ID: 971283226

View in Genome Browser
Species Human (GRCh38)
Location 4:25259858-25259880
Sequence TGTGGGTCCCTGGACTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971283218_971283226 -3 Left 971283218 4:25259838-25259860 CCAAAGCAGGGGCTCCCCATTGT 0: 1
1: 0
2: 4
3: 9
4: 129
Right 971283226 4:25259858-25259880 TGTGGGTCCCTGGACTGTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 172
971283214_971283226 28 Left 971283214 4:25259807-25259829 CCACGGGTTGGATAAGCTTGATG 0: 1
1: 4
2: 33
3: 209
4: 505
Right 971283226 4:25259858-25259880 TGTGGGTCCCTGGACTGTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971283226 Original CRISPR TGTGGGTCCCTGGACTGTCA GGG Intronic
901648574 1:10729454-10729476 CCTGGCTCCCTGGACTGTCCGGG - Intronic
903065350 1:20696546-20696568 GGCGGGTCCCTGGAGTGCCACGG - Intronic
903718099 1:25384334-25384356 CCTGGGTCCCTGCACTGTGATGG + Intronic
904121394 1:28200502-28200524 TGTGGGTCCCTTGTCTGGCTTGG - Exonic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
907401843 1:54229195-54229217 TTTTGGTCCCTGGCCTGACATGG - Intronic
910244624 1:85124997-85125019 TGTATGTCCCTGGACAGGCAAGG - Intronic
912455754 1:109795838-109795860 TTTGGGTCCCTGCACTCACAGGG + Intergenic
919797809 1:201331887-201331909 CCTGGATCCCTGGACTGTCCTGG + Exonic
920656485 1:207879378-207879400 TGGGGGACCCTGGAGTATCAAGG - Intergenic
921167438 1:212517114-212517136 TGTTCGTCTCTGTACTGTCATGG + Intergenic
921722103 1:218483962-218483984 TGTGGATTCCAGGCCTGTCACGG + Intergenic
924002888 1:239573421-239573443 CCTGGTTCCCTGGAATGTCATGG + Intronic
924822106 1:247503413-247503435 TTTGGGTCCCTCGAATGCCATGG - Intergenic
1067471479 10:46541446-46541468 TGTGTGTCCCCGGACTGGCGTGG - Intergenic
1068354163 10:55889601-55889623 TGTGTGTTCCTGTATTGTCATGG - Intergenic
1070081579 10:73193950-73193972 TGTGAGTCCCTGTACTGCCTTGG - Intronic
1072813888 10:98486028-98486050 TGTGGGTCTCTGGGCTGTACTGG - Intronic
1072971668 10:100022816-100022838 TGGGGGTCCCTGGCCAGGCACGG + Intergenic
1073511419 10:104045108-104045130 TGTGGGTCCCTGAACTTGCTCGG + Intronic
1076234020 10:128849939-128849961 TGTGGGACCCTGGGCTGGCCTGG + Intergenic
1076314118 10:129528707-129528729 TGTTGGGCCCTGATCTGTCAAGG + Intronic
1076332362 10:129679456-129679478 TGCGGGTCCCTGGAGTCACATGG - Intronic
1077094753 11:794565-794587 CCAGGGTCCCTGGACTGTCTAGG + Intronic
1077111524 11:864194-864216 TGTGGGGCCCTGGGCTGGCCTGG - Intronic
1081061193 11:38479872-38479894 TGTATGTCCCTGGAGTGGCAAGG + Intergenic
1084534280 11:69747518-69747540 GGTGGGTGCCTGGAATGCCAGGG - Intergenic
1084711581 11:70847130-70847152 TGTGGGTCGCAGCACAGTCAAGG - Intronic
1088289510 11:108221804-108221826 TGTGGGTCACTTGTCTGTCAGGG - Intronic
1088578515 11:111295927-111295949 TGTGGGTACCTGGGGTCTCAGGG + Intergenic
1088922620 11:114272170-114272192 TGTGGGTTCCTGAAGAGTCATGG - Intronic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1090802118 11:130179510-130179532 TGCTGGGCCCTGGACTGCCATGG + Intronic
1092731550 12:11539701-11539723 GGGAGGTCCCTGGGCTGTCACGG + Intergenic
1094812446 12:34151666-34151688 TTTGGGTCCCTGGAATGCTATGG + Intergenic
1095152708 12:38814104-38814126 TGTGGGTCTGCGGGCTGTCAGGG + Intronic
1095990118 12:48028707-48028729 TGTGGGTCCCTGCCCAGTGAAGG - Intergenic
1098172197 12:67758331-67758353 TGTGGTTCCCTGTTCTGTCTGGG + Intergenic
1098512940 12:71340523-71340545 TGTGGTTCCCAGGATTGTCCTGG + Intronic
1100814530 12:98373494-98373516 TTTGGGTCCCTGAACTGTTCTGG - Intergenic
1101670149 12:106863073-106863095 TGGAGGTCCCTTGACTGTAAAGG + Intronic
1103535721 12:121632791-121632813 TTTGGAGTCCTGGACTGTCATGG + Intronic
1104081532 12:125434437-125434459 TGTGTGTCCTTGGCCTGTCCGGG + Intronic
1104720633 12:131043371-131043393 TTTGGGCCCCTGGACTGACAGGG + Intronic
1105951633 13:25234515-25234537 TTTGAGTCCATCGACTGTCAGGG - Intergenic
1106484317 13:30159019-30159041 TGTGGGTCCCTGGGAAGTCTGGG + Intergenic
1106576562 13:30980381-30980403 TGTGAGAGCCTGGGCTGTCAGGG + Intergenic
1109989422 13:70034005-70034027 TGTGATTCCCAGGAATGTCATGG - Intronic
1112991096 13:105514791-105514813 TGTGCATCCCTGGACTTACAGGG - Intergenic
1115106839 14:29771633-29771655 TGTGGGTGCCTGTACTCCCATGG - Intronic
1118015171 14:61653072-61653094 TATGGGTCCCTGGACACTCCGGG + Intronic
1121146906 14:91592319-91592341 TCTGGATCCCTGCACTGGCAGGG - Intronic
1122261840 14:100528054-100528076 TGTGGGTCCCTGGGCTGGGCTGG + Intronic
1124560563 15:30770162-30770184 TGTAGGTCCCAGGAGTGCCAAGG + Intronic
1129491527 15:75930956-75930978 TTGAGGTCCCTGGACTGCCAGGG + Intronic
1131427325 15:92356238-92356260 TGTGGGACCCTGGGCTCACAAGG + Intergenic
1131579900 15:93632866-93632888 TGTGGCTCACAGGACTGACATGG + Intergenic
1134685996 16:16159221-16159243 TGTGGTTCCCTGCACTCCCATGG + Intronic
1135559986 16:23468832-23468854 TGGGGGCCCCTGAACTGTAAGGG - Intronic
1135925260 16:26688240-26688262 TGAGGGCCCCTGGACTGCAAAGG - Intergenic
1140728052 16:77831697-77831719 TGTGGTTTCCTGGACTGAAAAGG + Intronic
1141642679 16:85350436-85350458 TCAGGGACCCTAGACTGTCATGG + Intergenic
1143046269 17:4082545-4082567 TCTAGGTCTCTGGAATGTCATGG - Intronic
1143181919 17:4988718-4988740 TGTGGGTCTCTGGTCTTGCATGG - Intronic
1143285675 17:5787373-5787395 TGTGGGTCTCTGGACTGGGGTGG + Intronic
1144506669 17:15837355-15837377 TGTGCTTCCCTCTACTGTCAAGG - Intergenic
1147134499 17:38427496-38427518 TGTCCCTCCCTGGACTGTCAGGG + Intergenic
1147332480 17:39707021-39707043 GGTGGGTCTCGGGACTGGCAGGG - Exonic
1147421154 17:40322773-40322795 AGTGGGTCACAGGACTGACAGGG - Intronic
1150125452 17:62631951-62631973 TGGGGGTCCCTGGACTTGGAAGG + Intronic
1150640775 17:66948094-66948116 TGTGGGGCCCTGGGCTGAGAGGG - Intergenic
1151659187 17:75509699-75509721 TGTGTGACCCTGGCCTGCCACGG + Intronic
1151965062 17:77426823-77426845 TGTGGGTGCCTTGCATGTCACGG + Intronic
1152631774 17:81413747-81413769 TGCGTGACCCTGGCCTGTCATGG + Intronic
1153518782 18:5932147-5932169 TGGGGTTCCCTGGAAAGTCATGG + Intergenic
1157410273 18:47457597-47457619 TGTGGGTGCCTGTCCTGTGAGGG + Intergenic
1157607086 18:48932718-48932740 TGTGAGGCCCTGGCCTGTCTGGG - Intronic
1157763652 18:50282253-50282275 TGTGGGTCCCTGGGCTCTCGCGG + Intergenic
1158823162 18:61184517-61184539 TTTTGGTCCCAGGAATGTCAGGG - Intergenic
1158912008 18:62073843-62073865 TCTGGGCCCTTGGAATGTCATGG + Intronic
1161064213 19:2229588-2229610 TCAGGCTCCCTGGTCTGTCACGG + Intronic
1162799991 19:13104985-13105007 TGGAGGTCTCTGGACAGTCAGGG + Exonic
1164869512 19:31631546-31631568 TGTGGGTTCCTGGACATTCTGGG + Intergenic
1166105198 19:40594740-40594762 TGTGTGTCCCTGGACGGTGCTGG + Intronic
1168019116 19:53595855-53595877 TGTGGGTCCCTGGCCGGGCATGG + Intergenic
926738347 2:16091200-16091222 TGTGGGTCACTTCACGGTCAAGG + Intergenic
928189383 2:29148170-29148192 TGGGGCTCCCAGGGCTGTCAAGG - Intronic
930259271 2:49126225-49126247 TGAGGGTCCCATGTCTGTCAAGG + Intronic
932475778 2:72004947-72004969 TGTGGGAACCAGGACTGGCAGGG + Intergenic
932942456 2:76184067-76184089 TGTGGCTTCCTGGACTCTCATGG + Intergenic
933707985 2:85305575-85305597 TCTGGGTCCCTGTCCTTTCAGGG + Intronic
936078986 2:109419383-109419405 TGTGCCTACCTGGACTGTCATGG - Intronic
937083653 2:119157368-119157390 TGGGGGTCTCTGGGCTCTCAAGG + Intronic
937278025 2:120698567-120698589 TTTGTGTCCCTGAGCTGTCAAGG + Intergenic
937304815 2:120864782-120864804 TGTGGGTCACTTGTATGTCATGG + Intronic
937911616 2:127078305-127078327 TGTGGGTCTCTGTCCTGACATGG + Intronic
937979821 2:127608408-127608430 TGGGGGTCCCTGGAGTTTGAAGG + Intronic
938343324 2:130549535-130549557 TGTGGGGCGCTGGACTGTAGAGG + Intronic
938346509 2:130571187-130571209 TGTGGGGCGCTGGACTGTAGAGG - Intronic
942612485 2:177756206-177756228 AGTGGGCCCCTGGTCTTTCAGGG + Intronic
942891315 2:180992505-180992527 TGTGGGTCCAGGGACTATCTTGG + Intronic
944531348 2:200670499-200670521 TGTTGTTCCCTGACCTGTCATGG + Intronic
1169425277 20:5491959-5491981 TCTTGGGCCCTGGAGTGTCAGGG - Intergenic
1172606549 20:36217931-36217953 TCTGGGCCCCTGGACAGACAAGG + Intronic
1172645075 20:36463910-36463932 TGTGGGTCCCTGGCCCTTCTGGG - Intronic
1174189159 20:48727951-48727973 TGAGGGACCCAGGACTGTGAAGG - Intronic
1174511985 20:51060337-51060359 TATGGGTTCCTGGCCTGTGATGG + Intergenic
1175970287 20:62682922-62682944 TGTGTGGCCCTGGACTGGCGAGG - Intronic
1176896450 21:14383776-14383798 TGAGGGTCACTGGAGTTTCAGGG - Intergenic
1180244680 21:46539133-46539155 TCTGGGGCCCAGGACTGTCCAGG + Intronic
1181696315 22:24594582-24594604 TGGGGGTCCGTGGATGGTCAAGG - Intronic
1184699692 22:46162328-46162350 GGTCAGTCCCTGGAATGTCAGGG - Intronic
950602759 3:14049364-14049386 TGGGGGTCCCTGTACTACCAGGG + Intronic
950938403 3:16866958-16866980 GGTGGGTCCATGGGCTGTAAGGG - Intronic
952415091 3:33082792-33082814 TGTGCATTCATGGACTGTCATGG + Intronic
953956584 3:47236288-47236310 TGTGGTTCCCAGGACTGTGAGGG - Intronic
954431244 3:50471977-50471999 TGTGCTTCTCTGGACAGTCATGG - Intronic
956110365 3:65864477-65864499 TGGGGAAGCCTGGACTGTCAAGG + Intronic
958665980 3:97138720-97138742 TGTGGGTCCCTGTTGTGGCATGG + Intronic
959208665 3:103346604-103346626 TTTGGGTCACTGGACTGGAAGGG - Intergenic
960629704 3:119717454-119717476 TGTGGGACCCAGGACTCTAAGGG + Intronic
961518161 3:127451320-127451342 TCAGGGTCCCTGGACAGTGAGGG - Intergenic
966643424 3:182215856-182215878 TGTGTGTTCCAGGCCTGTCATGG - Intergenic
967702890 3:192614788-192614810 TGTGAGTTCCTGGACTTTCCTGG + Intronic
968954921 4:3713347-3713369 TGTGTGTCCCAGGAATCTCAGGG + Intergenic
969868842 4:10092561-10092583 TCTGTGTCCCTGGACTGTGCCGG - Intronic
971283226 4:25259858-25259880 TGTGGGTCCCTGGACTGTCAGGG + Intronic
972819346 4:42681867-42681889 TGTGAGAAACTGGACTGTCATGG + Intergenic
974063610 4:57056953-57056975 TGTGTCTCCCTGCACTGTTAGGG - Intronic
975506130 4:75140294-75140316 TGTAGGTGCTTGGACTGCCAAGG - Intergenic
976204216 4:82609310-82609332 GGAGGGCCCCTGGACTGGCAAGG - Intergenic
978846398 4:113278079-113278101 TGTATGTACCTGGACGGTCATGG - Intronic
981578339 4:146227974-146227996 AGTGAGTCCCTGGCCTGTCTGGG - Intronic
982165059 4:152606771-152606793 TCTGGGTCCCAGGACTCTGAAGG + Intergenic
982293516 4:153803745-153803767 TGTGGCTCACTGGAGTGTCCTGG - Intergenic
982337749 4:154258821-154258843 TTTTGGCCCCTGGAATGTCATGG - Intronic
985841098 5:2306548-2306570 TGTGGGCCCCTGGACTGGGGTGG - Intergenic
986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG + Intronic
991697212 5:69284387-69284409 TGTGGGTAGCAGGACTGTAAAGG + Intronic
993156571 5:84232324-84232346 TGTCTGTCCCTGGATTGTAAGGG - Intronic
997284682 5:132669612-132669634 GGTGGGTGCCTGCATTGTCAGGG - Intergenic
997522655 5:134533098-134533120 TGTTGGTCTCTGGGCAGTCAAGG + Intronic
999740852 5:154550277-154550299 TGTAGGTTCCTCGATTGTCATGG - Intergenic
1000287900 5:159843775-159843797 GGTGGGTACATGGACTGTGATGG - Intergenic
1001082623 5:168678238-168678260 TGTGGATCCCTGGAGGTTCAGGG + Intronic
1003339447 6:5205488-5205510 AGTGGTTCCCTGAACTGCCAGGG + Intronic
1006343247 6:33458894-33458916 TGTGGGTGGCTGAACTGACACGG + Intergenic
1006922051 6:37633624-37633646 TGTGGCACCCAGGCCTGTCATGG + Exonic
1007787244 6:44287668-44287690 TGTGGGTTCCTGGACTTTGCAGG + Exonic
1007789387 6:44300523-44300545 TGTGGGTCCCTGGGCGGACCTGG + Exonic
1018904755 6:168069203-168069225 TGAGGGTCCTTGGCCTGTTATGG - Intronic
1019427832 7:985651-985673 GGAAGGTGCCTGGACTGTCAGGG - Intronic
1019770157 7:2878598-2878620 TGTGGGTCCCTGCAATGCCCTGG + Intergenic
1019782864 7:2954537-2954559 TGTGAGTGCCTGGACTGAAAGGG + Intronic
1020446090 7:8269393-8269415 TGTGGGTCCCAGGACCATGAGGG + Intergenic
1021229547 7:18069382-18069404 TGTGGATCCCCGGCCTTTCAGGG - Intergenic
1025635740 7:63317885-63317907 TGTGGGGCCCCTGGCTGTCAAGG - Intergenic
1025646956 7:63430295-63430317 TGTGGGGCCCCTGGCTGTCAAGG + Intergenic
1026654754 7:72247181-72247203 CGTGGGTCCTTGGTCTGGCAAGG + Intronic
1033418094 7:141182137-141182159 TTTGGGGGCCTGGACAGTCAGGG + Intronic
1034290062 7:149923678-149923700 TGTGTGTACCTAGTCTGTCATGG - Intergenic
1034661006 7:152769168-152769190 TGTGTGTACCTAGTCTGTCATGG + Intronic
1034842845 7:154415574-154415596 TGTGGGTCCCTGAGCTATCTTGG + Intronic
1035246067 7:157562589-157562611 TGTGGCTCCCCGGACTTTGAAGG - Intronic
1035461250 7:159040505-159040527 TCTGGGGCCCTGGGCTGTCCCGG - Intronic
1036452527 8:8881405-8881427 TGTGAGTTCCTGGAAGGTCATGG - Intronic
1037131251 8:15410605-15410627 TGTGGTTCCCTGTAGTTTCAGGG - Intergenic
1037796397 8:21998905-21998927 TGTGGGTCTCTGGCCAGTCCTGG + Intronic
1047610899 8:126519872-126519894 TGTTGGTTGCTGGACTATCAGGG + Intergenic
1052733917 9:32320726-32320748 TGGGGGTCCCGGGAGAGTCAGGG - Intergenic
1058013838 9:100007887-100007909 TGTGGGTCCTCTGACTGTCTGGG - Intronic
1058644062 9:107114213-107114235 TCTGGGCCCCTTGACAGTCAGGG + Intergenic
1059302138 9:113322655-113322677 TGTGAGACCCTGGCCTCTCAGGG - Intronic
1059733658 9:117080831-117080853 TGTGGTTCTCTGGGGTGTCAGGG - Intronic
1061745104 9:132733850-132733872 AGTGGGTGCCTGGACTGGCCAGG + Intronic
1186737965 X:12486095-12486117 TGGGGCTCCCTGGCCTGGCAGGG - Intronic
1188904233 X:35773177-35773199 TCTAGGTCCAGGGACTGTCATGG - Intergenic
1190516858 X:51232806-51232828 TGTGGGGGCATGGAATGTCAAGG + Intergenic
1190913879 X:54795577-54795599 TCTGTGTCACTGTACTGTCAGGG - Intronic
1196458093 X:115903879-115903901 TGTGGGGCCCTGCCCTGTCCTGG + Intergenic
1196683244 X:118489992-118490014 TGAGGGTCCCTGAATTGCCAAGG - Intergenic
1202601022 Y:26593112-26593134 TGTGAGTCTGTGGACTGGCATGG - Intergenic