ID: 971279940

View in Genome Browser
Species Human (GRCh38)
Location 4:25234409-25234431
Sequence CTGAAACCGCGGGGCGGCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971279940_971279956 20 Left 971279940 4:25234409-25234431 CCGGAGCCGCCCCGCGGTTTCAG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 971279956 4:25234452-25234474 ACTCCCCGCGCCCCTCCGGGCGG 0: 1
1: 0
2: 1
3: 16
4: 125
971279940_971279952 16 Left 971279940 4:25234409-25234431 CCGGAGCCGCCCCGCGGTTTCAG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 971279952 4:25234448-25234470 CCCCACTCCCCGCGCCCCTCCGG 0: 1
1: 0
2: 4
3: 58
4: 472
971279940_971279954 17 Left 971279940 4:25234409-25234431 CCGGAGCCGCCCCGCGGTTTCAG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 971279954 4:25234449-25234471 CCCACTCCCCGCGCCCCTCCGGG 0: 1
1: 0
2: 13
3: 78
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971279940 Original CRISPR CTGAAACCGCGGGGCGGCTC CGG (reversed) Exonic
915911590 1:159918841-159918863 CACCAACCGCGGGGCGTCTCAGG - Exonic
924172423 1:241356697-241356719 CTGAAACTGCTGCCCGGCTCCGG - Intronic
1069837328 10:71317767-71317789 CTGAAACCCAGGGTCGGCTTAGG - Intergenic
1074503478 10:114045482-114045504 CTGCAACGGCGGGGCGGCGGCGG + Exonic
1075693642 10:124418428-124418450 CCGGAACCCCGGGGCGCCTCGGG + Intronic
1085568195 11:77534824-77534846 CTTAAACCCCGGGGAGGCTGAGG + Intronic
1106246564 13:27954622-27954644 CTGGGAGCGCGGGGAGGCTCTGG + Intergenic
1113643596 13:111976254-111976276 CTGAAGCCGCGGGGCCGGCCCGG - Intergenic
1113822574 13:113225554-113225576 CTGACACCACTGGGCAGCTCAGG - Intronic
1116222870 14:42111395-42111417 CAGAAACAGCGGGGCAGCTCAGG + Intergenic
1130283750 15:82539231-82539253 GTGAAACTGCGGGGCGGGGCGGG - Intronic
1136996862 16:35196457-35196479 CTGAAGCCGCGCGGAGGCCCAGG + Intergenic
1141509028 16:84500750-84500772 CTGAAACAGAGGGGCTGCACCGG + Intronic
1149461480 17:56833483-56833505 CGGAAACCGCGGCCGGGCTCGGG + Intronic
1151802464 17:76386035-76386057 CTGAACCCGCGCGGCGGCAAGGG + Exonic
1151979828 17:77502243-77502265 CTGAAACAGCGGGGCGGAAGGGG - Intergenic
1152546918 17:81004623-81004645 CTTCAACCGCGGGGCCGCTGCGG - Intronic
1152586398 17:81191369-81191391 CTGGCCCCGCGGGCCGGCTCCGG - Intronic
1157919008 18:51697007-51697029 CTGAAACCCAGGAGGGGCTCAGG + Intergenic
933168497 2:79099218-79099240 CTGAAACCCAGGAGGGGCTCAGG - Intergenic
933893103 2:86789187-86789209 CTGTACCTGCGGGGCAGCTCGGG + Intronic
936763104 2:115810079-115810101 CTGAACCCGGGAGGCGGATCTGG + Intronic
948876421 2:240832248-240832270 GTGGAACCGCGGGGCCGCGCGGG - Intergenic
1172841641 20:37905586-37905608 CTGAAACCCCCGTGTGGCTCTGG + Intronic
1175075676 20:56370660-56370682 CTGAAAACGGAGGGAGGCTCAGG + Intronic
1175916320 20:62427641-62427663 CAGAACCCGCCTGGCGGCTCAGG - Intergenic
1175922344 20:62456058-62456080 CGGCCTCCGCGGGGCGGCTCTGG + Intergenic
1181317900 22:21982730-21982752 CTGGATCCGCGGTGCGGCTGTGG - Exonic
950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG + Exonic
954131951 3:48565377-48565399 CTGAACCCGTGGGGCAGCTATGG - Intronic
965871874 3:173274790-173274812 CTGAAACCTGGGAGGGGCTCAGG + Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968552961 4:1233466-1233488 CTGGAGCGGCAGGGCGGCTCCGG - Intronic
968965240 4:3766211-3766233 CCGGGACCGCGGGGCCGCTCAGG + Intergenic
971279940 4:25234409-25234431 CTGAAACCGCGGGGCGGCTCCGG - Exonic
985515689 5:343660-343682 CTGACACCGAGGGGAGGCCCAGG + Intronic
986051498 5:4094461-4094483 CTGGAATCGAGGGGAGGCTCCGG + Intergenic
989586163 5:43075235-43075257 CCGAAACCGGGGAGGGGCTCTGG - Intronic
1001752759 5:174144224-174144246 ATGGAACCGCTGGGTGGCTCTGG + Intronic
1008429484 6:51398768-51398790 CTGAGACCCCGGGGCTACTCTGG + Intergenic
1018748248 6:166779576-166779598 CTGAGGCCCCGGAGCGGCTCCGG - Intronic
1056386191 9:86099282-86099304 CGCAAGCCGCGGGGAGGCTCCGG + Intronic
1057428982 9:94977319-94977341 CTGAAAGCCCAGGGCTGCTCCGG - Intronic
1057708060 9:97412105-97412127 CCCAAGCCGCGGGGCGGCTCCGG + Exonic
1058684357 9:107467108-107467130 CTGAAGCCAAGGGGCTGCTCTGG - Intergenic