, 3: 77, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971272455 Original CRISPR CTGACTATACAAATGGACAA TGG Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
908478514 1:64512989-64513011 GTGACAATAGAAATGGAGAATGG - Intronic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
908578313 1:65485725-65485747 CTGACTGTACAAATTGGTAATGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
911584337 1:99672952-99672974 CAGATGATACAAATGGGCAAAGG + Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
914387079 1:147180191-147180213 CTGACTATACAACATGACACTGG - Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914906624 1:151751445-151751467 CTGATTTTAAAAATGGGCAACGG - Intergenic
917000636 1:170354407-170354429 ATGACTATACAAATCCAGAAGGG + Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
922815779 1:228447776-228447798 CTAACTTTAAAAATAGACAAAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063927035 10:10989831-10989853 CTGACCATAAAAGTAGACAAAGG + Intergenic
1065238939 10:23686204-23686226 CTGACTATAGACATTTACAAAGG + Intergenic
1065501684 10:26389587-26389609 GTCCCTATACAAATGGCCAATGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067813357 10:49449296-49449318 ATAACTTTAAAAATGGACAAAGG - Intergenic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069165357 10:65151418-65151440 CTGATTTTAAAAATGGGCAAAGG + Intergenic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1072265036 10:93719300-93719322 CTTACTCTACAAATGGAGACAGG + Intergenic
1072504341 10:96049272-96049294 CTAATTATAAAAATGGGCAAAGG - Intronic
1074442624 10:113492133-113492155 TTGTCTCTACAAATGGAAAAAGG + Intergenic
1074553241 10:114464501-114464523 CTTATTACCCAAATGGACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075598520 10:123749743-123749765 CTGACTTTACAAAGGGTGAAAGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076945675 10:133648024-133648046 TTTACTATAAAAATGAACAAAGG + Intergenic
1078456721 11:11481518-11481540 CTGACTTTCCCAAGGGACAAGGG + Intronic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078778599 11:14416045-14416067 CTGACTGTAGGACTGGACAAAGG - Intergenic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083210203 11:61179481-61179503 AGGAGGATACAAATGGACAACGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1090037716 11:123263282-123263304 CTGGCTATACTAACGGACAATGG - Intergenic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1091356187 11:134939645-134939667 CTGCCAAAACAAATGGTCAAAGG + Intergenic
1091893694 12:4083394-4083416 CTGCCCCTCCAAATGGACAAGGG + Intergenic
1092611982 12:10182131-10182153 ATGACTATACAAAGGAAGAAGGG - Intronic
1093087614 12:14884047-14884069 ATGACTATAAAAATTGCCAAAGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096356709 12:50947437-50947459 CTGACTTTAAAAATGGAGGAAGG - Intergenic
1097311515 12:58124037-58124059 ATGACTTTAAAAATGGGCAATGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098387333 12:69933383-69933405 CTGACTATTCATATGGTGAAAGG + Intronic
1099433306 12:82614855-82614877 CAGCCTATACAAAGGGACAGGGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108936037 13:55880677-55880699 CTGACTATAAAAAATGCCAAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110152727 13:72274423-72274445 ATGACTATATAAATGTATAAAGG + Intergenic
1111167409 13:84478121-84478143 AAGACTATACAAATGACCAAAGG + Intergenic
1111344863 13:86938401-86938423 CTGACTATCCAAATGGCTATTGG + Intergenic
1111373056 13:87342364-87342386 CTGACTAGAAGAAAGGACAATGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112159486 13:96853047-96853069 CTGACTATAGGAACAGACAAGGG + Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112798128 13:103079772-103079794 CATTCTATACAAATGGAAAATGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116111415 14:40590267-40590289 CTGATTGTACAAATGTTCAAAGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116880964 14:50168551-50168573 CTGACTAAAAAAATGAGCAAAGG - Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118986773 14:70762570-70762592 CTTACTTTAAAAATGGGCAAAGG - Intronic
1119355542 14:74003330-74003352 CTGACAATAGAAATGGGCTAGGG + Intronic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1122305140 14:100760562-100760584 CTGACTATCCACATGCAGAAAGG + Intergenic
1122458449 14:101875660-101875682 CTCACTTTACAAATGGGGAAAGG + Intronic
1123885238 15:24719744-24719766 GTGACTATACTAATTGTCAAAGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131492551 15:92875537-92875559 CTGATTATTTAAATGGGCAAAGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135912500 16:26574166-26574188 CTGACTTTGAAAATGGAGAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137357623 16:47781709-47781731 CTAACTAGATAAATGGGCAAAGG + Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1146120013 17:30184467-30184489 CTGATTATCCAAATGCAAAAAGG - Intronic
1146611494 17:34309450-34309472 CTGACTTTGAAAATGGAGAAGGG - Intergenic
1146828584 17:36046883-36046905 CTGACTATACATCTATACAATGG - Intergenic
1147522262 17:41184926-41184948 CTGAGTATAAAAGTGGACATGGG - Exonic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1151174552 17:72276395-72276417 CTGACTAAAGCAATCGACAAAGG - Intergenic
1151483860 17:74386558-74386580 CTGACTCTACAAATGGCCAGCGG - Intergenic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156303126 18:35852917-35852939 CAGACTATACAAGCAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157765359 18:50292557-50292579 CTCACTCTCCAAATGGACACAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1168561021 19:57383383-57383405 TTGACTATAGAAATCAACAATGG - Intronic
1168566975 19:57433442-57433464 TTTGCTATACAAATGGACAACGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925630002 2:5882225-5882247 CTGACAATACAAGTGGATTATGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927283353 2:21331086-21331108 CTGATTTTACAAATAGAGAATGG + Intergenic
927385482 2:22528388-22528410 CTGACAATATAAAATGACAATGG - Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
931519105 2:63075581-63075603 CTGACTTTTAAAATGGACACAGG - Intergenic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933057638 2:77692877-77692899 CCGACTACACAAGTAGACAATGG + Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935862750 2:107350644-107350666 CTGACTATACTATAGGACTAAGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939574556 2:143880684-143880706 CAGACTATAAAAATGAACATGGG + Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940746753 2:157575854-157575876 GACACTATACAAATTGACAAGGG + Intronic
940768340 2:157814188-157814210 ATTTCTATACAAATGGCCAACGG + Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
942657287 2:178227121-178227143 CCCACTAGAAAAATGGACAAAGG + Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945602397 2:211884388-211884410 CTGACTATGAAAATGTACCACGG + Intronic
945684647 2:212954258-212954280 CTGATTTTAAAAATGGGCAAAGG + Intergenic
948016005 2:234691127-234691149 CAAACTGTAAAAATGGACAAAGG + Intergenic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1168893590 20:1309255-1309277 CTGTCTGAACAAAAGGACAAAGG - Exonic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172058740 20:32174359-32174381 TTAACTATACAAATGGAAATAGG - Intergenic
1173136370 20:40442721-40442743 CCCACTATACAAATGTACAGAGG - Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173898058 20:46565899-46565921 CTGAGTAAACAAATGGCCATAGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951114070 3:18839183-18839205 CTGACTATTCAAATAAACCAAGG + Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952047871 3:29345876-29345898 CAGACTGTACAAATGGCCAGAGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953275046 3:41486807-41486829 TTGTGTATACAAATGGTCAATGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953957894 3:47245643-47245665 CAGACCAGACAAAAGGACAAAGG + Intronic
954253349 3:49385517-49385539 CTGAGTTTAAAAATGGGCAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
958745010 3:98123377-98123399 CTGATTTTAAAAATGGGCAAAGG + Intergenic
958776667 3:98492373-98492395 TTGATTTTACAAGTGGACAAAGG + Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959206886 3:103319721-103319743 ATAACAATAAAAATGGACAAGGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959872583 3:111345429-111345451 CTGACTTTGAAAATGGAGAAAGG + Intronic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961315217 3:126030349-126030371 CTAACTAGAAAAATGCACAAGGG + Intronic
961426924 3:126855727-126855749 ATGCCTACAGAAATGGACAAAGG - Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
962514638 3:136139097-136139119 CTGACTATTTACAGGGACAAAGG - Intronic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966178186 3:177162344-177162366 CTGACTGGAAGAATGGACAAGGG + Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970481558 4:16480783-16480805 CTGAGTATCAAAATGTACAATGG + Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970632760 4:17969712-17969734 CTGAGTTTACGAATGAACAAAGG - Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973832944 4:54780161-54780183 CTGAGTATGGAAAAGGACAATGG - Intergenic
974408408 4:61507080-61507102 CTCTCCATACAAATTGACAATGG + Intronic
974900061 4:67985516-67985538 GTGACTATACAAAAGGCAAAGGG + Intergenic
975998914 4:80348027-80348049 CTGACAATAGCAATGGAGAAAGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977663192 4:99614877-99614899 CTGTCAATACAAATGTAGAAAGG + Intronic
978030471 4:103936152-103936174 CTCACTAAAAAAATGGGCAAAGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
980140845 4:128914666-128914688 CTGACTATAGAGGTGCACAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
985025913 4:185738953-185738975 CTAACTATGCAAATAGAGAATGG - Intronic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986664280 5:10086776-10086798 CAGACAATACAACTGTACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
987446620 5:18027598-18027620 GTGACTATTCAATAGGACAATGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992882196 5:81121449-81121471 ATGACAATAAAAATGGACAAAGG - Intronic
994588617 5:101744663-101744685 GAGACGATACAAATGGAAAAAGG + Intergenic
995232051 5:109777226-109777248 CTGACAATACAAACTGAGAAAGG - Intronic
995704867 5:114977844-114977866 CTGATTTTATAAATGGGCAAAGG + Intergenic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998679442 5:144450163-144450185 GTGACCATACAAATGGCCACCGG + Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999625492 5:153516451-153516473 CTGATTTTACCAATGAACAAAGG + Intronic
999901295 5:156089451-156089473 TTCACTATACAAAATGACAACGG - Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002613780 5:180437711-180437733 CTAACAATACAAATGGAAAGTGG - Intergenic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004977152 6:20980901-20980923 CTGAGTCTTCAAATGGGCAAAGG - Intronic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008952954 6:57180893-57180915 TTGAGTATACAAATCAACAAGGG + Intronic
1011104695 6:83766648-83766670 CTGACTAAAGAAATGGGGAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014198851 6:118587066-118587088 CTTACTGTACAAATGGGCCATGG - Intronic
1014644941 6:123961081-123961103 CAGACTATAGAATTGAACAAGGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015095536 6:129410504-129410526 CTAACTAAACAAATTGAGAAAGG - Intronic
1015208283 6:130666846-130666868 AAGCCTATACAAATAGACAATGG + Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1016063854 6:139658510-139658532 CTGGCCATACAATTGGAGAAAGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016710542 6:147166348-147166370 CTCAGTATACAAATACACAATGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019773353 7:2897358-2897380 CTGAGTATAAAAATGGTCACTGG + Intergenic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1020793409 7:12654209-12654231 CTTACCACACAAATGGACTATGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1022047743 7:26636205-26636227 CTGTGTATACCAAGGGACAACGG + Intergenic
1022405039 7:30081083-30081105 CTACCTATACAAATGCAAAATGG - Exonic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1023665333 7:42517164-42517186 CTAACTATATAAATGAACAGTGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1028147463 7:87334233-87334255 CTGATTATAAAAATTGGCAAAGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1031057507 7:117009719-117009741 ATGACTATAAAAAAGGACATTGG - Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031241383 7:119246347-119246369 TTGACAATACAAATGAACATAGG - Intergenic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035114224 7:156509295-156509317 CTGACTGAATAAATGGACAGTGG - Intergenic
1038134324 8:24769272-24769294 CTGACTATCCAAATGAAAATGGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040460808 8:47646117-47646139 CTCAGTATAAAAATGGGCAAAGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041661497 8:60405753-60405775 CTGACTATAAACATTAACAAAGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044687053 8:94836249-94836271 CTGACTAGAAAAAAGGGCAAAGG - Intronic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1048409035 8:134152479-134152501 CTTACTAAACAAATAGAAAAGGG - Intergenic
1048767394 8:137859898-137859920 CTCACTCTACAAATGGGAAAAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051581419 9:18680211-18680233 CTGATTATACCAATAGACATGGG + Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056263497 9:84873123-84873145 CTGACCATCAAAATGGACCATGG - Intronic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057239237 9:93393383-93393405 CTGACTGTTGAAAGGGACAAGGG - Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058435719 9:104961232-104961254 CTGACTATCCATATGGATAGTGG - Intergenic
1058471879 9:105288117-105288139 CTGATTATACAAATATGCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188882846 X:35511254-35511276 CGGATAATACAAAGGGACAAAGG + Intergenic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193186294 X:78516907-78516929 CAGACTATTCAAATTGAAAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195037908 X:100986953-100986975 CTGACTATAGAATGGGCCAAGGG - Intronic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1197073126 X:122324104-122324126 CTTACTATACAATTGAGCAATGG + Intergenic
1197112381 X:122791558-122791580 CAGACTATACAAATGTCGAATGG - Intergenic
1197847636 X:130820129-130820151 CCGATTTTAAAAATGGACAAAGG + Intronic
1199556568 X:149115344-149115366 CTGACAAAACAAATGGGGAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic