ID: 971273413

View in Genome Browser
Species Human (GRCh38)
Location 4:25172565-25172587
Sequence CAAAGTGACCACTTTGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971273407_971273413 13 Left 971273407 4:25172529-25172551 CCAAAACTAGTAATGGGAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 106
Right 971273413 4:25172565-25172587 CAAAGTGACCACTTTGAATTTGG 0: 1
1: 0
2: 0
3: 11
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971273413 Original CRISPR CAAAGTGACCACTTTGAATT TGG Intronic
902905540 1:19554036-19554058 CACAGTGACTGCTTTGAATATGG + Intergenic
903434997 1:23343030-23343052 CAAAATGAGCATTTTGTATTTGG - Intronic
903842587 1:26254507-26254529 CACAGTGAGCACTCTCAATTGGG - Intronic
905448615 1:38043535-38043557 CAAAGACACCACATGGAATTCGG - Intergenic
906852698 1:49268926-49268948 AAAGGTGACACCTTTGAATTTGG + Intronic
906939559 1:50244370-50244392 CAAGGTGATCATTTTGAAATGGG - Intergenic
907160796 1:52367287-52367309 TAAAGTAACCACTTCGATTTTGG + Intergenic
909705434 1:78577415-78577437 CAGAGTGACTTCTCTGAATTGGG + Intergenic
911894974 1:103422201-103422223 CATAGTAACCAATTTGAGTTGGG - Intergenic
912594301 1:110858852-110858874 CAAAGTCACAGCCTTGAATTAGG + Intergenic
916474480 1:165155628-165155650 CAAAGTGACCACTTGTGCTTTGG + Intergenic
916516490 1:165522813-165522835 CAGAGTGATCATTATGAATTAGG - Intergenic
916968426 1:169980088-169980110 CAAACTAACCACTTTGAAGGAGG + Intronic
917550620 1:176023757-176023779 AAAAGTAAACACATTGAATTAGG + Intronic
917780574 1:178391637-178391659 CACAGTGGACTCTTTGAATTTGG + Intronic
918391829 1:184073150-184073172 CAAAGAGACAACTTTGAGTGTGG - Exonic
918893236 1:190303723-190303745 AAAATTAACTACTTTGAATTTGG + Intronic
921683835 1:218067086-218067108 CAAGGTGACAACTTTGAAGGGGG + Intergenic
922729927 1:227944571-227944593 GGGAGTGACCACTGTGAATTGGG - Intronic
923433197 1:233943691-233943713 TAATGTGATCACTTTGAATAAGG + Intronic
1063668949 10:8084251-8084273 CAAGGTGACAACTTTTATTTGGG - Intergenic
1064564356 10:16624913-16624935 CAAAGTGACTAATATTAATTAGG - Intronic
1065635267 10:27726328-27726350 AAAAGTCACAACTTTGACTTAGG + Intronic
1067731480 10:48814809-48814831 AAAAATGAGCACTGTGAATTTGG + Intronic
1068137592 10:52965763-52965785 CCCAGTGTCCACTTTGATTTTGG - Intergenic
1068580431 10:58732943-58732965 CAAAGTGAGCACATTGCTTTTGG + Intronic
1068608388 10:59031488-59031510 GAGAATGACCACTCTGAATTGGG + Intergenic
1068611188 10:59062167-59062189 CACACTGACGACTGTGAATTAGG + Intergenic
1069868941 10:71521491-71521513 GAAAGTGACCACTTGGTATTGGG - Intronic
1071716298 10:88099703-88099725 CAAAGTGCCCAGTATAAATTTGG + Intergenic
1072397274 10:95057315-95057337 TAAAGTGTACACTTTAAATTGGG + Intronic
1075152452 10:119946454-119946476 AAAAGTGACCACTTTCAAGCTGG - Intergenic
1076072998 10:127507409-127507431 CACAGTGTGCACTCTGAATTAGG + Intergenic
1081721914 11:45295511-45295533 CAAATTCACCAGTTTGATTTTGG - Intergenic
1086410346 11:86538794-86538816 CAAAGTGAGGAGTTTGGATTGGG - Intronic
1088977596 11:114829677-114829699 AAAAGAGACCACAATGAATTAGG - Intergenic
1089071507 11:115703208-115703230 GAATTTGACCACCTTGAATTTGG - Intergenic
1089749672 11:120642045-120642067 CACACTGTCCACTTTGTATTGGG + Intronic
1091156940 11:133382914-133382936 CTAGGTGACCTCCTTGAATTTGG + Intronic
1096405552 12:51341481-51341503 GAAAGTGACGACTTTGAAGAAGG + Intronic
1098306070 12:69103859-69103881 TGAAGTGACCACTGTGACTTAGG - Intergenic
1099326290 12:81219028-81219050 CAAAGTGACAAGTTTGCATAAGG - Intronic
1101346325 12:103889506-103889528 CAAAGTGACCGCCTTGCACTGGG - Intergenic
1106047509 13:26157187-26157209 CAAACTGTACACTTTAAATTGGG + Intronic
1106407173 13:29484255-29484277 CAAAGTGGCCTCTGTGAATTTGG - Intronic
1107579000 13:41761873-41761895 CTAAGTGAAAACTTTGAAATAGG - Intronic
1107668454 13:42717301-42717323 CAAAATGAACAATTTTAATTGGG + Intergenic
1108166526 13:47699124-47699146 CAAAGTGACTTCTTTGGGTTTGG - Intergenic
1108297226 13:49035883-49035905 CAAACTAACGAATTTGAATTTGG - Intronic
1108920265 13:55664516-55664538 CAAAGTAACTGCTTTGATTTTGG - Intergenic
1109078969 13:57873705-57873727 TAAAGTTACCACTTTTAATGTGG - Intergenic
1109393814 13:61727103-61727125 CAAATTTAAAACTTTGAATTAGG + Intergenic
1110397877 13:75052975-75052997 AAAAGTGAACACTTGGAAGTTGG + Intergenic
1111771881 13:92606918-92606940 CAAAGTCAAAACTTTGAATGGGG - Intronic
1112720569 13:102239637-102239659 CAAAGGGACCACTTTTGGTTAGG - Intronic
1112733389 13:102392731-102392753 CTTAGTGGCCAGTTTGAATTTGG - Intronic
1112734548 13:102401548-102401570 CAAAGAAACCACATTGATTTGGG + Exonic
1116246080 14:42413864-42413886 AAAAGATACCACTTTGAATGGGG - Intergenic
1116780066 14:49227315-49227337 CAAATAAACCACCTTGAATTAGG + Intergenic
1117323684 14:54648807-54648829 GAAAATGACCACTCTGAATGCGG + Intronic
1120055495 14:79919319-79919341 CCAAGTAACAACTTGGAATTGGG + Intergenic
1126288962 15:47049526-47049548 CACAGTGATCATTTTTAATTTGG + Intergenic
1126296019 15:47135423-47135445 CTAAGTAACCACTCTGAATGGGG - Intergenic
1126306658 15:47266424-47266446 CTAAGTGACAACTTTGTTTTTGG + Intronic
1127306875 15:57714968-57714990 CAAAGTTACCTCTTTTCATTTGG - Exonic
1131015847 15:89057424-89057446 CACAGTGACCACTGGGAAGTTGG + Intergenic
1131784982 15:95902955-95902977 CAAATTGACCCCTTTGTAATAGG - Intergenic
1133461232 16:5988356-5988378 TAAAGTAATCACTTTGAATTAGG - Intergenic
1133534785 16:6691390-6691412 GAAAGTGACAAGTTTGGATTGGG - Intronic
1137786813 16:51145619-51145641 AAAACTGACAAATTTGAATTAGG - Intronic
1139226915 16:65241494-65241516 AAAAGTAACCACTCTGAATTGGG + Intergenic
1139809729 16:69604346-69604368 CAGAGTGATCTCATTGAATTAGG + Intronic
1140745720 16:77978566-77978588 GAAAGTGACCACTTTGACCATGG + Exonic
1143362789 17:6385359-6385381 CAAAGTGACCAAGTTCACTTTGG - Intergenic
1143597375 17:7923342-7923364 CAAAGTGAGGACTTTGTAGTGGG + Intronic
1145952691 17:28831844-28831866 CAAAGTGTCTACTTTTAAGTAGG + Intronic
1147036293 17:37683953-37683975 CAAGGTGTCCCCTTTGACTTAGG - Intergenic
1147346646 17:39801608-39801630 CACAATGACCTCTTTGTATTAGG + Intronic
1148278484 17:46328099-46328121 CAAAGTGAGACTTTTGAATTGGG + Intronic
1148300693 17:46545962-46545984 CAAAGTGAGACTTTTGAATTGGG + Intronic
1148927877 17:51103516-51103538 CACAGTGAACATTTTGAATTTGG - Intronic
1151216681 17:72581935-72581957 AAAAGTGACCAATAGGAATTGGG + Intergenic
1153044793 18:845913-845935 AAAAATGATCACTTTTAATTTGG - Intergenic
1155537470 18:26832212-26832234 CAAACTGACCAGTAAGAATTTGG - Intergenic
1156136038 18:34039202-34039224 CAATGTAACCACTTAAAATTAGG - Intronic
1158190819 18:54826699-54826721 CACAGTGACCACTGTGAGCTCGG + Intronic
1158602498 18:58866597-58866619 CAAAATGCCCACTTCGAAGTAGG - Intronic
1167139924 19:47643380-47643402 CAAAGTGAAGGCTTTGAATGTGG + Intronic
928343118 2:30462849-30462871 CAAAGTAACCAGTCTGAATAGGG + Intronic
930132178 2:47863531-47863553 TAAAGTTACCACTTTTATTTAGG - Intronic
931245179 2:60486373-60486395 GAAAGTGAACTCTTAGAATTTGG - Intronic
931989417 2:67774948-67774970 GATAGTGACCACTGTGTATTAGG - Intergenic
935540615 2:104343914-104343936 CAGAGTGATTACTGTGAATTGGG - Intergenic
935815921 2:106845629-106845651 CAAGGTGACCACATTGAGGTAGG - Intronic
939567814 2:143805236-143805258 CAAAGGGACACCATTGAATTTGG - Intergenic
939646318 2:144703603-144703625 CAAAGTCACTACTTGGAAGTGGG + Intergenic
940031132 2:149262662-149262684 CAAAGTGACCTCTGTGTTTTGGG + Intergenic
941438991 2:165509832-165509854 CAAGGATACCACATTGAATTCGG + Intronic
942067396 2:172284595-172284617 CAAATAGGCCACTTTGAAGTAGG - Intergenic
942291898 2:174481508-174481530 CAAAGTAATGACTTTGCATTGGG - Exonic
942489017 2:176471092-176471114 CAACGTGCCCACATTTAATTTGG + Intergenic
946814512 2:223563044-223563066 AAAAGTGACAATTTTTAATTTGG - Intergenic
1171800356 20:29607712-29607734 CACAGTGATCATTTTTAATTTGG + Intergenic
1171843740 20:30248996-30249018 CACAGTGATCATTTTTAATTTGG - Intergenic
1172409993 20:34713966-34713988 CAAAATGACCCCTTTAATTTGGG + Intronic
1173742782 20:45413271-45413293 AAAAGTGACCATATTGAATATGG - Intergenic
1175861637 20:62153410-62153432 CCAAGTGGCCACTTTGGAATGGG + Intronic
1176977740 21:15342172-15342194 AAAAATGAACACATTGAATTTGG - Intergenic
1178731938 21:35111793-35111815 CAAAGTCACCGCTTTGATTCTGG + Intronic
1180026622 21:45167253-45167275 CAAAGTGAACTGTATGAATTAGG + Intronic
1180913843 22:19471755-19471777 CAAACTGACCAATAAGAATTCGG - Exonic
1181341440 22:22182895-22182917 CAAAGTGACCCCAGTGAATGAGG + Intergenic
1184167257 22:42737169-42737191 CAAAGCAACCACTTCAAATTTGG - Intergenic
949744311 3:7270783-7270805 CAAAGTAACCACTTCGATTTTGG + Intronic
949973104 3:9428332-9428354 CAAATTGATCTCTTTTAATTTGG + Intronic
950721030 3:14882711-14882733 AAAAGTCACCACTTAGAAGTTGG + Intronic
952017663 3:28977563-28977585 CAAAGTGACCACTATGTCATTGG - Intergenic
955618633 3:60836759-60836781 CAAAGCAATCACTTTGATTTTGG + Intronic
955792361 3:62601832-62601854 GAAAGTGAACACTTTGATCTGGG + Intronic
956722208 3:72128150-72128172 CTTGGTTACCACTTTGAATTGGG - Intergenic
959284088 3:104384876-104384898 CAACTTGAACACTTTTAATTAGG - Intergenic
959716225 3:109436006-109436028 CAAAGTGACCACTCTTAAGAAGG - Intergenic
960505217 3:118485703-118485725 CAAAATGACCACATTTATTTTGG + Intergenic
960700873 3:120438231-120438253 CAAACTGCACACTCTGAATTAGG + Intronic
963396686 3:144743457-144743479 TCAAGTGACCACTTTGTATTTGG - Intergenic
963734128 3:149000917-149000939 CTCAATGACCACTTAGAATTTGG - Intronic
964437264 3:156667238-156667260 CAAAATCACCATATTGAATTTGG + Intergenic
964637067 3:158869672-158869694 CAAAGTGAGCACTTTAAGTATGG + Intergenic
966009503 3:175057059-175057081 CACATTGACTACTTTGAAATAGG + Intronic
968261531 3:197328751-197328773 CAAAGTGTCCATTTTGAAAGCGG - Intergenic
970546694 4:17137530-17137552 CAAACTGACCACTGTGAACCAGG + Intergenic
971082158 4:23225874-23225896 CTAAGTGCCTACTTTAAATTTGG - Intergenic
971273413 4:25172565-25172587 CAAAGTGACCACTTTGAATTTGG + Intronic
971510944 4:27422601-27422623 AAAAATGACCACTTTCAATACGG + Intergenic
974904658 4:68039939-68039961 CAAAGTTACCTCTTTTCATTTGG - Intergenic
975424071 4:74206171-74206193 CAAAGTAACTCCTTTGATTTGGG + Intronic
977665419 4:99642153-99642175 GAAAGGGACCATTGTGAATTTGG + Intronic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
977823836 4:101506705-101506727 CAACGTGACCATATTAAATTAGG + Intronic
980424315 4:132606946-132606968 CCCAGAGAACACTTTGAATTTGG - Intergenic
981981409 4:150796285-150796307 CAAGTTGACCTCTTTGAATTAGG + Intronic
985268041 4:188168123-188168145 CAATGTGAGCAGTGTGAATTTGG + Intergenic
987023038 5:13894895-13894917 CAAAATGACTACTTTTATTTAGG + Intronic
989101175 5:37824587-37824609 CAAAGTCATCACTTTGAAATAGG - Intronic
990690231 5:58355446-58355468 CAAAGGGTCCACTTTGAAGCAGG + Intergenic
991603102 5:68373090-68373112 CAAAGTAACTGCTTTGATTTTGG + Intergenic
994068146 5:95566614-95566636 AAAAGTGAACAATTTGACTTGGG - Intronic
994742275 5:103635117-103635139 CAAAGTGAAAAGTCTGAATTTGG - Intergenic
995872690 5:116759505-116759527 CAAAGTGAGCACTTAGAAAATGG + Intergenic
996636721 5:125699502-125699524 AAATGTGGCCAGTTTGAATTGGG - Intergenic
997176850 5:131787506-131787528 CAAACTGAGGACTTTGAACTTGG + Intronic
999637375 5:153636617-153636639 CAAAGTGAGGACTCTGAAGTTGG + Intronic
1000126265 5:158246820-158246842 CAAGCTGCCCATTTTGAATTTGG + Intergenic
1000422457 5:161054248-161054270 CAAAGTGACAACTTAGGCTTAGG - Intergenic
1000954283 5:167523936-167523958 CACATTTACGACTTTGAATTTGG - Intronic
1001239851 5:170060222-170060244 ATTAGTGACCACGTTGAATTTGG - Intronic
1005051144 6:21685021-21685043 TAAAGTGAGAATTTTGAATTTGG - Intergenic
1006607315 6:35267396-35267418 CAAAATGACCACTTTAGACTAGG + Intronic
1006688375 6:35857469-35857491 CAAAGTGAGAACTTTGGTTTGGG - Intronic
1009544287 6:65004634-65004656 CCAAGTTATCACTGTGAATTTGG - Intronic
1009587960 6:65630168-65630190 CACAGTGACCATTTTGACATGGG - Intronic
1009684576 6:66939920-66939942 CATACTGACCATGTTGAATTAGG - Intergenic
1009818228 6:68764446-68764468 GAAAGTGACCACTTTGGCTCAGG + Intronic
1012299536 6:97568701-97568723 CAAAGTTACAATTCTGAATTAGG - Intergenic
1014929764 6:127321598-127321620 AAAAGTAAGCACTTTGAATATGG - Intronic
1015398376 6:132760495-132760517 TAAGGTGATCATTTTGAATTGGG - Intronic
1020483246 7:8689011-8689033 AAAAGAGACTACTATGAATTTGG - Intronic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1021000010 7:15317115-15317137 CAACGTTACCACTTTGAAAATGG - Intronic
1024966197 7:55023976-55023998 CAAGCTGGCCAGTTTGAATTTGG + Intronic
1027814166 7:82947844-82947866 CAAAGTATTCACTTTGGATTTGG - Intronic
1029908019 7:104111846-104111868 CAAAGTGAAAAATTTAAATTTGG + Intergenic
1031338171 7:120563850-120563872 CAAAGCCACCAGATTGAATTAGG + Intronic
1035128197 7:156626342-156626364 AAAAGTAACCATTTTGAAATAGG + Intergenic
1036411022 8:8501301-8501323 CAATGTGACCATTTTGAATGAGG + Intergenic
1036673888 8:10813035-10813057 CACAGTGATCATTTTGAATCAGG + Intronic
1037744636 8:21632949-21632971 CAACGTGACCACTTGGAACAGGG - Intergenic
1040717803 8:50279735-50279757 CAAAGAGGTCACTTTGACTTTGG + Intronic
1042967199 8:74366866-74366888 CAAAGTGAGTACTTTGTTTTAGG - Exonic
1046323627 8:112611922-112611944 CAAAGTGACTGCTTTGTAATAGG - Intronic
1047119466 8:121884613-121884635 CACAGTGATTACTTTGGATTGGG + Intergenic
1047284615 8:123476817-123476839 CAAAATGACTACTTTGAAATAGG - Intergenic
1051786311 9:20748033-20748055 CAAAGTGAGCATTTTGCTTTTGG + Intronic
1052657963 9:31389311-31389333 CACGTTGACCACTTTGAACTAGG + Intergenic
1054164358 9:61706833-61706855 CACAGTGATCATTTTTAATTTGG + Intergenic
1058120489 9:101133390-101133412 GAAAGTGAACAGGTTGAATTTGG + Intronic
1188713569 X:33432589-33432611 AAAAGAGACCACTTATAATTTGG - Intergenic
1189757737 X:44287922-44287944 CAAACTGCCCACTTTGTCTTGGG + Intronic
1191996142 X:67097145-67097167 CAAAATGCCCACTTTGAAGGAGG - Intergenic
1197058245 X:122146210-122146232 CAAATTGCCCAGTTTTAATTTGG - Intergenic
1197509125 X:127349362-127349384 CACAGTGACTACATTGCATTTGG + Intergenic
1197669664 X:129262546-129262568 CAAAGTCTCCACTTTGACTGAGG - Intergenic
1198601141 X:138285509-138285531 CAAAGTGGCTACTATGTATTAGG - Intergenic
1199418752 X:147618694-147618716 CAAAGTATTCACTCTGAATTTGG + Intergenic
1199627704 X:149756387-149756409 CAAAGAGAACACTATGAAATAGG + Intergenic