ID: 971276687

View in Genome Browser
Species Human (GRCh38)
Location 4:25205168-25205190
Sequence GGGTTGGTTACTACAGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971276687_971276691 1 Left 971276687 4:25205168-25205190 CCACAATCTGTAGTAACCAACCC 0: 1
1: 0
2: 2
3: 12
4: 146
Right 971276691 4:25205192-25205214 TTATCTCTAGCCAACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971276687 Original CRISPR GGGTTGGTTACTACAGATTG TGG (reversed) Intronic
901096080 1:6681565-6681587 GGGTTGGTTACTACAGGTTAGGG - Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906924758 1:50103240-50103262 GTTTTGTCTACTACAGATTGTGG - Intronic
913175923 1:116273277-116273299 GTGGTGGTTACTAGAGGTTGTGG - Intergenic
915014028 1:152716910-152716932 GTGCTGGTTACGAGAGATTGGGG + Intergenic
917577201 1:176336089-176336111 GGGTTGGTTTCTAGAGAAAGTGG + Intergenic
918088998 1:181271557-181271579 GGAATGGTTACTTCAAATTGAGG + Intergenic
919054883 1:192557955-192557977 GTGGTGGTTACTAAAGGTTGAGG + Intergenic
919159255 1:193807099-193807121 AGGTTGGTTACTATACATTGAGG + Intergenic
920552245 1:206872347-206872369 GGGCTGGTTGTTGCAGATTGTGG - Intergenic
1070587508 10:77777753-77777775 GGACTGGTTACTGCAGACTGTGG - Intergenic
1070612025 10:77939952-77939974 GAATTGGTTGCTACAGGTTGTGG - Intergenic
1070755936 10:78993307-78993329 GGGCTGGTTAGAAGAGATTGTGG - Intergenic
1079218119 11:18533325-18533347 GTGTTGGTTACCACAGGCTGCGG - Intronic
1080237351 11:30086535-30086557 GGGCTGGTTACTATAGATAATGG + Intergenic
1081902323 11:46639452-46639474 GGGCTGGTTGCTTCAGGTTGTGG + Intronic
1084726628 11:70946376-70946398 GGGTTGGTTAGTAGAGAGGGAGG - Intronic
1084726803 11:70947033-70947055 GGGTTGGTTAGTGCAGAGGGAGG - Intronic
1085351423 11:75800373-75800395 GGGTTGGGTGCTCCAGCTTGGGG - Exonic
1087095254 11:94311942-94311964 GGGCTGGTTACTATAGATAATGG + Intergenic
1093512827 12:19949227-19949249 GGGCTGGTTGCTGCAGACTGTGG - Intergenic
1094399144 12:30042321-30042343 GGGTTTGTTATAGCAGATTGTGG - Intergenic
1094794597 12:33956543-33956565 GGGCTAGTTACTGCAGATTGAGG - Intergenic
1095535262 12:43238470-43238492 GGGCTGGTTACTATAGATAATGG + Intergenic
1095556560 12:43513281-43513303 GGGTTGGTTTCTTGAGAATGTGG - Intronic
1095754473 12:45748522-45748544 GTGGTGGTTACTGAAGATTGGGG + Intronic
1100814354 12:98371656-98371678 AGGCTGGTTGCTGCAGATTGTGG + Intergenic
1100872737 12:98928213-98928235 GAGTTGGTTTCAACAGTTTGTGG - Intronic
1103859939 12:124004136-124004158 GGGTTGCTTAACACAGATTTGGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1107679395 13:42832677-42832699 GGTTTGATTACTAAAGATTCAGG + Intergenic
1107778640 13:43875534-43875556 GGGTTGCTTGCTGCAGGTTGTGG - Intronic
1110197825 13:72811164-72811186 GGGTTGTTTATTAAAAATTGAGG - Intronic
1111058405 13:82980265-82980287 GGCATAGTTACTACAGATTCTGG + Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112086712 13:96039769-96039791 GACTTGGTTTCTACAGTTTGTGG - Intronic
1113958542 13:114112625-114112647 GGGTTGGTAACTGGAGAATGGGG + Intronic
1115486995 14:33920535-33920557 GTGGTGGTTGCTAAAGATTGTGG - Intergenic
1115915821 14:38312848-38312870 GGGTTGAAAACTACATATTGAGG - Intergenic
1120287213 14:82519105-82519127 AAGTTGGTTGCTGCAGATTGTGG + Intergenic
1120412882 14:84179387-84179409 AAGTAGGTTACTTCAGATTGGGG + Intergenic
1122851457 14:104534725-104534747 GGGCTGGTTACTATAGATAATGG - Intronic
1126391818 15:48164688-48164710 GTGATGGTTACTAAAGTTTGGGG - Intronic
1132703024 16:1230001-1230023 GGGCTGGGGGCTACAGATTGTGG + Intronic
1132705299 16:1240867-1240889 GGGCTGGGGGCTACAGATTGTGG - Intronic
1132708427 16:1256230-1256252 GGGCTGGGGGCTACAGATTGTGG - Exonic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1137804663 16:51293177-51293199 GTGGTGGTTGCTAAAGATTGGGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144221369 17:13102773-13102795 GGGTAGGTTGCTGCAGGTTGTGG + Intergenic
1145285642 17:21504140-21504162 GGGCTGGTTGCTGCAGATTATGG + Intergenic
1145391882 17:22461559-22461581 GGGCTGGTTGCTGCAGATTATGG - Intergenic
1150993163 17:70284438-70284460 AAGCTGGTTACTACAGACTGGGG - Intergenic
1151483855 17:74386505-74386527 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
1151905465 17:77045611-77045633 GGGTTGGTTAATGCAGAGTGAGG - Intergenic
1152095384 17:78269126-78269148 AGGTTGGTAATTCCAGATTGAGG + Intergenic
1153375352 18:4370849-4370871 TGGCTGGTTACTTCAGATGGGGG - Intronic
1153833526 18:8944060-8944082 GAGCTGGTCACTGCAGATTGTGG - Intergenic
1153986669 18:10357087-10357109 GGGCTGGTTACTGTAGATGGTGG - Intergenic
1153986680 18:10357155-10357177 GGGCTGGTTACTGTAGATGGTGG - Intergenic
1154205005 18:12328706-12328728 GGGGTGGTTATCACAGATTCAGG + Intronic
1159611249 18:70527767-70527789 GGGCTGGCTGCTGCAGATTGTGG + Intergenic
1162844038 19:13378519-13378541 GGGGTGGTTGCTGAAGATTGGGG - Intronic
1163656537 19:18549147-18549169 GGGGTGGGGACTATAGATTGAGG - Intergenic
1164875134 19:31679398-31679420 GGGTTGGTGACTATGGATTTAGG + Intergenic
1168616833 19:57844629-57844651 AGCATGGATACTACAGATTGTGG + Exonic
926099035 2:10102016-10102038 GAGTTGCTAACTACAGATGGGGG + Intergenic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
927396587 2:22658202-22658224 GTGGTGGTTGCTAAAGATTGGGG - Intergenic
931954955 2:67412638-67412660 GGGTTGCTTACTGCAGACAGTGG + Intergenic
933993421 2:87649981-87650003 GGGATGATTGCTACAGATTGTGG + Intergenic
934625153 2:95841703-95841725 GTGGTGGTTGCTGCAGATTGAGG - Intronic
934729683 2:96648734-96648756 GGGCTGGTTGCTGCAGATGGTGG + Intergenic
934808412 2:97259568-97259590 GTGGTGGTTGCTGCAGATTGAGG + Intronic
934829097 2:97497618-97497640 GTGGTGGTTGCTGCAGATTGAGG - Intronic
936300438 2:111300902-111300924 GGGCTGATTGCTACAGATTGCGG - Intergenic
936547044 2:113401112-113401134 GTGGTGGTTGCTGCAGATTGAGG + Intergenic
937357379 2:121206586-121206608 GGATTGGTATCTACAGATTAAGG + Intergenic
938058930 2:128237348-128237370 GGCCTGGTTGCTGCAGATTGCGG - Intronic
939085892 2:137717639-137717661 GGCTGGGTTACAATAGATTGTGG + Intergenic
941735345 2:168968908-168968930 TGGTTGGTTAATTTAGATTGAGG + Intronic
941908167 2:170737102-170737124 AGGTTGGTTGCTGCAGATTGTGG - Intergenic
942309194 2:174638554-174638576 CAGATGGTTACTAGAGATTGGGG - Intronic
943836213 2:192516883-192516905 GGACTGTTTGCTACAGATTGTGG + Intergenic
1169236979 20:3937619-3937641 TGGTTGGTTGCCAGAGATTGGGG - Intronic
1173319949 20:41978434-41978456 GGGCTGGTTAAAACAGATGGCGG + Intergenic
1173393310 20:42654518-42654540 CGGATGGTTACTACAGAGAGGGG + Intronic
1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG + Intergenic
1177761433 21:25406721-25406743 GTGGTGGTTGCTACAGAGTGAGG - Intergenic
1182869573 22:33634261-33634283 GGGCTTGTTACAACAGAGTGCGG + Intronic
1184050015 22:41997462-41997484 GGGTGGGTCACTACAGATGTTGG + Exonic
952003552 3:28814059-28814081 GTGGTGGTTACTAAAGGTTGTGG + Intergenic
952201516 3:31133616-31133638 TGGATGGTTACTAGAGATGGTGG - Intergenic
956697895 3:71934204-71934226 GGGCTGGTTGCTTCAGGTTGTGG - Intergenic
961471927 3:127120558-127120580 TGGCTGGTTGCTGCAGATTGTGG + Intergenic
962488444 3:135867128-135867150 GGGCTGGTTAATAGAGATAGTGG + Intergenic
962488457 3:135867231-135867253 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
964930049 3:162008041-162008063 GTGGTGGTTGCTAAAGATTGGGG + Intergenic
967648695 3:191958792-191958814 GGGTTGGTTGCTGCAGTTTGTGG - Intergenic
970208228 4:13678408-13678430 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
970246861 4:14072864-14072886 GGGTTGGTTACTGCAGATATGGG - Intergenic
971276687 4:25205168-25205190 GGGTTGGTTACTACAGATTGTGG - Intronic
971409583 4:26355864-26355886 GGGATGGTTAATTCAGACTGGGG + Intronic
972401944 4:38713021-38713043 GGGCTAGTTGCTGCAGATTGTGG + Intergenic
975526971 4:75361612-75361634 AGATTGGTTACTACGAATTGTGG + Intergenic
976239219 4:82935770-82935792 GGGTTTATTATTACAGCTTGGGG - Intronic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
979474630 4:121140615-121140637 GAGTTGGCTTCTACAGGTTGGGG - Intronic
983203631 4:164888552-164888574 GGGCTGGTTGCTGCAGTTTGTGG + Intronic
983433582 4:167682728-167682750 GGGTTGGTTCCTTCTGAGTGTGG - Intergenic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
991612915 5:68467125-68467147 GGGGTGGTTATTACATATTGTGG - Intergenic
992226520 5:74624305-74624327 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
992939259 5:81747209-81747231 GGGTAGGATGCTACAGATTTAGG - Intronic
994454720 5:99990409-99990431 GGATTGGTTGCTGCAGATTCTGG - Intergenic
996352096 5:122555587-122555609 GTGGTGGTTGCTAAAGATTGGGG - Intergenic
996670888 5:126115520-126115542 GGGCTGGTTGCTGCAGGTTGTGG + Intergenic
996810142 5:127507387-127507409 GGACTGGTTGCTACAGGTTGTGG - Intergenic
997810051 5:136958194-136958216 GGGCTGTTTACCACAGATTATGG + Intergenic
997810056 5:136958228-136958250 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
1002006227 5:176237230-176237252 GTGTTTGTTAAGACAGATTGCGG - Intergenic
1003675573 6:8201477-8201499 GGATTGGTTACTATAGATAAGGG + Intergenic
1004039349 6:11960543-11960565 GGGCTGGTTGCTGCAGGTTGAGG - Intergenic
1004350931 6:14889882-14889904 GGGTTGGGAACTACAGCCTGTGG - Intergenic
1007517469 6:42424577-42424599 CAGTTGGGTAGTACAGATTGAGG - Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1011247327 6:85333140-85333162 AGACTGGTTGCTACAGATTGTGG + Intergenic
1011410554 6:87061792-87061814 GAGCTGGCTCCTACAGATTGAGG - Intergenic
1015452887 6:133391081-133391103 GGGTAGGTTAGCACAGCTTGTGG + Intronic
1016797955 6:148137947-148137969 GGGCTGGTTGCTGCAGACTGTGG + Intergenic
1016849336 6:148601157-148601179 GGGCTGGTTACTCCAAGTTGTGG - Intergenic
1021330353 7:19330608-19330630 TGCTTTGTTACTACAAATTGAGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1025968604 7:66300170-66300192 GTGGTGGTTGCTAAAGATTGGGG + Intronic
1026298122 7:69073718-69073740 GTGGTGGTTACTACAGGCTGGGG - Intergenic
1026463942 7:70637723-70637745 GGGTTGGTTTTTATAGATGGTGG + Intronic
1026597943 7:71750188-71750210 GGGCTTGTTAAAACAGATTGAGG - Intergenic
1029323093 7:99782500-99782522 GGGGTGGTCACTACAGACTCAGG - Intronic
1031795584 7:126170269-126170291 GGGCTGGTTGCTGCAGATTGCGG + Intergenic
1035409597 7:158628651-158628673 GGGTTGGGTATTACAGTATGTGG - Intergenic
1036610631 8:10346881-10346903 GGGCTGGTTGCTGCAGGTTGTGG + Intronic
1037093647 8:14954678-14954700 GATTCGGTTCCTACAGATTGTGG - Intronic
1038698846 8:29830710-29830732 GGGATGGTTTCTAGAGATAGTGG - Intergenic
1041131170 8:54702598-54702620 GTGGTGGTTGCTGCAGATTGGGG + Intergenic
1041146553 8:54881952-54881974 GGGTTGGTTGCTGCAGAGTTTGG + Intergenic
1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG + Intronic
1053465360 9:38303371-38303393 GTGGTGGTTACTGAAGATTGGGG + Intergenic
1054902473 9:70383615-70383637 GGAGAGGCTACTACAGATTGAGG - Intergenic
1054962470 9:70983931-70983953 GGGGTGGTTACTGCAGATTGTGG + Intronic
1055276129 9:74619019-74619041 TGGTTAGTGACTACAGATTAAGG + Intronic
1061762611 9:132860821-132860843 GGGTGGGCTGCTGCAGATTGTGG + Intronic
1062059910 9:134489702-134489724 GGGTGGGTTGCTGCGGATTGTGG + Intergenic
1194181885 X:90720516-90720538 GTGGTGGTTACTAAAGGTTGGGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1196194104 X:112822360-112822382 GGCTTGCACACTACAGATTGGGG + Exonic
1197364968 X:125552872-125552894 GGGTTTCTTTCTACAAATTGTGG - Intergenic
1197977005 X:132176447-132176469 GGGTTGGTGATCACAGAGTGAGG + Intergenic
1200528511 Y:4302433-4302455 GTGGTGGTTACTAAAGGTTGAGG - Intergenic