ID: 971279916

View in Genome Browser
Species Human (GRCh38)
Location 4:25234328-25234350
Sequence GGAGGGCGAGGCCGGCGACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 425}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971279900_971279916 30 Left 971279900 4:25234275-25234297 CCGCGGAGAGGCGCCCCAGGCAG 0: 1
1: 0
2: 0
3: 18
4: 207
Right 971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG 0: 1
1: 0
2: 3
3: 33
4: 425
971279906_971279916 5 Left 971279906 4:25234300-25234322 CCGTGAGGCTGCTGGACGCTGCC 0: 1
1: 0
2: 1
3: 19
4: 231
Right 971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG 0: 1
1: 0
2: 3
3: 33
4: 425
971279902_971279916 17 Left 971279902 4:25234288-25234310 CCCCAGGCAGCGCCGTGAGGCTG 0: 1
1: 0
2: 0
3: 8
4: 211
Right 971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG 0: 1
1: 0
2: 3
3: 33
4: 425
971279903_971279916 16 Left 971279903 4:25234289-25234311 CCCAGGCAGCGCCGTGAGGCTGC 0: 1
1: 0
2: 0
3: 8
4: 154
Right 971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG 0: 1
1: 0
2: 3
3: 33
4: 425
971279904_971279916 15 Left 971279904 4:25234290-25234312 CCAGGCAGCGCCGTGAGGCTGCT 0: 1
1: 0
2: 1
3: 6
4: 126
Right 971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG 0: 1
1: 0
2: 3
3: 33
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971279916 Original CRISPR GGAGGGCGAGGCCGGCGACG AGG Exonic
900156843 1:1206608-1206630 GGCGGGTGAGGACGGGGACGGGG - Intronic
900179216 1:1304015-1304037 GGAGGGCGAGTCTGGCCATGTGG + Intronic
900244228 1:1630202-1630224 GGGGGGCGAGGCTGGGGGCGGGG - Intronic
900357723 1:2272841-2272863 GGAGGGCGAGGCTCGGGGCGTGG - Intronic
900473263 1:2864683-2864705 GGAGGGCGGAGCTGGCGTCGGGG + Intergenic
900610741 1:3543579-3543601 GCGGGGCGAGGCCAGGGACGGGG + Intronic
900749857 1:4388643-4388665 GGAGGGTGGGGCTGGGGACGGGG + Intergenic
901078918 1:6572696-6572718 GGAGGGCGAAGCCTGCTCCGGGG - Intronic
901628989 1:10639124-10639146 CGAGGACGAGGACGACGACGAGG - Exonic
902333182 1:15740919-15740941 GGAGGCCGAGGCGGGCGGCAAGG - Exonic
902875561 1:19338734-19338756 GGAAAGCGAGGCCGGCGAGAAGG + Intergenic
903377608 1:22876530-22876552 GCAGGGGGAGGCCGGCCAGGCGG - Intronic
903967674 1:27100474-27100496 GGAGGACGAGGACGACGATGGGG - Exonic
904029978 1:27527873-27527895 CGAGGGCGAGGGCGACGGCGAGG - Intergenic
904237089 1:29122956-29122978 GGAGGGCGAGGGAGAAGACGCGG + Intronic
904256933 1:29260086-29260108 GAGGGGCGGGGCCGGCGACGGGG + Intronic
904528730 1:31154825-31154847 GGAGACCAAGGCCGGCGCCGGGG - Intergenic
904528798 1:31155003-31155025 GGAGGGCGGGGCCGGAGTCGAGG + Intergenic
904744673 1:32703220-32703242 GCAGGGCGCGGCCGGGGAGGAGG + Intronic
905075663 1:35268819-35268841 GGAGGGCCTGCCCGGGGACGGGG - Intergenic
905202135 1:36322552-36322574 GGAGCCCGAGGACGACGACGAGG - Exonic
905617116 1:39408943-39408965 GGAGGACGAGGGCGGGGGCGGGG - Intronic
905731923 1:40303821-40303843 GCAGGGCGAGTCCGGCGAGCCGG - Exonic
906292997 1:44632040-44632062 GGCCGGCGAGGGCGGCGATGCGG - Intronic
907282799 1:53361977-53361999 TGAGGGCGAGGCCGGCTGCCAGG + Intergenic
907883908 1:58576274-58576296 GGACGGCCATGCCGGCGACGAGG + Exonic
908534759 1:65067154-65067176 GGAGCGCGGGGGCGGCGGCGCGG - Intergenic
911696563 1:100895997-100896019 GGAGGGCGTGGCTTGCGGCGGGG - Exonic
913449193 1:118981072-118981094 GGAGGCCGAGGCGGGGGGCGGGG - Intronic
914264659 1:146028049-146028071 GGAGGCCGAGGCAGGCGGCCGGG - Intergenic
914869060 1:151458636-151458658 GGCGGGAGGGGCCGGCGAGGGGG - Intronic
914899844 1:151706089-151706111 GGAGGGAGTGGCCGGAGACTTGG - Intronic
914902928 1:151721472-151721494 GCAGGGCGGGGCCGGGGGCGGGG + Intronic
914919630 1:151838540-151838562 GGGCGACGAGTCCGGCGACGAGG + Exonic
914993100 1:152515472-152515494 GGAGGAGGAGGCGGGCGCCGGGG - Exonic
915123142 1:153645099-153645121 GGAGGCCGAGGCCGAGGCCGTGG + Exonic
915123144 1:153645105-153645127 CGAGGCCGAGGCCGTGGACGAGG + Exonic
916029244 1:160862156-160862178 GGAGGGCGAGGCCAGCAGCCAGG - Intronic
916037243 1:160933023-160933045 GGAGGCCGAGGCAGGCGGCTGGG - Intergenic
917291698 1:173477592-173477614 GGAAGGCGAGGGCGGCGCAGGGG - Intronic
917869549 1:179229448-179229470 GGAGCCCGAGGCCGGAGCCGAGG - Exonic
922925119 1:229342132-229342154 GGACGCGGAGGCCGGGGACGCGG - Exonic
922958507 1:229625676-229625698 GGAGGCCGAGGGCGGAGGCGCGG + Intronic
923109449 1:230879572-230879594 AGAGGGGGAGGCCGGCAAGGGGG - Intergenic
923109525 1:230879800-230879822 GGAGGGGGAGGCCGGCAGAGGGG - Intergenic
923109538 1:230879837-230879859 GGAGGGGGAGGCCGGCAGAGGGG - Intergenic
923482410 1:234397381-234397403 GGAGGGGGAGGACGGGGATGGGG + Intronic
924415282 1:243850682-243850704 GGCGGGCAGGGCCGGGGACGCGG - Intronic
1063180922 10:3599196-3599218 GGAGGGCGAGGCGGGCGGATCGG + Intergenic
1063907814 10:10798727-10798749 TGAGGGCGAGTCCGGAGAGGAGG - Intergenic
1063995140 10:11611697-11611719 GGCGGGCGGGGCCGGAGGCGCGG - Intronic
1064035239 10:11908956-11908978 GGAGGGCGAGGCCCTGGACATGG - Intergenic
1065214690 10:23438858-23438880 GCGGGGCGAGGCCGGGGGCGCGG - Intergenic
1067084371 10:43230060-43230082 GGCGCGCGGGGCCGGCGAGGGGG + Intronic
1067145435 10:43690312-43690334 GGAGGGCGCGGCCGGCAGCAGGG - Intergenic
1069386068 10:67884584-67884606 AGAGGGCGGGGGCGGCGATGGGG + Intergenic
1069957871 10:72062774-72062796 GGCAGGCGAGGCTGACGACGGGG - Exonic
1070145764 10:73772417-73772439 GGAGAGGGAGGCCGGCGGGGAGG + Exonic
1070570847 10:77638397-77638419 GGGCGGCGAGGACGGGGACGAGG - Intronic
1071086961 10:81875741-81875763 GGAGGGGGTGGCGGGGGACGTGG - Exonic
1071598108 10:86942617-86942639 CGAGGCCGAGGCCGGGGCCGGGG - Exonic
1072611246 10:97018954-97018976 GGAGGCAGAGGCCGGGGAGGAGG - Intronic
1073446594 10:103584657-103584679 GCCGGGCGCGGACGGCGACGAGG + Exonic
1073766233 10:106685694-106685716 GGAGGGAGAGGCTGGAGACCAGG + Intronic
1074121734 10:110498352-110498374 GGAGGGCGGCGGCGGCGTCGCGG + Exonic
1074536944 10:114334807-114334829 GCAGGGAGAGGCAGGAGACGGGG + Intronic
1075169732 10:120102067-120102089 GGAGGGCGAGGGAGGGGAGGGGG + Intergenic
1075753248 10:124791393-124791415 AGAGGGCGAGGCTGGCGAATAGG - Intronic
1076026817 10:127122358-127122380 GGAGGACCAGGCTGGCAACGAGG - Intronic
1076313351 10:129523548-129523570 GGAGGGCCGGGCTGCCGACGTGG + Intronic
1076737114 10:132463862-132463884 GGAGTGCGTGGCCGGTGATGAGG + Intergenic
1076878820 10:133230326-133230348 GGCGGGCGAGGGCGGCGCGGGGG - Exonic
1077035107 11:490660-490682 TGAGGGCAAGGCCGGGCACGTGG - Exonic
1077190105 11:1252463-1252485 GGAGGGCGAGGACAGCGGGGCGG - Exonic
1077253922 11:1572286-1572308 GGAGGGCGGGGCCGCCGGCGGGG + Intergenic
1077499307 11:2902070-2902092 GGCGGGCGAAGCCGGGCACGGGG + Intronic
1077508676 11:2943897-2943919 GCAGGGCGGGGCCAGCCACGTGG + Intergenic
1078316050 11:10294100-10294122 CGGCGGCGAGGGCGGCGACGGGG - Exonic
1078631753 11:13009786-13009808 GGACGACGAGGACGACGACGAGG + Intergenic
1080283441 11:30584666-30584688 GGAGGCTGAGGTCGGGGACGTGG - Intronic
1081608337 11:44541859-44541881 GGAGGGCGATGACGGTGACTTGG + Intergenic
1081981558 11:47270081-47270103 GGAGGGGGAGGCCGGGGCCGGGG - Intronic
1082023403 11:47553184-47553206 GGAGGGGGAGCGCGGCGAGGGGG + Intronic
1083184189 11:61007987-61008009 GGAGGGCGAGGCTTGCGTCCAGG - Intronic
1083454757 11:62771372-62771394 GGAGGGCGGGGCCGGGGCCCCGG + Exonic
1083656938 11:64234458-64234480 GGGGGGCGAGGCCGTCGGCGGGG - Intergenic
1083672035 11:64305298-64305320 GAGGGGCGGGGCCGGAGACGCGG - Intergenic
1083940034 11:65890786-65890808 GGAGGCCGAGGCAGGCGGCCTGG + Exonic
1084046106 11:66568489-66568511 CGAGGGCGAAGCCGGCGGCCCGG + Exonic
1084145218 11:67261617-67261639 TGAGGGCGAGGGCGGGGGCGGGG + Intergenic
1084310218 11:68312495-68312517 GGAGGGCGCGGCCGGTGCGGGGG + Intergenic
1085784277 11:79437654-79437676 GGCGGGGGAGGCGGGCCACGAGG + Intronic
1087516423 11:99168323-99168345 GGAGGCCGAGGCCGGGGGGGTGG + Intronic
1088289684 11:108222787-108222809 GGAGGGCGGGGAGGACGACGAGG + Intronic
1089850102 11:121488277-121488299 GGAGGGAGAGGCAGGAGGCGAGG - Intronic
1090780259 11:130001861-130001883 GGAGGCCGAGGCCGGGGTCGCGG - Intronic
1090788593 11:130070397-130070419 GGAGGGCGGGGCGGGCGCCCGGG - Intronic
1091219141 11:133920180-133920202 CGAGGGCTAGGCCGGGGCCGGGG + Exonic
1091393378 12:139124-139146 CGAGGCCGAGGCAGGCGACTTGG + Exonic
1091759373 12:3077183-3077205 GGAAGGGGAGCCCGGGGACGGGG - Intergenic
1096403176 12:51324075-51324097 AGAGGGCAAGGCAGGCGGCGCGG - Exonic
1096461047 12:51821597-51821619 GAAGCGCAAGGCCGCCGACGAGG - Intergenic
1096693545 12:53335287-53335309 GGAGGGGGAGGGGGGCGAGGGGG - Intronic
1096747856 12:53739953-53739975 CGAGGGCGAGGGCGGGGGCGGGG + Intergenic
1096747869 12:53739978-53740000 CGAGGGCGAGGGCGGGGGCGGGG + Intergenic
1096882384 12:54683604-54683626 GGAGGACGAGGCCTGAGAGGAGG - Intergenic
1097267545 12:57755038-57755060 GGCGGGCGGGGCGGGCGCCGGGG - Intronic
1101131793 12:101697771-101697793 GGAGGGAGAGGCTGGCGGCCGGG - Exonic
1103516202 12:121509911-121509933 GGAGGGCGAGGGCAGGGACAGGG - Exonic
1104049499 12:125186291-125186313 GGAGGGCGGGGCCGCGGCCGGGG - Intergenic
1104954338 12:132457145-132457167 GGAGGAGGAGGCAGGAGACGAGG + Intergenic
1105313101 13:19230690-19230712 GGAGGCCGAGGCAGGTGACAAGG + Intergenic
1106057885 13:26254876-26254898 GGAGCCAGAGGCCGGCGTCGAGG - Intronic
1106517112 13:30465253-30465275 GGCGGGCGAGGGCGGCGCGGGGG - Intronic
1106680040 13:31999842-31999864 GGAGGCCGAGGCAGGCGGCTGGG - Intergenic
1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG + Intergenic
1108396608 13:49996853-49996875 GCAGGCGGAGGCGGGCGACGGGG + Intronic
1109024644 13:57142539-57142561 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109025631 13:57149109-57149131 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109026621 13:57155682-57155704 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109027613 13:57162253-57162275 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109028599 13:57168818-57168840 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1110212952 13:72994142-72994164 GGAGGTAGAGGCCGGAGGCGGGG + Intronic
1110318201 13:74134287-74134309 CGAGGGCGGGGGCGGCGGCGGGG + Intergenic
1112070651 13:95846058-95846080 GGAGGGCAAGGCAGGCGGCTGGG + Intronic
1112077377 13:95928828-95928850 GGAGGGCAAGGCAGGCGGCTGGG + Intronic
1113962271 13:114132627-114132649 CGAGGGCGAGGGCGGGGACCGGG + Intergenic
1115399430 14:32939841-32939863 GGAGGAGGAGGCCGGGGGCGGGG + Intronic
1118849565 14:69573482-69573504 GGAGGCCGAGGCCGAGGCCGAGG + Exonic
1119219474 14:72894207-72894229 GGTGGGCGGGGCCTGCGCCGTGG + Intergenic
1119264264 14:73254822-73254844 TGAGGGCGAGGCTGGGGGCGGGG - Intronic
1122217663 14:100214606-100214628 GGAGGGCGGGGCGGGGCACGAGG - Intergenic
1122422139 14:101584270-101584292 GGAGGGCGGGGCCGACGGGGCGG + Intergenic
1122620955 14:103057455-103057477 GGAGGGCGCGGCCGCGGGCGGGG - Exonic
1122666680 14:103334713-103334735 GGAGGGGGCGGCCGGCGCCCGGG - Intronic
1122779793 14:104138783-104138805 GGAGAGGGAGGCGGGCGGCGGGG + Intronic
1122964504 14:105115858-105115880 AGAGGGCCAGGCGGGCGACGTGG + Intergenic
1123221573 14:106862327-106862349 GGAGGGTGGGGCAGGCGAGGGGG - Intergenic
1123710078 15:22980459-22980481 GGAGGGAGCGGCCGGGGCCGCGG - Intronic
1124088050 15:26570398-26570420 GGAGGGCGAGGCCCGCGAGGAGG - Intronic
1125834456 15:42737161-42737183 GAGGGGCGGGGCCGGCGGCGGGG + Intergenic
1126035012 15:44537397-44537419 GGAAGGCGAGGACGAGGACGAGG + Exonic
1128078331 15:64841858-64841880 GGGGGGCGGGGCCGGGGGCGGGG - Intergenic
1128269222 15:66293862-66293884 GGGGGGTGAGGCCGGCGAGCGGG - Intronic
1128327430 15:66734092-66734114 GGAGGGAGAGGCCGGAGAGGCGG + Intronic
1129483229 15:75843875-75843897 GCAGGGCGAGGACGGAGAGGGGG + Intronic
1129752793 15:78077604-78077626 GGAGGGCGGCGGCGGCGGCGAGG - Exonic
1129983678 15:79897198-79897220 GGAGGGCGAGCCGGACCACGGGG - Intronic
1130270769 15:82445780-82445802 GCAGGGCGAGGGCGGAGAGGAGG + Intergenic
1130463111 15:84173103-84173125 GCAGGGCGAGGGCGGAGAGGAGG + Intronic
1130489563 15:84421685-84421707 GCAGGGCGAGGGCGGAGAGGAGG - Intergenic
1130501154 15:84500447-84500469 GCAGGGCGAGGGCGGAGAGGAGG - Intergenic
1131112879 15:89776446-89776468 GGAGGAGGAGGCCGGGGACGTGG - Exonic
1131828749 15:96341151-96341173 GGGGGGCGAGGGCGGGGGCGGGG + Intergenic
1132519855 16:382013-382035 GGAAGGCGAGGGCGGGGTCGGGG + Intronic
1132750442 16:1455103-1455125 GGTGGGCGAGGTGGGCGATGGGG + Intronic
1133048071 16:3100180-3100202 GGAGAGCGAGGCGCGGGACGCGG - Intergenic
1133211229 16:4264355-4264377 GGAAGCCGAGGCCGGGGAAGGGG - Intronic
1133230193 16:4362697-4362719 GGAGGGCGAGGTCAGCGAACTGG + Exonic
1133328684 16:4958059-4958081 GGAGGGCGGGGCCAGTGAAGGGG + Intronic
1135190258 16:20348709-20348731 GGAGGGCTACGCCTGCGACACGG - Exonic
1135691456 16:24540386-24540408 GGAGGACGAGGACGGGGAAGAGG - Exonic
1136413894 16:30092033-30092055 GGGCTGCGAGGCCGGCGGCGCGG + Intergenic
1136574909 16:31117738-31117760 GGAGGGCGAGCCCGGGCCCGGGG + Exonic
1136707562 16:32202122-32202144 GGTGGGCGAAGCCGGCGGCCTGG - Intergenic
1136760348 16:32727288-32727310 GGTGGGCGAAGCCGGCGGCCTGG + Intergenic
1136807756 16:33143098-33143120 GGTGGGCGAAGCCGGCGGCCTGG - Intergenic
1137288908 16:47038173-47038195 GGAGGGCGGGAGCGGGGACGCGG + Intergenic
1137559241 16:49492464-49492486 GGAGGCCGAGGCCGGGGCCGGGG + Intronic
1137683144 16:50368599-50368621 GCAGGCCCAGGCCGGCGAAGGGG - Intronic
1140187381 16:72787458-72787480 GGAGGGGGCGGCGGCCGACGGGG + Exonic
1142163134 16:88569809-88569831 GGAGGGCCCGGCCGGAGACCAGG - Intergenic
1142163329 16:88570614-88570636 GGAGGAGGAGGCCGCCGAGGCGG + Intronic
1142267338 16:89070695-89070717 GGAGGGCAAGGACGGCGGTGGGG - Intergenic
1142343063 16:89536626-89536648 GGCGGGTGAGGCGGGCGAGGTGG + Intronic
1142343068 16:89536644-89536666 GGTGGGCGAGGCAGGCGAGGCGG + Intronic
1203062502 16_KI270728v1_random:987610-987632 GGTGGGCGAAGCCGGCGGCCTGG + Intergenic
1142513151 17:410510-410532 GGAGCGGGAGGGCGGCGCCGCGG + Exonic
1142656757 17:1399750-1399772 GGAGGGCGAGTCCCGGGGCGGGG - Intronic
1142903257 17:3026431-3026453 GGAGGGCGAGGCCATGGAGGAGG + Exonic
1143148243 17:4790122-4790144 GGAAGGCGAGGAAGGCGAGGCGG - Exonic
1143273664 17:5694102-5694124 GGAAGGCGAGGCCGGCAAGCCGG - Intergenic
1143590741 17:7884908-7884930 GGAGGTGGAGGCGGCCGACGAGG + Exonic
1144340834 17:14309372-14309394 GGACGGCGAGGCTGGTCACGTGG - Intronic
1144836016 17:18157095-18157117 GGAGGGGGAGGCTGGCCAAGGGG + Intronic
1147110467 17:38257437-38257459 CGAGGGCGCGGCCGGCGGGGCGG + Intergenic
1147720400 17:42536326-42536348 CGGGGGCGCGGCAGGCGACGAGG + Exonic
1148419040 17:47530994-47531016 CGAGGGCGCGGCCGGCGGGGCGG - Intronic
1148840871 17:50496060-50496082 GGAGGCCGAGGCAGGCGAGACGG - Intergenic
1149486453 17:57046381-57046403 GGAGGGGGAGGACGACGAGGAGG - Intergenic
1150137652 17:62704330-62704352 GGGGGGCGAGGCCGGGGTCGGGG + Intronic
1150643700 17:66965508-66965530 GGAGGTGGAGGCTGGCGAGGGGG + Intronic
1150823886 17:68457598-68457620 GCGGGGCGAAGCCGGGGACGCGG - Intergenic
1151324102 17:73368360-73368382 GGAGGGGTAGGTCGGCCACGGGG - Intronic
1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG + Intergenic
1152524319 17:80878976-80878998 AGAGGGCAAGGCGGGGGACGGGG - Intronic
1152970760 18:158826-158848 GGTGCGCGGGGCCGGCGGCGCGG + Intronic
1153515057 18:5895044-5895066 GGAGGTCGGGGCCGGCGAACGGG + Exonic
1153904701 18:9650763-9650785 GGAGGCCGAGGTAGGCGAGGTGG + Intergenic
1158730514 18:60017622-60017644 GGAGGCGGCGGCCAGCGACGCGG - Intergenic
1158890529 18:61867674-61867696 GGATGGTGAGGCCGGCGATGTGG - Intronic
1160750682 19:732853-732875 GGAGGGCTGGGCAGGCGACCTGG + Intronic
1160750694 19:732893-732915 GGAGGGCTGGGCAGGCGACCTGG + Intronic
1160812763 19:1020101-1020123 GGAGGAAGAGGCCGGGGATGGGG + Intronic
1160827140 19:1085844-1085866 GGAGGACGGGGACGGGGACGAGG + Exonic
1160906460 19:1453785-1453807 GGAGGGGGAGGGAGGCCACGTGG - Intronic
1160949474 19:1658570-1658592 CGAGGTGGAGGCCGGTGACGTGG + Intergenic
1160966641 19:1749631-1749653 CGAGCGCGAGGCGGGCGGCGCGG + Intergenic
1161149998 19:2702591-2702613 TGAGGGCGCGGCCGGCGTCCCGG - Intronic
1161282576 19:3453896-3453918 ACAAGGCGAGGTCGGCGACGTGG - Exonic
1161307942 19:3577790-3577812 GGATGGCGAGGACGGGGACAGGG - Intronic
1162001318 19:7746704-7746726 GGAAGGGGAGGCTGGGGACGGGG - Intronic
1162003859 19:7764991-7765013 GGAGGGAGAGGCTGGGGATGGGG + Intronic
1162344414 19:10111118-10111140 GGTGGGCGAGGCCGGGGCCGGGG + Exonic
1162426840 19:10602356-10602378 AGAGGGCGAGGGCGGGGACCGGG - Intergenic
1162832965 19:13298638-13298660 CGAGGGCGAGGGCCCCGACGGGG - Exonic
1162901058 19:13795699-13795721 GGAGCGCGATGCCGGGGCCGGGG + Exonic
1162924459 19:13923306-13923328 GGAGGACGAGGCTGGTGGCGGGG - Intronic
1163023444 19:14495935-14495957 GCAGGGTGGGGCCGGCGCCGTGG - Intronic
1163442401 19:17328620-17328642 GGAGGACGAGGACGACGAGGAGG - Exonic
1163444360 19:17338119-17338141 GGAGGGCGTGGCCGCTGGCGGGG - Exonic
1163601454 19:18251689-18251711 GGAGGCCGAGGGCGGGGGCGGGG - Intronic
1163698096 19:18774150-18774172 GGAGGGGGTGGCCGTGGACGAGG - Intronic
1164624115 19:29715252-29715274 GGAGGGCGGGGCCAGCGCCGGGG - Intronic
1164784063 19:30915536-30915558 GGAGAGCGAGGCTGGTGATGTGG - Intergenic
1165079249 19:33298344-33298366 GGAGGGCGAGGCCCCCGGGGGGG - Intergenic
1165858650 19:38895062-38895084 GGAGGGCGAGGAGGGAGGCGGGG - Intronic
1166547011 19:43639844-43639866 GGGGGGCGGGGCGGGCGGCGCGG - Intergenic
1166762720 19:45234868-45234890 GGAGGGCGATGCCGGACGCGGGG + Intronic
1167091739 19:47349087-47349109 AGAGGGCGGGGCCGGGGAGGAGG + Intergenic
1167268266 19:48493930-48493952 GGAGGACGAGGACGAGGACGAGG - Exonic
1167376416 19:49114555-49114577 GGTGGGCGGGGCGGGCGCCGGGG + Intronic
1167574141 19:50309694-50309716 GGAGGGCGTGGCATCCGACGAGG + Exonic
1167646492 19:50708490-50708512 GGAGGGCGAGGGCGGGGTTGGGG - Intronic
1167741727 19:51327917-51327939 GGTGGGCGGGGCCGGGGGCGGGG + Intronic
1168339156 19:55613896-55613918 GGAGGACGAGGACGAGGACGAGG - Exonic
1168645896 19:58059310-58059332 GGTGAGCTAGGCCGGCGAGGAGG + Exonic
925376156 2:3387857-3387879 CGAGGGCGACGCGGGCGACCTGG + Exonic
926150866 2:10424994-10425016 GGAGGGCAGGGCAGGCGAGGGGG - Intronic
926878584 2:17514521-17514543 GGAGGCCGAGGGCGGCGGGGGGG + Intronic
926982229 2:18584579-18584601 GGAGGACGAGGACGACTACGAGG - Exonic
927706981 2:25302482-25302504 GGAGGGAGAGGCCAGCCCCGAGG + Intronic
927808968 2:26171692-26171714 AGAGGGCGAGGCCGAGGCCGAGG + Intergenic
928094112 2:28393554-28393576 GGAGGGCGAGGACAGGGAGGCGG - Exonic
928964832 2:36966355-36966377 GGCTGCCGCGGCCGGCGACGGGG - Exonic
929033666 2:37671694-37671716 GCGGGGCGGGGCCGGCGGCGCGG + Exonic
929564251 2:42974975-42974997 GGACGGTGAGGCCTGTGACGGGG + Intergenic
931576300 2:63722091-63722113 GGAGGCCAAGGCAGGCGGCGGGG - Intronic
931587248 2:63841648-63841670 GGCGGGCGAGGCCGGCCAGCGGG - Intronic
931604849 2:64042095-64042117 GGAGGCCAAGGCAGGCGGCGGGG + Intergenic
931754774 2:65362935-65362957 GGAGGCCGAGGCGGGCGAGCAGG + Intronic
932566904 2:72916431-72916453 GGAGGGCGCGGGCGGCGGTGGGG - Intronic
932725811 2:74178833-74178855 GGCGGGCAAGGCGGGCGCCGAGG - Exonic
932757037 2:74416076-74416098 GGAGGGCGAGGACGTCGTAGGGG - Exonic
934079020 2:88452173-88452195 GGCGGGCGAGGCGGGCGCGGCGG + Exonic
935971492 2:108534382-108534404 GGAAGGCGAGGCGGGCCGCGCGG - Intronic
936452815 2:112646097-112646119 GGAGGGCGGAGCGGGAGACGAGG - Exonic
937119383 2:119431528-119431550 CGAGGGCTGGGACGGCGACGAGG - Intronic
938058263 2:128233124-128233146 GAAGGCCGAGCCCGGCGGCGCGG + Intergenic
938260451 2:129892053-129892075 GGAGGGCCAGGCTGGCGGGGAGG - Intergenic
944547334 2:200811559-200811581 GGAGGAGGGGGCCGGCGGCGAGG + Intronic
945054947 2:205860354-205860376 GGAGCTCGAGGCCAGCCACGTGG - Intergenic
945225913 2:207530586-207530608 CGGGGGCGAGGCGGGCGGCGGGG - Intronic
947418324 2:229921205-229921227 GGAGGGCGAGCCCGGAGACGGGG - Intronic
947523422 2:230865099-230865121 GGTGGCCGAGGCCGGCGCAGGGG - Exonic
948393260 2:237627405-237627427 GGACGGCGGGGCGGGGGACGGGG - Intergenic
948393331 2:237627557-237627579 GGAGGGAGGGGCCGGGGCCGGGG + Intronic
948438063 2:237967208-237967230 GGAGGGCGCGGGCGGTGGCGGGG + Intronic
1168765840 20:381218-381240 GGAGGGGGCGGCCGGGGAAGGGG + Intronic
1170204698 20:13785310-13785332 GGGCGGCGGGGCGGGCGACGCGG + Intronic
1171452810 20:25247973-25247995 GGAGGGCGGGGCGGGCGTCCAGG - Intergenic
1172284689 20:33732257-33732279 GGAGAGCCAGGCCGGCGGGGAGG + Intronic
1172603263 20:36197989-36198011 GGAGGGGGAGGCGGGGGAGGAGG - Exonic
1172644576 20:36461684-36461706 GGAGGGCGAGGGCGGGGGCGGGG - Intronic
1173822677 20:46029362-46029384 GGACTGCGAGGACGGCGATGGGG + Intronic
1174701862 20:52617231-52617253 GAAGGGAGAGGCCGGGGAGGGGG + Intergenic
1175358534 20:58389252-58389274 GGAGGGCGAGGGCGAGGCCGCGG - Exonic
1175777774 20:61663855-61663877 GGAGGGCCAGGGCGGCCTCGAGG - Intronic
1175877834 20:62238743-62238765 GGGGGTCGAGGCCGGGGCCGGGG - Intronic
1175881513 20:62262131-62262153 GGAGTGTGAGGCCGGCCATGTGG - Intronic
1176005583 20:62860963-62860985 GGAGGCCGAGGCCGGGGCCGGGG - Intronic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176383517 21:6125741-6125763 GGTGGGAGAGGCCGGGGAGGGGG + Intergenic
1176549734 21:8216030-8216052 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176557625 21:8260259-8260281 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176568659 21:8399064-8399086 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1178610431 21:34074147-34074169 CGGCGGCGGGGCCGGCGACGAGG - Intronic
1179213739 21:39349122-39349144 GGAGCCCGCGGCCGGGGACGCGG - Exonic
1179416024 21:41199350-41199372 GGAGGGGAAGGCTGGCGAGGAGG + Intronic
1179511871 21:41878935-41878957 GGGGCGCGAGGCAGGGGACGGGG + Intronic
1179739953 21:43412497-43412519 GGTGGGAGAGGCCGGGGAGGGGG - Intergenic
1179882665 21:44300037-44300059 GCGGGGCGGGGACGGCGACGCGG + Exonic
1180093105 21:45542590-45542612 GTGGGGAGAGGCCGGCGCCGGGG - Intronic
1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG + Exonic
1180615053 22:17121181-17121203 GGCGGGCGAGGCGGGCTAGGCGG + Exonic
1180743074 22:18067275-18067297 GGATGGCGAGGCTGGAGAGGGGG - Intergenic
1181082782 22:20425537-20425559 GGCGGGCGAGGCTGGCGGCACGG + Exonic
1183517137 22:38273049-38273071 GGAGGGCGGGGCGGCGGACGCGG + Intergenic
1184131630 22:42519883-42519905 GGCGGGCGGGGCCGGGGAGGCGG - Intergenic
1184141848 22:42582098-42582120 GGCGGGCGGGGCCGGGGAGGCGG - Intergenic
1184241776 22:43214713-43214735 GGAGGGCCTGGCGGGCGAGGTGG + Intronic
1184362040 22:44024522-44024544 GGAGGGCGGGGGCGGCCTCGTGG - Intronic
1184740500 22:46426132-46426154 GGAGGGCGCAGCCGGGGAGGGGG + Intronic
1184806327 22:46796897-46796919 GGAGGGCCAGGCAGGTGGCGGGG + Intronic
1185397420 22:50600307-50600329 GGCGGGCGAGGCGGGAGGCGCGG - Intronic
951217669 3:20040326-20040348 GGAGGGCGGGGGCGGGGAGGGGG + Exonic
951881339 3:27483979-27484001 GGGGGGCGCGGCGGGCGTCGCGG - Intronic
953013641 3:39052188-39052210 GCGGGGCGCGGCCGGCCACGAGG + Intronic
954429430 3:50462143-50462165 GGAGGCCGAGGCAGGGGAAGTGG + Intronic
954539765 3:51385524-51385546 AGAGGGCGAGGGCGGGGGCGGGG + Intronic
956761241 3:72447000-72447022 GCAGCCCGAGGCCGGCGACGGGG + Intergenic
957085370 3:75672132-75672154 GGAGGGCAGGGCCGCCCACGCGG + Intergenic
958538112 3:95430774-95430796 GGAGGCCGAGGCAGGAGAAGGGG + Intergenic
958980084 3:100709885-100709907 GGAGGACGAGGCCGGGGGGGAGG + Intronic
960937595 3:122913102-122913124 GGAGGCCCAGGCCGGGGTCGGGG - Intronic
961660726 3:128467623-128467645 GGAGGGCCAGGACGGGGAGGCGG - Intergenic
963252995 3:143119668-143119690 CGGGGGCGGGGCCGGCGAAGGGG + Exonic
963905603 3:150771281-150771303 GGAGGGAGAGGCTGGTGAGGTGG - Intergenic
964358511 3:155871150-155871172 GGAGGCGGGGGCCAGCGACGCGG - Intronic
965590606 3:170357559-170357581 GGAGAGCGAGGGCGGCGGGGAGG - Intergenic
968048129 3:195635396-195635418 GGAGGTCGGGGCAGGGGACGGGG - Intergenic
968099273 3:195954224-195954246 GGAGGTCGGGGCAGGGGACGGGG + Intergenic
968225608 3:196970100-196970122 GGAGTGCGAGGCCGGCGGGGAGG - Intergenic
968306482 3:197654525-197654547 GGAGGTCGGGGCAGGGGACGGGG + Intergenic
968479014 4:825805-825827 GGAGGGAGAGGCCGGAGCCGGGG + Intronic
968584250 4:1408618-1408640 GGCGGGCGAGGCCTGGGTCGGGG + Intergenic
968732239 4:2274811-2274833 GGAGGCTGAGACCGGAGACGCGG + Intronic
968756013 4:2417109-2417131 GGAGGGGTAGGTCGGCAACGCGG + Intronic
968920695 4:3521008-3521030 GGAGGGCGAGGCCAGCCCCCAGG - Intronic
968985381 4:3871879-3871901 GGAGGGGAAGGACGGCGGCGGGG + Intergenic
971279826 4:25233986-25234008 GTGGGGCGCGGCCGGCGGCGAGG + Exonic
971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG + Exonic
971351958 4:25863047-25863069 GGAGGGAGGGGACGGGGACGGGG - Intronic
972765607 4:42150901-42150923 GGATGGCGGGGACGACGACGTGG + Intronic
973273526 4:48285497-48285519 AGAGGCCGATGCCGGCGGCGTGG - Intergenic
979624138 4:122827091-122827113 GGAGGCCGGGGCCGGGGCCGGGG + Exonic
985660855 5:1155908-1155930 GGAGGGCGGGGCCGGCGGGGCGG + Intergenic
985895647 5:2748894-2748916 GGACGACGAGGACGACGACGAGG - Exonic
985990315 5:3552378-3552400 GGAGGGCGGGGCCTGAGAGGAGG + Intergenic
989294018 5:39802836-39802858 GGAGGCCAAGGCGGGCGAGGAGG + Intergenic
990218476 5:53560945-53560967 TGAGTGCGAGGCCGGGGAGGAGG + Intronic
992532962 5:77670311-77670333 GGAGGCCGAGGCCGAGGCCGAGG - Intergenic
992576284 5:78117020-78117042 GGTGAGAGAGGCAGGCGACGGGG - Intronic
992910791 5:81394163-81394185 GGAGGGCGGGGCGGGCGGAGCGG - Intronic
995975846 5:118034059-118034081 GGGGGGCGAGGAGGGCGAGGCGG - Intergenic
997462998 5:134067666-134067688 GGAGGGCGAGGGAGGAGAGGGGG + Intergenic
1001993434 5:176135093-176135115 GGAGGGAGAGGCTGGGGGCGAGG + Intergenic
1002168710 5:177363309-177363331 GAGGGGCGGGGCCGGAGACGGGG + Intronic
1002452424 5:179326474-179326496 GGGGGGCGGGGCCGGGGGCGGGG - Intronic
1002455429 5:179343664-179343686 GGAGGGCAAGGCCTGCGCTGAGG - Intronic
1002526087 5:179816890-179816912 GGAGGGAGAGGCTGGCGAGGGGG + Intronic
1002897973 6:1390090-1390112 GGAGGCGGAGGACGACGACGAGG - Exonic
1003569469 6:7246746-7246768 CGACGGCGAGGCAGGCGCCGGGG + Exonic
1004193686 6:13486453-13486475 GGTGGGGAAGGCCGGGGACGAGG + Intronic
1004529373 6:16439355-16439377 GGGGGGCGGGGCCGGGGGCGGGG + Intronic
1004615045 6:17281436-17281458 CGGGGGCGAGGGCGGCGGCGCGG - Exonic
1005040385 6:21595346-21595368 GGAGGCCGAGGCTGCCGAGGAGG - Exonic
1007785314 6:44276368-44276390 GGACGACGAGGACGACGACGAGG + Exonic
1008378672 6:50819830-50819852 GGCGGCCGAGGCGGGCGAGGTGG + Intronic
1008378679 6:50819848-50819870 GGTGGGAGAGGCGGGCGAGGTGG + Intronic
1008378736 6:50820075-50820097 GGAAGTCGAGGCGGGCGAAGCGG + Intronic
1012400018 6:98835107-98835129 GGGGGGCGGGGGCGGCGGCGGGG + Exonic
1012912779 6:105136761-105136783 CGAGGGCGCGGCCAGCGAGGAGG + Intronic
1012998320 6:105994849-105994871 GGAATGCGAGCCCGGCCACGCGG + Intergenic
1013369314 6:109455782-109455804 GGAGGGCGGGGGCGGGGGCGGGG + Exonic
1014272520 6:119349788-119349810 GGAAAGCGAGGGAGGCGACGCGG + Intergenic
1015440495 6:133241533-133241555 GGAGGGAGAAGCCGGCTCCGAGG - Exonic
1016438896 6:144064148-144064170 GGAGGGCGGGCCGGGTGACGTGG - Intronic
1016714055 6:147203932-147203954 GCGGGGCGAGGCAGGCGGCGCGG + Intergenic
1017021370 6:150142990-150143012 GGAGGGCGGGGAGGACGACGGGG - Intergenic
1017708580 6:157147197-157147219 GGAGGGCAGGGCCGGAGGCGGGG - Intronic
1019537834 7:1538250-1538272 GGACGGCGGGGGCGGCGGCGGGG + Intronic
1019616920 7:1967748-1967770 GCAGGGCGCGGCCGGCCGCGGGG + Intronic
1020083099 7:5296825-5296847 GGAGGGCGGGGCCGGTGGGGAGG + Intronic
1021365540 7:19773372-19773394 GGAGGAAGAGGACGACGACGAGG - Exonic
1022207970 7:28180818-28180840 GGAGGGCGGGGGCGGGGGCGGGG + Intergenic
1025211204 7:57020405-57020427 GGAGGGCGGGGCCGGCGGGGAGG - Intergenic
1025660751 7:63556442-63556464 GGAGGGCGGGGCCGGCGGGGAGG + Intergenic
1026017333 7:66681839-66681861 GGAGGGCGACGCCGGCACCGCGG - Intronic
1026025373 7:66740408-66740430 GGAGGGCGACGCTGGCTCCGCGG - Intronic
1026833723 7:73624603-73624625 GGTGGGCGGGGCCTGGGACGGGG + Intergenic
1026968341 7:74454035-74454057 GGGAGGCGAGGACGGCGGCGCGG - Exonic
1029123026 7:98281291-98281313 GGAGGGCGGGGCCTGAGAGGGGG - Intronic
1029445848 7:100612533-100612555 GGTGGGCGTGGCCGTCGAGGTGG + Exonic
1029537170 7:101163595-101163617 GGACGGGGAAGCCGGCGCCGAGG - Exonic
1029640209 7:101815750-101815772 GGAGGGGGAGGGCGGCGGTGGGG + Intergenic
1029715089 7:102321392-102321414 GGAGGGCGAGGCAGGCGGGCAGG - Exonic
1031243009 7:119270288-119270310 GGAGGGCAAGGCCCACGATGAGG + Intergenic
1031604071 7:123748457-123748479 GCAGGGCGAGGGCGCCGACGAGG + Intronic
1032014533 7:128369594-128369616 GGAGGCCGAGGCCGGAGCGGGGG + Intergenic
1032359894 7:131245516-131245538 GGAGGCCGAGGCCGGGGGCGGGG - Intronic
1032545495 7:132738244-132738266 GGAGGGCGAGGCAGGGGTGGTGG + Intergenic
1033099722 7:138460180-138460202 GGAGGGCGGGGGCGGGGGCGGGG + Intergenic
1033662063 7:143408893-143408915 GGGGGGCGGGGCCAGCGCCGGGG + Intergenic
1034430303 7:151037954-151037976 GGAGGGCGAGGCTGCCAAGGAGG - Intronic
1034448683 7:151126149-151126171 GGAGGGCGTTGCCGAGGACGGGG + Intronic
1035021724 7:155804516-155804538 GGAGGGGGAGGCCCGCGAGCTGG - Intronic
1035161143 7:156950571-156950593 GCAGAGCGAGGACGACGACGAGG + Exonic
1035602090 8:902814-902836 GGTGGGCGGGGCCGCCGGCGTGG + Intergenic
1035730335 8:1849831-1849853 GGAGGGCTTGGGCGGCCACGTGG + Intronic
1036664811 8:10731158-10731180 GGAGGGCGAGGCCGTCGTTCTGG + Intronic
1036709310 8:11068174-11068196 GGAGGGCGAGGACAGCCACTGGG - Intronic
1036749747 8:11436271-11436293 GGAGGGCCAGGCCCGCCACTAGG + Intronic
1036803202 8:11808353-11808375 GGAGCGGGAGGCCGGGGGCGGGG + Intronic
1037787698 8:21912351-21912373 GGTGGCCGAGGCCGGCGGAGAGG - Exonic
1037989982 8:23314952-23314974 GGAGGGGGTGGCCAGCGAGGAGG + Intronic
1045098976 8:98825968-98825990 GGCGGGCGGGGCCGGTGCCGCGG + Intronic
1045459311 8:102412467-102412489 GGAGTGCGAGGCAGGCGGCCGGG + Exonic
1046871404 8:119208759-119208781 GGAGGGCCCGGGCGGCGGCGCGG - Intronic
1047259235 8:123241178-123241200 GGAGGGCGAGGCCTGGGGCCCGG + Intronic
1048214083 8:132480304-132480326 GGAGGGCGGCGGCCGCGACGAGG - Exonic
1049396433 8:142403143-142403165 GGCGGGCGAGGCGGGCGGGGCGG + Exonic
1049405258 8:142449552-142449574 GGAGGAGGAGGCCGAGGACGAGG - Exonic
1049544676 8:143224760-143224782 GGAGGCTGAGGCCGGTGGCGAGG - Intergenic
1049693607 8:143973277-143973299 GGCGGACGAGGCCGGCGGAGTGG + Intronic
1049698308 8:143994371-143994393 GGAGGGCGGGGCAGGCGAGGAGG - Intronic
1049710463 8:144060810-144060832 GCAGGGCGAGGACGGAGGCGCGG - Intronic
1049759985 8:144327558-144327580 GGAGGGCGAGGGCGAGGGCGAGG + Intergenic
1049789480 8:144466266-144466288 GGAAGGCGAGCGCGGGGACGGGG - Exonic
1051278905 9:15422420-15422442 GGAGGGCGAGGGCCGAGACCAGG - Intergenic
1051344482 9:16139952-16139974 GGAGGGGGAGGACGGGGAGGAGG - Intergenic
1053323494 9:37120716-37120738 AGACGTCGAGGCCGGCGAGGGGG - Exonic
1053434880 9:38068178-38068200 GGAGGACGAGGACGAGGACGCGG + Exonic
1054731416 9:68705588-68705610 GGCGGGCGGGGCCGGGGCCGGGG - Intronic
1057596443 9:96418869-96418891 CGAGGGCGGGGCGGGCGGCGGGG - Intergenic
1058439088 9:104991222-104991244 GGCGGGCGGGGCCGGCGCTGGGG - Intergenic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1059191790 9:112333712-112333734 GGAGGGCGGGGACGGTGAGGGGG - Intergenic
1060470224 9:123942453-123942475 GGAGGGTGAGGCAGGGGACAAGG + Intergenic
1060477923 9:123999610-123999632 GGGTGGGGAGGCCGGGGACGCGG + Intergenic
1060962672 9:127692145-127692167 GGAGGTCAAGGGCGGCGAGGGGG - Exonic
1060987042 9:127825735-127825757 GGAAGGCGTGGCCGGCCACAAGG - Exonic
1061275786 9:129568874-129568896 GGAGGGAGAGGCCGGAGCAGGGG + Intergenic
1061666138 9:132161958-132161980 GGCGGGCGATGCGGGCGGCGCGG + Exonic
1061737404 9:132670664-132670686 GGAGGGAGAGGGGGGCGGCGAGG + Exonic
1061961532 9:133991525-133991547 AGAGGCGGAGGCCGGCGAGGGGG + Intronic
1062105747 9:134753873-134753895 GAAGGGCGAGCCGGGAGACGTGG + Exonic
1062332187 9:136049702-136049724 GGAGGACGAGGAGGACGACGAGG - Exonic
1062533915 9:137013376-137013398 GGTGGGCCAGGCGGGCGAGGGGG - Intronic
1062651165 9:137578577-137578599 GGAGGGCGGGGCCGGCCACGAGG - Intronic
1203767827 EBV:35482-35504 CGAGCGGGAGGCCGGGGACGTGG - Intergenic
1203780238 EBV:96634-96656 GGAGGTGGAGGCCGGGGTCGAGG + Intergenic
1186426035 X:9465000-9465022 TGAGGGAGGGGCCGGCGGCGGGG + Exonic
1187048858 X:15675969-15675991 GGAGTGGGAGGCTGGCGGCGGGG + Intergenic
1188535345 X:31190610-31190632 GGAGGGGGAGGGCGGGGAGGGGG + Intronic
1190220343 X:48508895-48508917 GGGGGGCGGGGACGGGGACGCGG - Intergenic
1190388839 X:49911783-49911805 GGAGGTTGAGGCCGGCAAGGTGG + Intergenic
1192432827 X:71124299-71124321 GGAGAGGGAGGCCGGGGACCAGG - Exonic
1195210844 X:102651556-102651578 GGAGGGGGAGGCCGATGACCTGG + Exonic
1195216993 X:102712513-102712535 GGAGGGGGAGGCCGACGACCTGG + Exonic
1195221134 X:102746135-102746157 GGAGGGGGAGGTCGACGACCTGG + Exonic
1195269456 X:103215545-103215567 GGGGGGCGAGGGTGGCGAGGAGG + Intronic
1198100436 X:133417349-133417371 GGAGGGCGGGGGCGGCGGGGGGG - Intergenic
1198388305 X:136148234-136148256 GGATGGCGGGGGTGGCGACGAGG + Intronic
1198767213 X:140091760-140091782 GGAGGGCGAGGCCGAGGTCGCGG + Intergenic
1200003466 X:153073419-153073441 GGAGAGCGTGGCCGGCGCCCTGG + Exonic
1200004257 X:153076590-153076612 GGAGAGCGTGGCCGGCGCCCTGG - Intergenic
1200093874 X:153648226-153648248 GGAGGCCGAGGCCGAGGCCGAGG + Exonic
1200103209 X:153698628-153698650 GGAGGGCCAGGCCGGAGATGTGG - Intergenic
1200146340 X:153928179-153928201 GGAGGGCGCCGCGGGCGCCGTGG + Intronic
1202372084 Y:24205509-24205531 GCAGGGCGAGGGCGGAGAGGAGG - Intergenic
1202498701 Y:25464607-25464629 GCAGGGCGAGGGCGGAGAGGAGG + Intergenic