ID: 971279992

View in Genome Browser
Species Human (GRCh38)
Location 4:25234577-25234599
Sequence GCCCGCGGTGCGGCTGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971279992_971279998 4 Left 971279992 4:25234577-25234599 CCAGCCGCAGCCGCACCGCGGGC 0: 1
1: 0
2: 2
3: 29
4: 341
Right 971279998 4:25234604-25234626 AGCTTGCTCGCTCTTTCTCCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
971279992_971279997 3 Left 971279992 4:25234577-25234599 CCAGCCGCAGCCGCACCGCGGGC 0: 1
1: 0
2: 2
3: 29
4: 341
Right 971279997 4:25234603-25234625 TAGCTTGCTCGCTCTTTCTCCGG 0: 1
1: 0
2: 0
3: 9
4: 115
971279992_971280001 28 Left 971279992 4:25234577-25234599 CCAGCCGCAGCCGCACCGCGGGC 0: 1
1: 0
2: 2
3: 29
4: 341
Right 971280001 4:25234628-25234650 GCTCCCTCTCCTAAGGCCAGTGG 0: 1
1: 0
2: 3
3: 17
4: 189
971279992_971279999 21 Left 971279992 4:25234577-25234599 CCAGCCGCAGCCGCACCGCGGGC 0: 1
1: 0
2: 2
3: 29
4: 341
Right 971279999 4:25234621-25234643 TCCGGGAGCTCCCTCTCCTAAGG 0: 1
1: 0
2: 1
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971279992 Original CRISPR GCCCGCGGTGCGGCTGCGGC TGG (reversed) Intronic
900382316 1:2391161-2391183 GCTGGCTGTGAGGCTGCGGCCGG + Intronic
900970966 1:5992256-5992278 GCCTCCGGCGCGGCCGCGGCGGG - Exonic
901312035 1:8276733-8276755 GCCGGTGGTGTGGCTGCAGCCGG - Intergenic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903750177 1:25616686-25616708 GGCTGCGGCGCGGCGGCGGCGGG + Intergenic
903750211 1:25616798-25616820 GCCCGAGCGGCGGCGGCGGCGGG + Intergenic
903813057 1:26045621-26045643 GCCCGCGGGGGGCCTGGGGCCGG - Intronic
904045163 1:27604225-27604247 GCGCGCGGAGCGGCCGGGGCGGG - Intronic
904470249 1:30731646-30731668 GCCCGCTGTGGGGCTGGGTCAGG - Intergenic
905308405 1:37034129-37034151 GCCCGGGGCGCGGCCGTGGCGGG + Intronic
905990674 1:42334924-42334946 CCCCGCAACGCGGCTGCGGCTGG + Exonic
906076911 1:43058630-43058652 GGCCGCGCTGGGGCTGGGGCTGG + Intergenic
907486459 1:54781407-54781429 CCCCGCGGCGCGCCTGCGCCAGG - Exonic
910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG + Intronic
911025662 1:93433827-93433849 GCCCCCTGTGAGGCTGTGGCTGG + Intergenic
911052365 1:93681686-93681708 GCCCGCGCCGCGGCTGCTCCCGG + Intronic
911664764 1:100539773-100539795 GCCCGCGCTGCACCCGCGGCGGG + Exonic
912568863 1:110607398-110607420 TGGCGCGGTGCGGCTGCGGGCGG - Exonic
912993501 1:114511151-114511173 GCTCTTGCTGCGGCTGCGGCTGG - Exonic
921472674 1:215567569-215567591 GCCAGCGGGGCGGCGGCGGCCGG - Exonic
922809202 1:228406592-228406614 GTCCGCGGGGCGGCGGCGGGCGG + Exonic
922832254 1:228609819-228609841 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922832814 1:228612060-228612082 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922833375 1:228614301-228614323 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922833935 1:228616542-228616564 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922834492 1:228618783-228618805 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922835046 1:228620998-228621020 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922835603 1:228623218-228623240 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922836161 1:228625460-228625482 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922836719 1:228627699-228627721 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922837278 1:228629941-228629963 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922837839 1:228632182-228632204 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922838397 1:228634422-228634444 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922838955 1:228636647-228636669 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922839515 1:228638888-228638910 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922840076 1:228641119-228641141 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922840636 1:228643360-228643382 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922841199 1:228645591-228645613 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
923372716 1:233328598-233328620 GGCAGAGGTGCGGCTGCTGCAGG - Exonic
924436740 1:244049069-244049091 GCCAGCTGTGCGGCCCCGGCCGG + Intronic
924853896 1:247857261-247857283 GCCCGGGGAGCGGCTGCGCGAGG + Exonic
1062767023 10:73928-73950 GCCCGCGCTGCGAGTGCAGCGGG - Intergenic
1064582711 10:16810459-16810481 GCCCGGGGGGCGGCTGCTGGGGG - Intronic
1064622507 10:17229644-17229666 GCCCGGGGTGCGGCTCCTGCAGG + Exonic
1066011121 10:31194103-31194125 CCCAGCGGTGAGGCTGAGGCAGG + Intergenic
1066464217 10:35639480-35639502 GGCCGGGGGGCGGCGGCGGCGGG - Exonic
1067084220 10:43229621-43229643 GCCCCAGGTAGGGCTGCGGCGGG - Exonic
1069761799 10:70816228-70816250 GGCGGCGGGGCGGCTGCGGCCGG + Intronic
1071966588 10:90858087-90858109 GGACGCGGCGCGGCTGCCGCAGG - Intergenic
1072915483 10:99535283-99535305 CCACGCGGCGCGGCGGCGGCGGG - Exonic
1074377386 10:112951300-112951322 GCCCGGGGGGCGGCTCCGGGCGG - Intronic
1074618309 10:115092943-115092965 GCGCGGGGTGCGGGTGGGGCCGG + Intergenic
1074618388 10:115093173-115093195 CCCGGCGCTGCCGCTGCGGCCGG + Intergenic
1075438282 10:122461026-122461048 GACCGCGGGGCCTCTGCGGCCGG - Intergenic
1076035550 10:127196277-127196299 GCGCGCGGGGAGGCAGCGGCTGG + Intronic
1076815277 10:132911492-132911514 ACCCGCGGTGGGGCGGGGGCAGG - Intronic
1076858425 10:133128470-133128492 GCCCGAGGAGCAGCGGCGGCTGG + Exonic
1076947918 10:133664760-133664782 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076948908 10:133668070-133668092 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
1076949892 10:133671369-133671391 GTCCGTGGTGGGGCTGGGGCCGG + Intronic
1076950876 10:133674668-133674690 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076951866 10:133677978-133678000 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076952855 10:133681288-133681310 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076953839 10:133684587-133684609 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076954823 10:133740939-133740961 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076955812 10:133744249-133744271 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076956802 10:133747559-133747581 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076957789 10:133750868-133750890 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076958774 10:133754167-133754189 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076959763 10:133757477-133757499 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076960747 10:133760776-133760798 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1077143771 11:1035958-1035980 GCCTGCCCTGCGGCTGCTGCAGG - Intronic
1077197183 11:1287526-1287548 TGCGGCGGTGAGGCTGCGGCGGG - Intronic
1077251743 11:1563789-1563811 GCCAGCAGTGGGGCTGGGGCTGG - Intronic
1078091676 11:8268200-8268222 GCCCGGGCTTCGGCGGCGGCGGG - Intronic
1079122589 11:17696141-17696163 GCGCGGGGTGCGGCTGCGGGCGG + Intergenic
1081492583 11:43579621-43579643 CCCCGCGCCGCGGCGGCGGCGGG + Intronic
1081528686 11:43943563-43943585 GCCCGCGCTGAGTCGGCGGCGGG + Intronic
1083272973 11:61581248-61581270 GCCCTCGGGGCGGCTTCGGGCGG - Intergenic
1083849007 11:65354698-65354720 GGCCGGGGCGGGGCTGCGGCGGG + Intergenic
1084155412 11:67310333-67310355 GCCAGAGGTGAGGCTGGGGCTGG + Exonic
1084175673 11:67421045-67421067 GGCCGCGCCGCGGCTGGGGCCGG + Exonic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084399584 11:68935955-68935977 GCCTGGGGTGTGGCTGCAGCTGG - Intronic
1084525819 11:69697431-69697453 GCCTGCCGTGCAGCTGGGGCTGG + Intergenic
1084787051 11:71448521-71448543 GCCCGCCATTCGGCAGCGGCCGG + Intronic
1084889763 11:72230904-72230926 GCCCGGGCTGGGGCTGGGGCGGG + Intronic
1084898979 11:72295534-72295556 GCACGCGCTGCAGCTGAGGCAGG - Exonic
1088893459 11:114061235-114061257 GCCCGCGATCCGGCTGGCGCTGG - Intronic
1089262415 11:117232180-117232202 GCCCGGGGTCCGGCTCCCGCGGG + Exonic
1090333456 11:125948051-125948073 GCCCGCGGACCAGCTGCAGCTGG - Intergenic
1090662215 11:128890663-128890685 CCCCGGCGTGCGGCGGCGGCTGG - Intergenic
1090832237 11:130427836-130427858 GCAGGCGGTGCGGCTGAGCCAGG + Exonic
1091218717 11:133918602-133918624 GCCCGCGGTGGGGCTGCGGGTGG + Intronic
1091770538 12:3148495-3148517 GCCAGCGGTGGGGCTGTGGCTGG + Intronic
1092173932 12:6390334-6390356 GCCCACGGTGAGCCTGGGGCAGG + Exonic
1094470278 12:30796235-30796257 GGCCGCGGGGCGGCGGGGGCGGG - Intergenic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1096134590 12:49188800-49188822 ACCCGCACTGCGGCGGCGGCGGG + Intronic
1097267761 12:57755626-57755648 GCCGGGGAGGCGGCTGCGGCTGG + Exonic
1098320650 12:69239937-69239959 GGCCGCTGTGCAGCTGCCGCCGG + Intronic
1098550378 12:71755151-71755173 GGCGGCGGGGCGGCGGCGGCGGG + Exonic
1102492734 12:113298667-113298689 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
1103377725 12:120469673-120469695 GCCCGCGGGGACGCTGCGGGGGG - Exonic
1103509861 12:121467010-121467032 GCCGGCGGGGCGGCCGGGGCCGG - Intronic
1103509892 12:121467128-121467150 GCCCGGGGTGGGGCTGAGGGAGG - Intronic
1103595453 12:122022280-122022302 GCCCGCGGCGGGGCTGGGCCGGG - Intronic
1103764724 12:123271864-123271886 GCCGGCGGGGCGGCCGGGGCCGG + Exonic
1103915961 12:124375889-124375911 GCCTGCAGTGCCGCTGGGGCTGG + Intronic
1105048651 12:133028247-133028269 GCTCTCTGTGAGGCTGCGGCTGG - Intergenic
1105413742 13:20192538-20192560 GCCCGGGGTGCGAGTGGGGCCGG - Intronic
1108500507 13:51065957-51065979 GCCCCAGGAGCAGCTGCGGCAGG - Intergenic
1111474435 13:88726199-88726221 GCCCTCTGTGAGGCTGTGGCTGG - Intergenic
1114554783 14:23555793-23555815 GCCTGCGTTGGGGGTGCGGCGGG + Intronic
1116018182 14:39431787-39431809 GCCCGCGGAGCAGCCTCGGCTGG - Exonic
1116152046 14:41154196-41154218 TCCCGCGGTAGGGCTGCGGGTGG + Intergenic
1117875929 14:60249723-60249745 GCCTGCGCGGCGGCGGCGGCGGG + Intronic
1118905252 14:70018873-70018895 GCCAGCTGTGCGGGTGCGGCTGG - Intronic
1118925697 14:70188499-70188521 GCCCCGGACGCGGCTGCGGCCGG - Exonic
1120730139 14:87992794-87992816 GCCCGCTGCGGGGCTGGGGCGGG - Intronic
1202849780 14_GL000225v1_random:9304-9326 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1202853731 14_GL000225v1_random:37279-37301 GTCCGTGGTGGGGTTGCGGCCGG + Intergenic
1202854838 14_GL000225v1_random:43721-43743 GCCTGTGGTGGGGCTGCGGCCGG + Intergenic
1202859423 14_GL000225v1_random:72288-72310 GTCCGTGGTGCGGCTGGGGCCGG - Intergenic
1202922065 14_KI270723v1_random:35587-35609 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1202922865 14_KI270724v1_random:2026-2048 GTCCGTGGTGGGGCTGGGGCCGG - Intergenic
1124121694 15:26893884-26893906 GCGCGCGGGGCGGCGGCAGCCGG + Intronic
1125241666 15:37583018-37583040 GCCCCCTGTGAGGCTGCCGCTGG - Intergenic
1127995586 15:64151746-64151768 GCGCGCGGAGCAGCTGGGGCCGG + Exonic
1129409246 15:75339775-75339797 GCCCATGGTGCACCTGCGGCTGG + Exonic
1130302739 15:82692389-82692411 GCCCGCGGGGACGCTGCGGGGGG - Intronic
1130312277 15:82765982-82766004 GTCCGTGGTGCAGCTGCAGCCGG - Exonic
1132462399 16:61979-62001 GCCCAAGGTGCGGCTCCGACAGG - Exonic
1132722828 16:1325418-1325440 GCCCGCGGTGGGGCTGCAGGTGG - Exonic
1132793353 16:1706110-1706132 CCTGGCGGCGCGGCTGCGGCGGG + Intergenic
1132841224 16:1979303-1979325 CCCCGCGGTGCTGCTGCGGCCGG - Exonic
1132877942 16:2148602-2148624 GCCCGTGGAGCGGCGGGGGCGGG + Exonic
1132898069 16:2238247-2238269 GCCTGCGGTGGGGCAGGGGCAGG - Intronic
1133279505 16:4657207-4657229 GCAAGCAGTGAGGCTGCGGCAGG - Intronic
1133784300 16:8963179-8963201 GCCCGAGGGCCGGCCGCGGCGGG - Intronic
1134522914 16:14926738-14926760 GCTCCCGGGGCTGCTGCGGCAGG + Intronic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1134549713 16:15133320-15133342 GCTCCCGGGGCTGCTGCGGCAGG - Intronic
1134710582 16:16325389-16325411 GCTCCCGGGGCTGCTGCGGCAGG + Intergenic
1134718752 16:16369677-16369699 GCTCCCGGGGCTGCTGCGGCAGG + Intergenic
1134949020 16:18343256-18343278 GCTCCCGGGGCTGCTGCGGCAGG - Intergenic
1134956004 16:18382482-18382504 GCTCCCGGGGCTGCTGCGGCAGG - Intergenic
1135491713 16:22915153-22915175 GCCCAGGGTGCGGTTGCGGAAGG - Exonic
1138513986 16:57525935-57525957 GACCGCCCTGCGGCTACGGCTGG - Exonic
1138591178 16:58000521-58000543 CCTCGCGTAGCGGCTGCGGCCGG + Intronic
1139546741 16:67653200-67653222 GCTGGCGGCGCGGCCGCGGCCGG - Exonic
1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG + Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141280703 16:82627739-82627761 GACCCCGATGCGGGTGCGGCCGG - Intronic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142142373 16:88478359-88478381 GCCAGGGGTGGGGCTGCTGCAGG + Intronic
1142319227 16:89370371-89370393 GCCCAGGGTGTGGCTGGGGCAGG - Intronic
1142408950 16:89906556-89906578 GCGCGTGGTGCGGCTGCTGGGGG + Intronic
1143411862 17:6713876-6713898 GCCCGCGGTGCGGAGGGCGCGGG - Intergenic
1143747274 17:9003595-9003617 GCCCGGGGCGCGGGCGCGGCAGG - Intergenic
1145305747 17:21674251-21674273 GACCGCGGAGCGGCGGCTGCGGG + Intergenic
1145306603 17:21678948-21678970 GCCCCCGCCGCGGCTGCAGCAGG - Intergenic
1145327704 17:21844354-21844376 GCCCTCAGAGCGGCGGCGGCGGG - Intergenic
1145694523 17:26775729-26775751 GCCCTCAGTGCCGCGGCGGCGGG - Intergenic
1145903922 17:28506165-28506187 GGCCAGGGTGCGGCTGGGGCGGG + Intronic
1146034035 17:29390644-29390666 GCCCGCCGAGGGGCCGCGGCGGG + Exonic
1147264276 17:39225537-39225559 GCCCGCGGTGGGCCTGCCGTCGG - Exonic
1147672414 17:42184271-42184293 GCCCGCGGCGTGGTTGCCGCTGG + Exonic
1149996693 17:61409567-61409589 CCCCGGGGTGCAGCTGCCGCCGG - Intergenic
1151670335 17:75568712-75568734 GCTTGCGGTGGGGCTGGGGCTGG - Intronic
1151670750 17:75570504-75570526 GCCTGAGGTGAGGCTGCGGCCGG + Intronic
1151797111 17:76353710-76353732 GCCCGCGGCGCGGTTACGACCGG + Exonic
1152581151 17:81166125-81166147 GCGGGCTCTGCGGCTGCGGCGGG - Intergenic
1152610540 17:81313136-81313158 GGCCCCGGTGGGGCTGGGGCTGG + Exonic
1152697494 17:81804309-81804331 GACCGCGGGGCGGGCGCGGCGGG + Intronic
1152714060 17:81889902-81889924 TCCCGCTGTGTGCCTGCGGCCGG - Intronic
1153288771 18:3480302-3480324 TCCAGCGGTGCTGCTGCTGCTGG + Intergenic
1154231083 18:12557093-12557115 TCCCGCGTTGGGGCTGCGGGTGG + Intronic
1155152777 18:23135797-23135819 GCCGGCGCTGCCGCTGCTGCAGG - Exonic
1157279076 18:46334122-46334144 GGCGGCGGTGGGGCGGCGGCTGG - Intronic
1157492957 18:48136821-48136843 GGCCGCGGGGCGGCTCTGGCTGG - Intronic
1157713202 18:49864104-49864126 GCCCGCGGTGGGGCTGCCGAGGG - Intronic
1158643392 18:59221284-59221306 GGCCGCGCTGCGGGTGCGGAGGG + Intronic
1159322211 18:66866784-66866806 GCACTCGGAGCGGCGGCGGCGGG + Intergenic
1159904656 18:74078448-74078470 ACCCACTGTGCCGCTGCGGCTGG - Intronic
1160453383 18:78979904-78979926 GCCCCGGGTGCGGCTGTGGCGGG - Intergenic
1160702230 19:513165-513187 GGCCCCGGTGCGGCTCCTGCTGG + Intronic
1160747812 19:720074-720096 CCCCGCGCTGCGGCTGGGGGAGG - Intronic
1161086296 19:2337121-2337143 GGCCGTGGTGGGGCTGCGGTGGG + Intronic
1161233253 19:3186108-3186130 GCCCGCTGTGCTGCTGCTGGTGG + Exonic
1161473474 19:4472658-4472680 CCCCGGGGCGCGGCTCCGGCAGG - Intronic
1161620110 19:5293188-5293210 ACGCGGGGAGCGGCTGCGGCGGG - Intronic
1162019859 19:7863417-7863439 GCCCCAGGTGCGGCTGCTGAAGG + Exonic
1162135810 19:8554638-8554660 GGGCGCGGTGAGGCTGGGGCTGG - Exonic
1163123496 19:15232041-15232063 GGCCCCGGCGCGGCTGCTGCGGG - Exonic
1163358366 19:16829619-16829641 GGCCGAGGTGGGGCTGGGGCCGG - Intronic
1163432032 19:17274018-17274040 GGCCTGGGTGAGGCTGCGGCAGG + Exonic
1164639307 19:29812499-29812521 GCGCGGGGTGAGGCGGCGGCGGG - Intronic
1165129437 19:33622627-33622649 GCCCGCGGGGAGGCGGCGTCGGG + Intronic
1166428152 19:42698039-42698061 CACCGCGGTGCGGATGCTGCTGG - Intronic
1166883073 19:45940605-45940627 GCCGACGCTGCGGCCGCGGCTGG + Exonic
1167513390 19:49908941-49908963 GCCGGTGGTGCTGCTGCTGCTGG + Exonic
1167643660 19:50694961-50694983 GCGCGGGGGGCGGCTGCGGCAGG + Intronic
1167738686 19:51311715-51311737 GCCCGGGGGGCGGCGGGGGCGGG - Intergenic
927606569 2:24491510-24491532 GCCCGAGGAGCGGCGGAGGCCGG + Intergenic
927667588 2:25042839-25042861 TCCCGCGGGGCGGCAGGGGCAGG - Intronic
927943319 2:27119069-27119091 GCCCCCGCTGCGCCCGCGGCCGG + Exonic
928964826 2:36966342-36966364 GGCGACGGGGCGGCTGCGGCGGG - Exonic
929492568 2:42408986-42409008 GCTCTCTGTGAGGCTGCGGCCGG - Intronic
929604692 2:43226638-43226660 CCCGGGAGTGCGGCTGCGGCGGG + Intergenic
930048219 2:47192624-47192646 GCCCACCGTGGAGCTGCGGCTGG - Intergenic
932568503 2:72924388-72924410 GCCCTCGCAGCTGCTGCGGCTGG + Exonic
932798131 2:74715517-74715539 GCCGGCAGTACGGCTGCGGAGGG - Intergenic
935592764 2:104856353-104856375 GCGCGTGGTGCGGGTGCGGCGGG - Exonic
936396950 2:112138525-112138547 GGCCGGGGGGCGGCTGGGGCAGG - Exonic
938397856 2:130963973-130963995 GGCGGCGGTGCGGCGGCCGCGGG - Intronic
939034564 2:137115263-137115285 GCCCTCAGTGCGGCAGCTGCTGG - Exonic
941951495 2:171160834-171160856 GCCCGGGAGGCGGCGGCGGCGGG + Intronic
942151066 2:173076161-173076183 GCCCGCCCGGCGGCGGCGGCCGG + Intronic
946354876 2:219178327-219178349 GCTCGGGCGGCGGCTGCGGCGGG + Exonic
947632308 2:231662151-231662173 GCCCGCGAGGCGGCCACGGCCGG + Intergenic
947736072 2:232456208-232456230 GCCCTGGGTGCTGCTGCTGCTGG + Exonic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948940366 2:241192401-241192423 GCCCGAGGTGAGGGTGAGGCAGG + Intronic
948991902 2:241559681-241559703 GTGCGCGGTGCTGCTGCGCCTGG + Exonic
1171531002 20:25853718-25853740 GACCGCGGAGCGGCGGCTGCGGG + Intronic
1172618678 20:36306333-36306355 GCCCCAGATGCGGCTGCGGGAGG - Exonic
1175429526 20:58891679-58891701 GGCCGGGCTGCGGCGGCGGCGGG - Intronic
1176056239 20:63150705-63150727 GCCTGAGGTGGGGCTGCGTCTGG + Intergenic
1176069025 20:63216424-63216446 GTCGGGGGTGCGGCTGTGGCCGG - Intergenic
1176171094 20:63696665-63696687 GCCCCCGGTCCGCCTGCGGAGGG - Exonic
1176308184 21:5135328-5135350 TCCCTCGCTGCAGCTGCGGCAGG + Intronic
1179848876 21:44126704-44126726 TCCCTCGCTGCAGCTGCGGCAGG - Intronic
1180156387 21:45979418-45979440 GTCCGCGGGGTGGGTGCGGCGGG - Intergenic
1180414210 22:12693754-12693776 GTCCGTGGTGGGGCTGGGGCCGG - Intergenic
1181283400 22:21735754-21735776 GCCCGCGGGGCGGCGGCGGGAGG - Exonic
1183742650 22:39677440-39677462 GCCCGTGGTGGGGGTGCAGCAGG + Intronic
1183744691 22:39685789-39685811 GCCCGCGGAGCTGCTGGGGCTGG - Exonic
1183788406 22:40045198-40045220 GCGCGCGGGGCTGGTGCGGCCGG + Intronic
1184004753 22:41699866-41699888 GCCCGAGAGGCCGCTGCGGCCGG - Intronic
1184617053 22:45645501-45645523 GCTTGCGGTGGGGCTGGGGCCGG + Intergenic
1185278622 22:49960654-49960676 GCCCGCGAGGCGGCGGCGGCCGG - Exonic
1185296683 22:50058242-50058264 ACCCCCGGTGCGGCGGCTGCTGG + Intergenic
949918796 3:8985594-8985616 GCCCGAGCTGCTGCTGCTGCTGG + Exonic
950679364 3:14574390-14574412 GCCCAAGGTGCGGCTCCGACAGG - Intergenic
950710628 3:14810753-14810775 CCCCGCGGGGCGGCCGCGGAGGG + Intergenic
953761168 3:45688511-45688533 ACCTGCGGTGCGGCTGCGCTCGG - Intergenic
954085536 3:48241255-48241277 GCCTGCGCGGCGCCTGCGGCTGG - Intronic
954156152 3:48685935-48685957 GCCCGGGGCGGGGCTTCGGCGGG - Intronic
954339370 3:49940489-49940511 GCCAGCTGTGAGGCTGGGGCCGG + Intronic
961067018 3:123884259-123884281 CCGCGCTGTGCGCCTGCGGCCGG - Intronic
961824919 3:129594054-129594076 ACCTGCGGTGGGTCTGCGGCAGG - Intronic
961827800 3:129607700-129607722 GCCAGGGGTGGGGGTGCGGCTGG - Intergenic
962129747 3:132660235-132660257 CACCCCGGTGCTGCTGCGGCCGG + Exonic
963160787 3:142149270-142149292 GCCCGCGCTTAGGCGGCGGCCGG + Exonic
963733209 3:148991937-148991959 GCGGGCGGAGCAGCTGCGGCGGG + Intronic
965757571 3:172040725-172040747 GCCCGCGGCTGGGCTGGGGCCGG + Intronic
966863113 3:184241602-184241624 GGCCGAGGTGGGGCTGAGGCTGG - Exonic
966945364 3:184773820-184773842 GCCAGAGGTGCGGCTCCGACAGG + Intergenic
968477372 4:818343-818365 GCCCGTGGCGGGGCTGGGGCTGG - Intronic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
971327429 4:25655736-25655758 GCCCCGGCGGCGGCTGCGGCAGG + Intronic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
977536568 4:98261391-98261413 GCAGGCGGCGCGGCCGCGGCGGG - Intronic
982583180 4:157204801-157204823 GCCAGAGGAGCGGCTGCTGCCGG + Intronic
984578200 4:181475966-181475988 GCAGGCGGTGCGGCTCCAGCGGG + Intergenic
985068491 4:186145180-186145202 GCCCGCGGGCCGGCTGCGTCTGG + Intronic
985446012 4:190021724-190021746 GTCCGTGGTGGGGCTGGGGCCGG - Intergenic
985451372 4:190065561-190065583 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
985452362 4:190068854-190068876 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
985453347 4:190072151-190072173 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985454337 4:190075444-190075466 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985455325 4:190078737-190078759 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985456313 4:190082037-190082059 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985457297 4:190085331-190085353 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
985458284 4:190088624-190088646 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985459273 4:190091924-190091946 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985463525 4:190174693-190174715 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985625138 5:981898-981920 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985625161 5:981972-981994 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985625180 5:982046-982068 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985625203 5:982120-982142 GCTCGAGGTGGGGCTGAGGCAGG - Intergenic
985625220 5:982194-982216 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985749772 5:1667450-1667472 GCCCGCGGTCCTGCAGGGGCCGG - Intergenic
990456583 5:55994876-55994898 GCCCCCGGTTCAGCTGCGCCGGG + Exonic
992671861 5:79069525-79069547 GCCCGCGCTCTGTCTGCGGCCGG - Exonic
994072731 5:95620469-95620491 GCCGCCTGTGCGGCGGCGGCGGG + Exonic
997697692 5:135874389-135874411 ACCAGCTGTGTGGCTGCGGCAGG - Intronic
998406882 5:141878930-141878952 GACCGCTCTGCGGCTTCGGCCGG - Intronic
999386557 5:151157766-151157788 CCCCGCGCTGCGGTTGCTGCTGG - Exonic
1000347957 5:160330439-160330461 GCCCATGGTGCGGAGGCGGCAGG - Intronic
1002284170 5:178151296-178151318 GCCCACGGAGGGGCTGGGGCGGG + Intronic
1002522995 5:179801566-179801588 GCCCGCGGTGCGCGTGGGCCAGG - Exonic
1002986337 6:2192653-2192675 GCTCTCTGTGAGGCTGCGGCTGG - Intronic
1004561989 6:16760629-16760651 GCCGGGTGTGCGGCTGCGGGCGG - Intronic
1006396157 6:33788863-33788885 GCCCGCGGAGAGGCCGCGGCGGG + Exonic
1007387224 6:41528150-41528172 GCCACCGCTGCCGCTGCGGCTGG - Intergenic
1012345447 6:98179804-98179826 GGCCACGGTGCGGCTGGGGATGG + Intergenic
1012696377 6:102390229-102390251 GCTCCCTGTGAGGCTGCGGCTGG + Intergenic
1013230517 6:108157795-108157817 GCCGCTGGTGCGGCTGCGGCGGG - Intronic
1014035590 6:116764693-116764715 GCTTGCGGGGCGGCTGTGGCGGG - Intronic
1017164125 6:151391422-151391444 GTCGCCGGTGCTGCTGCGGCGGG + Exonic
1018091244 6:160348275-160348297 GCAGGAGGAGCGGCTGCGGCCGG + Exonic
1018876694 6:167827375-167827397 GCCCGCGGTGGGCCTGGGGGAGG - Intronic
1019521882 7:1464405-1464427 GCCGGTGCTGCGGCTGGGGCTGG + Intergenic
1019562565 7:1665874-1665896 GAGCGCGGGGCGGCGGCGGCGGG - Intergenic
1020085658 7:5308911-5308933 GGCCGCCGGGAGGCTGCGGCTGG + Exonic
1020281531 7:6652593-6652615 GCCGGCGGGGCCACTGCGGCGGG - Exonic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1023881837 7:44325262-44325284 GCCCGCAGTGCGCCTGGAGCCGG + Intronic
1024074290 7:45810828-45810850 GTCCGCTGTGAGGCTGAGGCTGG - Intergenic
1024075330 7:45814982-45815004 GTCCGCTGTGAGGCTGAGGCTGG - Intergenic
1025053123 7:55744700-55744722 GTCCGCTGTGAGGCTGAGGCTGG + Intergenic
1025078720 7:55964631-55964653 GCCCGCGGAGCGGCCTGGGCCGG + Exonic
1025208652 7:57008253-57008275 GGCCGCCGGGAGGCTGCGGCTGG - Intergenic
1025663295 7:63568625-63568647 GGCCGCCGGGAGGCTGCGGCTGG + Intergenic
1026482554 7:70790800-70790822 GCCCGCGGTGGGGCTGATGCGGG - Exonic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1028987325 7:97018531-97018553 GCCCGCGGTGTGCCAGCGCCTGG - Intergenic
1029123118 7:98281518-98281540 GCCGGCGGGGCGGCTTCGGGAGG + Intronic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029413653 7:100430258-100430280 CCCCTCGGTGCTGCTGCGCCTGG - Exonic
1032525463 7:132576202-132576224 GCCCGCGGAGGTGCAGCGGCCGG - Intronic
1033159119 7:138981327-138981349 GCGGCCGCTGCGGCTGCGGCTGG + Intergenic
1034349163 7:150405332-150405354 GGCCGCGCTGGGGCCGCGGCGGG + Intronic
1034415781 7:150963610-150963632 GCCAGCGCTGGGGCTGAGGCTGG - Intronic
1034446220 7:151115507-151115529 GGCGGCGGTGCGGGGGCGGCCGG - Intronic
1035567384 8:650514-650536 GCCACCGGGGCGGCTGCTGCTGG - Intronic
1038176373 8:25184830-25184852 GAGCGCGGGGCGGCGGCGGCCGG + Intronic
1039434361 8:37549428-37549450 GCCCGCGTCACTGCTGCGGCAGG + Intergenic
1039864592 8:41490313-41490335 GCGAGCTGTGGGGCTGCGGCCGG - Intergenic
1039864600 8:41490337-41490359 GCGAGCTGTGGGGCTGCGGCCGG - Intergenic
1040355885 8:46617709-46617731 GCTCGCGGGGCGGCTGGGGCGGG + Intergenic
1041502474 8:58553552-58553574 GCCCGGGCTGGGGCTGGGGCTGG + Intronic
1043854172 8:85245712-85245734 GACCGCGGGGCGCCGGCGGCAGG - Exonic
1044988587 8:97775922-97775944 GCCCGCCGCGCCGCTGCTGCCGG - Exonic
1045782746 8:105886785-105886807 GCTCCCTGTGAGGCTGCGGCTGG - Intergenic
1049109666 8:140635308-140635330 GCTCGAGGAGCGGCGGCGGCGGG - Intronic
1049288583 8:141789949-141789971 GCCAGCGGGGCGGCAGCGGCAGG - Intergenic
1049322320 8:142003089-142003111 GCCAGCGGGGCTGCTGTGGCTGG + Intergenic
1049365745 8:142236065-142236087 CCACGCGGTGAGGCTGTGGCTGG - Intronic
1049376780 8:142293120-142293142 GCCTGCGGTGCGGCTGCTCGAGG - Intronic
1049405437 8:142450077-142450099 GCCGGCGGGGCCGCTGCTGCTGG + Exonic
1049420522 8:142514373-142514395 GCCGGCTCTGCGGCTGCAGCAGG + Intronic
1049570619 8:143368813-143368835 GCCCGCGGCGCGGCTGGGCGGGG - Intergenic
1049758971 8:144323345-144323367 GCCTGAGGTGAGGCTGTGGCTGG - Intronic
1049791081 8:144473030-144473052 CACCGCGGTGCTGCTGCTGCAGG + Exonic
1052192701 9:25677787-25677809 GCTCGAGGTGCAGCTGCAGCAGG + Exonic
1053016454 9:34665064-34665086 AGCGGCGGTGGGGCTGCGGCGGG + Exonic
1057494959 9:95553501-95553523 GGCCGCGGCGGGGCGGCGGCTGG - Intergenic
1058077790 9:100668154-100668176 GCTCCCTGTGAGGCTGCGGCTGG - Intergenic
1058110678 9:101028564-101028586 CCCCGCGGAGCGACTGCCGCTGG + Intergenic
1060485777 9:124045442-124045464 GCAGGCGGTGCGGCTGGGGCTGG + Intergenic
1060811551 9:126613709-126613731 GCCCGCGGGGCGGCCGGGCCGGG + Intergenic
1060855862 9:126914839-126914861 GCCCGCGCTCCAGCTGCGCCTGG + Exonic
1060947579 9:127579229-127579251 GCCTGCGGTGAGGCTGCGCCCGG + Intergenic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1061006470 9:127930935-127930957 GACCTCGGTCCGGCTGGGGCGGG + Intergenic
1061265185 9:129500690-129500712 GCCTGGGGTGCGGCTGGGGAGGG - Intergenic
1062022274 9:134325344-134325366 GCTCGCGGTGGGGGTGCGGAGGG + Intronic
1062220210 9:135410997-135411019 GCCCGGGCTGCAGCTGCGGCAGG + Intergenic
1062503940 9:136863272-136863294 GGCCACGGTGAGGCTGCGCCGGG - Exonic
1189333118 X:40155023-40155045 GCCCGCAGTGCGCCCGGGGCTGG + Intronic
1190054324 X:47173136-47173158 GCACGCCGTGCGACTGCAGCTGG - Exonic
1190984416 X:55488509-55488531 GGCCGCGGTGCGGGTGGGGGCGG + Exonic
1191184345 X:57592965-57592987 GCCCCCTGGGTGGCTGCGGCTGG + Exonic
1191213049 X:57909494-57909516 GCCCCCTGGGTGGCTGCGGCTGG - Exonic
1196653537 X:118193496-118193518 GCGCGTGGTGAGGCTGAGGCAGG + Intergenic
1197782444 X:130171686-130171708 GGCCGAGGCGCGGCGGCGGCTGG + Exonic
1201178210 Y:11322477-11322499 GTCCGCGGTGGGGCTGGTGCCGG + Intergenic