ID: 971286159

View in Genome Browser
Species Human (GRCh38)
Location 4:25291731-25291753
Sequence AAATGGCAACTGAGGTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971286159_971286163 -3 Left 971286159 4:25291731-25291753 CCTGGATACCTCAGTTGCCATTT No data
Right 971286163 4:25291751-25291773 TTTTTGTTCTTCTCAGCGGCAGG No data
971286159_971286161 -7 Left 971286159 4:25291731-25291753 CCTGGATACCTCAGTTGCCATTT No data
Right 971286161 4:25291747-25291769 GCCATTTTTGTTCTTCTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971286159 Original CRISPR AAATGGCAACTGAGGTATCC AGG (reversed) Intergenic
No off target data available for this crispr