ID: 971279088

View in Genome Browser
Species Human (GRCh38)
Location 4:25226504-25226526
Sequence GAGTTAATACAGACGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971279088_971279089 3 Left 971279088 4:25226504-25226526 CCTTGTTTCGTCTGTATTAACTC 0: 1
1: 0
2: 0
3: 7
4: 147
Right 971279089 4:25226530-25226552 TTCCCGATCCTCCCAAATCTTGG 0: 1
1: 0
2: 1
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971279088 Original CRISPR GAGTTAATACAGACGAAACA AGG (reversed) Intronic
900202578 1:1417450-1417472 AAGTTAATTTAGACTAAACAAGG - Intergenic
902051843 1:13569340-13569362 AAGTTAATTTAGACTAAACAAGG + Intergenic
906499447 1:46330843-46330865 AAGTTAATTTAGACTAAACAAGG - Intergenic
906622471 1:47294860-47294882 GAGAGAATACTGAAGAAACAGGG + Intronic
911429352 1:97764090-97764112 AAGTTGATAAAGAGGAAACAAGG + Intronic
913751107 1:121967821-121967843 GAGTTGATACACACAACACAAGG - Intergenic
913858900 1:123745314-123745336 GAGTGAATACACACAACACAAGG - Intergenic
914510034 1:148324154-148324176 AAGTTAATTTAGACTAAACAAGG - Intergenic
916766574 1:167866572-167866594 AAGTTAATTTAGACTAAACAAGG + Intronic
917053166 1:170948215-170948237 AAATTAACACAGAAGAAACAGGG + Intronic
917115806 1:171601864-171601886 AAGTTAATTTAGACTAAACAAGG + Intergenic
918756497 1:188344697-188344719 AAGTTAATACAGAAGATATACGG - Intergenic
920450137 1:206053921-206053943 AAGTTAATTTAGACTAAACAAGG + Intronic
923722050 1:236475337-236475359 GACTTAACACAGAGCAAACAAGG - Intronic
1063346918 10:5320245-5320267 GAGAGAGTACAGTCGAAACATGG + Intergenic
1065148789 10:22800416-22800438 GAGTTAAGTCACAAGAAACAAGG - Intergenic
1065545026 10:26810147-26810169 GAGTTAGTGCAGACCACACAAGG - Intronic
1067467518 10:46511901-46511923 GATATAATACAGATGAAACTGGG + Intergenic
1067619668 10:47872704-47872726 GATATAATACAGATGAAACTGGG - Intergenic
1068972784 10:62977090-62977112 GAGTTATTACATAAGAATCATGG + Intergenic
1071288449 10:84170939-84170961 AAGTTAATTTAGACTAAACAAGG - Intergenic
1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG + Intronic
1072689208 10:97560402-97560424 AAGTTAATTTAGACTAAACAAGG - Intronic
1074975584 10:118578713-118578735 GAGGTATAAGAGACGAAACATGG + Intergenic
1076032282 10:127169881-127169903 GAGTTAATACAGACGAAGTGTGG - Intronic
1078333742 11:10447320-10447342 GAGTTAATACAGAGAGAAGATGG + Intronic
1078412886 11:11142221-11142243 GAAATAATACATACAAAACATGG + Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079789114 11:24713548-24713570 AAGTTAATACAGGCCAGACACGG + Intronic
1084501363 11:69537488-69537510 GAGATATTTCAGAAGAAACACGG - Intergenic
1088574984 11:111262641-111262663 GGGTTCAAACAGACGAAAGAAGG - Intronic
1093508611 12:19899802-19899824 AAGATAATACAGAAGAAAAATGG - Intergenic
1095406069 12:41868747-41868769 GAGTTGATACATAAGAAACGCGG + Intergenic
1096993294 12:55822190-55822212 GAGGTAAAACAGAAGAAATAAGG + Intronic
1103776600 12:123371038-123371060 GAGTCAATACAGGCGAGGCACGG + Intergenic
1109497952 13:63198850-63198872 AAGTTAGTACAGAGGTAACATGG - Intergenic
1113000846 13:105634349-105634371 CAGTTAATGCAGATCAAACAGGG + Intergenic
1116175093 14:41459083-41459105 GAGTTAATCCAGACAGAACTGGG - Intergenic
1125027288 15:35043469-35043491 GAGTTAATGATGACGAAAGATGG - Intergenic
1125424323 15:39534030-39534052 GAGATAATACAGGCAGAACAGGG + Intergenic
1128141787 15:65307018-65307040 GATTTAATTCAGACGCAATAGGG - Intergenic
1129044757 15:72724900-72724922 GAGTTAATAAGGAAGAAACCTGG - Intronic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1140692964 16:77502022-77502044 GAGTTTCTGCAGACAAAACAAGG + Intergenic
1140822647 16:78677764-78677786 GTATTAAAACAGAGGAAACATGG + Intronic
1144187701 17:12811642-12811664 GACTTAATACAGACCCAACAAGG - Intronic
1146112174 17:30099927-30099949 GAGTGAATACAGAAAAAAGAGGG - Intronic
1149784048 17:59420863-59420885 GAGTTAACACAAAGGACACAAGG + Intergenic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1153160641 18:2200956-2200978 GAGTTAATACAGAAGGGAGAAGG + Intergenic
1158070572 18:53465683-53465705 GAGTCAATAAAGAGGAAAAAGGG - Intronic
1159331400 18:66998626-66998648 GAGTACATACACATGAAACAAGG + Intergenic
1159531555 18:69661987-69662009 GAGTTTATTCAGAAGAACCAAGG - Intronic
1159933884 18:74344583-74344605 TAGTTGATAAAAACGAAACAAGG - Intronic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1163929188 19:20372350-20372372 AAGTTAATACGGACTGAACAAGG + Intergenic
1167935463 19:52903309-52903331 AAGTTAATTTAGACTAAACAAGG - Intergenic
926036453 2:9639676-9639698 TAATTAATACAGACCAAGCAAGG - Intergenic
927001472 2:18798863-18798885 GAGCTGATCCAGAAGAAACACGG - Intergenic
928397317 2:30952973-30952995 GATTTTATACAGAAGAGACAAGG - Intronic
928411149 2:31055005-31055027 GAGGTCATACAGAGGAAACCCGG + Intronic
928520876 2:32087399-32087421 GAGGTAATACATAAAAAACAGGG - Intronic
930200294 2:48546291-48546313 GAGTTAATGCAGGTGACACAGGG - Intronic
934232765 2:90200561-90200583 GAGTTAATAGAGACAAGATACGG - Intergenic
943452659 2:188064707-188064729 CATTTAATACAGAGTAAACAAGG + Intergenic
944225601 2:197346087-197346109 GATTTAACCCAGACCAAACAAGG - Intergenic
945966744 2:216195666-216195688 GATTCAATACACACCAAACAAGG - Intronic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
947049277 2:226023972-226023994 AAGATAATACAGACAAAATAGGG + Intergenic
948484985 2:238274791-238274813 GGGTTGATACAGACAGAACAAGG - Intronic
1178791338 21:35703028-35703050 GAGGTAATACAAGAGAAACAAGG - Intronic
1182132663 22:27868648-27868670 GAGTTAACACAGAAGACAAATGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
953266653 3:41396174-41396196 GGGTAAATAAAGACCAAACATGG - Intronic
957038173 3:75314061-75314083 GAGGTAATACTGAGGGAACATGG + Intergenic
958000039 3:87739129-87739151 AAGTTAATTTAGACAAAACAAGG - Intergenic
958052944 3:88371315-88371337 GAGTTATTGCAGAGTAAACAGGG + Intergenic
959850462 3:111080948-111080970 GAGTTTAGACAGATAAAACAGGG + Intronic
961968253 3:130928598-130928620 AGGTCAATACAGACTAAACAAGG - Intronic
963198257 3:142558220-142558242 GAGTTAAAACAAACCACACAAGG + Intronic
966645585 3:182243386-182243408 GAGTTAATACATATGAATGAAGG - Intergenic
966657086 3:182371495-182371517 GAATTTATACAGGTGAAACATGG + Intergenic
966986023 3:185181074-185181096 GGGTTGATACAGATGTAACAGGG - Intergenic
969325704 4:6442644-6442666 GAGTTAATTCATATAAAACACGG - Intronic
971027297 4:22600759-22600781 AAGTTAATTTAGACGAAACAAGG + Intergenic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
972185633 4:36524459-36524481 TGGTTTATACAGAAGAAACAGGG - Intergenic
972274913 4:37547797-37547819 AAGTTAATTTAGACTAAACAAGG + Intronic
974987945 4:69052367-69052389 AAGTTAATTTAGACTAAACAAGG + Intronic
976990372 4:91358075-91358097 AAGTTAATTTAGACTAAACAAGG - Intronic
977570469 4:98623851-98623873 ACGTGAATACAGAGGAAACATGG - Intronic
978552425 4:109941688-109941710 GATTTTATACAGATAAAACAGGG - Intronic
978580706 4:110228775-110228797 GAGTGAATTCAGACTACACAGGG - Intergenic
979052456 4:115951895-115951917 AAGTTAATTTAGACTAAACAAGG + Intergenic
979071878 4:116218162-116218184 GAGTTAAAAAAGACAAAAAATGG + Intergenic
979423004 4:120529647-120529669 AAGTTAATAAAAAAGAAACAAGG - Intergenic
980373863 4:131916470-131916492 GAGTTGAGACAGTAGAAACAAGG - Intergenic
981405972 4:144369563-144369585 GAGTCATTTCAGAAGAAACAGGG + Intergenic
982334559 4:154219458-154219480 AAGTTAATACAGAAGAATAAAGG - Intergenic
982522038 4:156430064-156430086 GAATTAAAAGAGAAGAAACAAGG - Intergenic
987157890 5:15109384-15109406 AAGATAATATAGACCAAACAGGG - Intergenic
989557560 5:42814806-42814828 AAGTTAATTTAGACTAAACAAGG + Intronic
989776022 5:45207591-45207613 AAGTTAATTTAGACTAAACAAGG + Intergenic
990678282 5:58213159-58213181 GAGTGAGTACAGAGGAGACATGG - Intergenic
992734916 5:79709332-79709354 GAGTTATTATAGAGGAAACTTGG + Intronic
995488964 5:112669831-112669853 GAGGAAATACAGACAAAGCAAGG - Intergenic
998847745 5:146327230-146327252 AAGTTTATACAGAAGACACAGGG - Intronic
998938810 5:147258875-147258897 GAGTTAATTTTGACTAAACAAGG - Intronic
999717545 5:154373555-154373577 GAGATAATATAGATGAAATAGGG + Intronic
1000604932 5:163317989-163318011 AAGTTAATTTAGACTAAACAAGG - Intergenic
1004812724 6:19277294-19277316 AAGTTAATATGGACGGAACAAGG + Intergenic
1005977760 6:30813150-30813172 GAGTAAATAGAGAGGAAACCGGG - Intergenic
1006032205 6:31185367-31185389 AAGTTAATTTAGACTAAACAAGG - Intergenic
1006570615 6:35000283-35000305 AAGTTAATTTAGACTAAACAAGG + Intronic
1007183194 6:39945565-39945587 GATTTAAAACAGACCACACAGGG - Intergenic
1008123341 6:47642463-47642485 AAGTTAATTTAGACTAAACAAGG + Intergenic
1011190001 6:84718552-84718574 AAGTTAATTTAGACTAAACAAGG - Intronic
1015316781 6:131825881-131825903 AAGTTAATAAAGATGAAAAATGG - Intronic
1016559232 6:145376283-145376305 GATTTAATACTCATGAAACAAGG - Intergenic
1021081825 7:16373786-16373808 GAGATAAGCCAGAAGAAACAGGG + Intronic
1021867605 7:24974238-24974260 GAGGGAGTACAGAGGAAACAAGG - Intronic
1022042115 7:26591133-26591155 GAGTTACTACAGAGGAACCTGGG + Intergenic
1022656784 7:32326636-32326658 GAGTTTATACAGAGGACAAAAGG + Intergenic
1023341089 7:39220541-39220563 TAGTTAATACAGAAGCTACATGG + Intronic
1024305977 7:47929876-47929898 GATTTAATAGACACGAAAGATGG + Intronic
1024887187 7:54157058-54157080 GACTTAATACAGATCAAGCATGG - Intergenic
1028787160 7:94808554-94808576 GATTGAATCCAGAGGAAACACGG + Intergenic
1033290708 7:140080449-140080471 TAGGAAAGACAGACGAAACATGG + Intergenic
1038032935 8:23660830-23660852 GAGTTAATGCAGACCCCACAGGG + Intergenic
1039155402 8:34550373-34550395 AACTTAATACAGATGAATCATGG - Intergenic
1039211904 8:35226725-35226747 GAGTAAATAAAGACAAAACTAGG + Intergenic
1041226968 8:55709989-55710011 AAGTTAATTTAGACAAAACAAGG + Intronic
1043325733 8:79048775-79048797 TAGTTAATACAGAGGAAACTGGG + Intergenic
1045537670 8:103047569-103047591 GACATAACACAGTCGAAACAGGG - Intronic
1045883744 8:107071420-107071442 GTGTTAATAGAGAAGAAAGAGGG + Intergenic
1051240311 9:15048051-15048073 GAGTTCCTACAGAGGAAAAAAGG + Intergenic
1053110928 9:35459557-35459579 AAGTTAATTTAGACTAAACAAGG - Intergenic
1053638846 9:40046702-40046724 GAGTTGAGACAGTAGAAACAAGG - Intergenic
1053767236 9:41418500-41418522 GAGTTGAGACAGTAGAAACAAGG + Intergenic
1054319642 9:63643272-63643294 GAGTTGAGACAGTAGAAACAAGG - Intergenic
1054545905 9:66330001-66330023 GAGTTGAGACAGTAGAAACAAGG + Intergenic
1056207331 9:84333174-84333196 AAGATAATACAGACGAAATGGGG + Intronic
1056485910 9:87058081-87058103 GAGTGAATGCAGAAAAAACAGGG + Intergenic
1057737147 9:97673644-97673666 AAGTTCATACAGACAAAAGATGG + Exonic
1058246169 9:102628125-102628147 GAGTCAACACACACAAAACATGG - Intergenic
1058950441 9:109898722-109898744 GAGTTAGTGCAGAAGAAAAATGG - Intronic
1059074558 9:111178776-111178798 GATTTAATGCAGACCAAACACGG + Intergenic
1060784660 9:126441154-126441176 GAGTAAATACAGAGGAAAAAGGG - Intronic
1202786718 9_KI270719v1_random:30303-30325 GAGTTGAGACAGTAGAAACAAGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189915610 X:45851997-45852019 TAGTTAATGTAGAAGAAACAGGG - Intergenic
1193731167 X:85105629-85105651 GAGTTCATACAGAGGATACTTGG + Intronic
1195850693 X:109278887-109278909 AAGTTAATACAGACTGAACGAGG - Intergenic
1201372852 Y:13283805-13283827 AAGTTAATTTAGACTAAACAAGG + Intronic