ID: 971290981

View in Genome Browser
Species Human (GRCh38)
Location 4:25339231-25339253
Sequence ATCACCAGTACTTCAGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 1, 2: 12, 3: 66, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971290981_971290985 2 Left 971290981 4:25339231-25339253 CCACATTCTGAAGTACTGGTGAT 0: 1
1: 1
2: 12
3: 66
4: 280
Right 971290985 4:25339256-25339278 GGGCTTCAACATAAGGATTTTGG No data
971290981_971290984 -5 Left 971290981 4:25339231-25339253 CCACATTCTGAAGTACTGGTGAT 0: 1
1: 1
2: 12
3: 66
4: 280
Right 971290984 4:25339249-25339271 GTGATTAGGGCTTCAACATAAGG 0: 2
1: 9
2: 66
3: 149
4: 305
971290981_971290986 3 Left 971290981 4:25339231-25339253 CCACATTCTGAAGTACTGGTGAT 0: 1
1: 1
2: 12
3: 66
4: 280
Right 971290986 4:25339257-25339279 GGCTTCAACATAAGGATTTTGGG 0: 1
1: 35
2: 333
3: 1232
4: 2850
971290981_971290987 4 Left 971290981 4:25339231-25339253 CCACATTCTGAAGTACTGGTGAT 0: 1
1: 1
2: 12
3: 66
4: 280
Right 971290987 4:25339258-25339280 GCTTCAACATAAGGATTTTGGGG 0: 1
1: 30
2: 309
3: 1203
4: 3005
971290981_971290988 5 Left 971290981 4:25339231-25339253 CCACATTCTGAAGTACTGGTGAT 0: 1
1: 1
2: 12
3: 66
4: 280
Right 971290988 4:25339259-25339281 CTTCAACATAAGGATTTTGGGGG 0: 1
1: 36
2: 359
3: 1426
4: 3142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971290981 Original CRISPR ATCACCAGTACTTCAGAATG TGG (reversed) Intronic
900912694 1:5612920-5612942 ATCCCCAGTATCTTAGAATGTGG + Intergenic
902270009 1:15297069-15297091 ATCACCATCACTTAACAATGAGG + Intronic
902587347 1:17448361-17448383 ACCACCAGTATCTCAGAATGTGG - Intergenic
902834014 1:19035212-19035234 AACCCCAGAACCTCAGAATGTGG + Intergenic
904294963 1:29514180-29514202 ATCCCTAGCACCTCAGAATGTGG - Intergenic
905512077 1:38529733-38529755 CTGACCAATGCTTCAGAATGAGG - Intergenic
906860045 1:49349738-49349760 ATCCCCAGTATCTCAGAACGTGG + Intronic
908032485 1:60016083-60016105 ATCCCCAGTACTTCAGAATATGG - Intronic
908043627 1:60143968-60143990 ACCCCTAGTACCTCAGAATGGGG - Intergenic
908127465 1:61045276-61045298 AGTCTCAGTACTTCAGAATGTGG - Intronic
908211728 1:61907000-61907022 ATCACAAGAACAGCAGAATGGGG - Intronic
908416707 1:63920284-63920306 ATCACCAGTGCTTCAGCCTGAGG - Intronic
910537349 1:88313675-88313697 ACCCCCAGTACCTCAGAATGTGG + Intergenic
911372878 1:97015046-97015068 ATCCCCAGTACTTCAGAGTGTGG - Intergenic
912259482 1:108096196-108096218 ACTCCCAGTACGTCAGAATGTGG + Intergenic
912267728 1:108175242-108175264 ATCATGAGAACATCAGAATGAGG - Intronic
916953826 1:169810654-169810676 ACTCCCAATACTTCAGAATGTGG - Intronic
917415897 1:174808955-174808977 ATCACAAGTATTTGAGAATGAGG - Intronic
917492096 1:175506421-175506443 ACCCCCAGTACTTGAGAATGTGG + Intronic
917595973 1:176529472-176529494 ATCCCCAGTACTTCAAAGTGTGG - Intronic
917730273 1:177868166-177868188 ACCCCCAGTACCTCAGAATGTGG + Intergenic
918050330 1:180967824-180967846 ACCCCCAGTACCTCAGAATGTGG - Intergenic
918060881 1:181060334-181060356 ACCCCCAGTACCTCAGAATGTGG - Exonic
918506755 1:185263194-185263216 ACCTCCAGTACTGCAGAATGTGG - Intronic
920725045 1:208427181-208427203 ATCCCCAGTACTGCGGAATGTGG + Intergenic
922819840 1:228476696-228476718 ACCCCCAGGACCTCAGAATGTGG + Intergenic
922977876 1:229800256-229800278 ATCACCATTACTTCTCAGTGTGG - Intergenic
922978264 1:229802972-229802994 ACCCCCAGGACCTCAGAATGTGG + Intergenic
1064006074 10:11700194-11700216 AACCCCAGTACATCAGAATGTGG + Intergenic
1064170141 10:13024341-13024363 AACACCAGTTCTTCAGAGAGAGG - Intronic
1066120487 10:32281491-32281513 ATCACAATTACTACTGAATGAGG + Intronic
1066358463 10:34707525-34707547 AGAACCAGTGATTCAGAATGAGG + Intronic
1067250299 10:44580846-44580868 GTCACCAGTGCTTTAGACTGTGG - Intergenic
1067546329 10:47195009-47195031 AACTCCAGTGCCTCAGAATGTGG + Intergenic
1068468711 10:57431741-57431763 ATTTCCAGTACCTCAGAATTTGG + Intergenic
1068939427 10:62666343-62666365 ACTCCCAGTACCTCAGAATGTGG + Intronic
1069214324 10:65800334-65800356 ATCCCCAGTAGCTCAGAATGGGG - Intergenic
1069421685 10:68252213-68252235 ATCACAAGCACTTCAGCTTGGGG - Intergenic
1069696025 10:70386137-70386159 ACCCCTAGTACCTCAGAATGTGG + Intergenic
1070548760 10:77474261-77474283 ATCCCCAGGACCTCAGAATGTGG + Intronic
1074571293 10:114626722-114626744 ACCCCCAGTATCTCAGAATGTGG + Intronic
1076183136 10:128426218-128426240 ACCCCCAGTACCTCAGAATGGGG - Intergenic
1076382560 10:130035399-130035421 ACCCCCAGTAAATCAGAATGTGG - Intergenic
1077796858 11:5501289-5501311 ATCACCAGTAGGGCAGAATCAGG - Intronic
1078738108 11:14040173-14040195 ATCACAAGTACAGCAGCATGAGG + Intronic
1080133385 11:28823524-28823546 ATCATCAGTACTTCATCTTGAGG - Intergenic
1080149495 11:29033271-29033293 ACCACTAATACCTCAGAATGTGG - Intergenic
1082736559 11:56862230-56862252 ATGTCAAGTTCTTCAGAATGGGG - Intergenic
1082927463 11:58565063-58565085 ATCACCAAACGTTCAGAATGGGG + Intronic
1083169168 11:60912601-60912623 ATGAACAGGGCTTCAGAATGAGG - Intergenic
1084377455 11:68787550-68787572 ACCCCCAGCACCTCAGAATGTGG + Intronic
1084405163 11:68967872-68967894 CTCACCAGAATCTCAGAATGTGG - Intergenic
1084547906 11:69823574-69823596 CTCACTAGGACCTCAGAATGTGG - Intergenic
1085758851 11:79224541-79224563 ACCCCCAGTACTGCAGAGTGGGG + Intronic
1088434513 11:109796299-109796321 AGGACCTGCACTTCAGAATGGGG + Intergenic
1089370888 11:117956181-117956203 AACCCCCGTACCTCAGAATGTGG + Intergenic
1089534350 11:119151361-119151383 ATGGCCAGTACAGCAGAATGAGG - Intronic
1098449597 12:70604668-70604690 AACCCCAGTACCTCAGTATGTGG + Intronic
1098630539 12:72716534-72716556 ATTACCAAAACTTCAGAAAGTGG + Intergenic
1098912069 12:76219099-76219121 ATCCCTAGTACCTCAGAATGTGG - Intergenic
1099686976 12:85902660-85902682 ACCGCCAGTATTTTAGAATGTGG + Intergenic
1101305891 12:103527504-103527526 ATCAACAATATGTCAGAATGAGG - Intergenic
1101814106 12:108131836-108131858 ATCACCAGGACATCAGGAGGTGG + Exonic
1102649712 12:114430936-114430958 ATCCCTAGTACCTCAGAATGTGG - Intergenic
1103038715 12:117677253-117677275 ACCCCTAGGACTTCAGAATGTGG + Intronic
1103195165 12:119037411-119037433 GTCACCGGCCCTTCAGAATGAGG + Intronic
1104231561 12:126889569-126889591 ACTCCCAGTAATTCAGAATGAGG + Intergenic
1105606063 13:21927435-21927457 ATCCCCAGTACCTCAAAGTGTGG + Intergenic
1106047786 13:26160998-26161020 ACCCCCAGTACCTCACAATGTGG - Intronic
1106333851 13:28764934-28764956 ACCCTCAGTACCTCAGAATGTGG - Intergenic
1106882124 13:34143204-34143226 CTCCCCAGCACTTCAGAATGTGG + Intergenic
1107153515 13:37139945-37139967 ATCCCCAGTACTTCAGAATGTGG - Intergenic
1110454856 13:75679869-75679891 ATCACCAGGACTGCAGGGTGTGG - Intronic
1111268658 13:85852681-85852703 TTCACCAGTAGTTGAAAATGAGG + Intergenic
1111505347 13:89182921-89182943 ATCACAAGAACATCAGCATGGGG + Intergenic
1112095710 13:96129682-96129704 ATCCCCAGTACCTCAGAGTGTGG + Intronic
1112154962 13:96807323-96807345 ACCTCCAGTACCTCAAAATGTGG + Intronic
1113645598 13:111992954-111992976 ACCTTCAGCACTTCAGAATGTGG - Intergenic
1114953759 14:27791911-27791933 ATAACCAGTTCTTCTGAAGGTGG + Intergenic
1117748590 14:58897343-58897365 GCCCCCAGTACCTCAGAATGTGG + Intergenic
1118124389 14:62884073-62884095 ACCACCAGTACTGCAGAAATGGG + Intronic
1119694379 14:76701131-76701153 ATCCCCAGTACCTTAGAATATGG + Intergenic
1120041843 14:79762780-79762802 ATCACCATTACTTAAGAGAGAGG + Intronic
1120730993 14:88001653-88001675 ATCCTCAATACTTCAGAATGTGG - Intergenic
1120972354 14:90218253-90218275 ACCTCAAGTACCTCAGAATGTGG + Intergenic
1122150599 14:99724193-99724215 ATCCCCAGTACCTCAGAATGCGG - Intronic
1122438998 14:101717377-101717399 ACCCCCAGTACCTCAGAATGTGG + Intergenic
1124055880 15:26240746-26240768 AACTCCAGGACCTCAGAATGTGG + Intergenic
1125382948 15:39106588-39106610 ATTACCAGTACTTGAGAAAATGG + Intergenic
1127064711 15:55224878-55224900 ATGAACACTACTTCATAATGAGG - Intronic
1129522525 15:76194858-76194880 ACCCCTAGTACCTCAGAATGTGG - Intronic
1137521981 16:49202297-49202319 ACCCTCAGTACTTCAGAATATGG + Intergenic
1138425344 16:56928459-56928481 ACCACCAGTACCTGTGAATGTGG + Intergenic
1141276594 16:82593971-82593993 ACCACCAGTACCTCAGAGTGTGG - Intergenic
1141288697 16:82697299-82697321 ATCACCAGTACCTGGGAATATGG - Intronic
1146089103 17:29858428-29858450 ATCCCCAGTATCTCAGAATGTGG + Intronic
1149554494 17:57563608-57563630 ATCTCCAGTCCTTCCTAATGTGG + Intronic
1150055886 17:62015259-62015281 TTCTGCAGTACTTCAGTATGCGG - Intronic
1150506506 17:65703973-65703995 ATCCCCAGTACCTCAGAACGTGG + Intronic
1150647286 17:66986914-66986936 ACCCCCAGTATCTCAGAATGTGG - Intronic
1153824801 18:8865558-8865580 ATTCCCAGTACCTCAAAATGTGG - Intergenic
1155528772 18:26744484-26744506 ACCCCCAGTACCTCAGAATGTGG - Intergenic
1156013580 18:32522410-32522432 ATCCCCAGTACCTCAGAATGTGG - Intergenic
1157237988 18:45981962-45981984 CCAGCCAGTACTTCAGAATGTGG - Intergenic
1157458619 18:47862642-47862664 ACCTCCAATACCTCAGAATGTGG - Intronic
1158947237 18:62457621-62457643 ATCTCCAGTACCTTAGAATGTGG + Intergenic
1159014937 18:63093593-63093615 ATCCCCAGTATCTCAGAATGTGG - Intergenic
1160060558 18:75525559-75525581 ACCCTCAGTATTTCAGAATGTGG - Intergenic
1161863725 19:6818593-6818615 ACCCCTAGTACCTCAGAATGTGG + Intronic
1161899054 19:7104205-7104227 GTCCCCAGGACCTCAGAATGTGG - Intergenic
1162873408 19:13602716-13602738 AACTCCAGTATCTCAGAATGGGG - Intronic
1163066209 19:14797872-14797894 ACCGCCAAAACTTCAGAATGTGG + Intronic
1164404212 19:27928174-27928196 ATCACCAGTAGTGCAGAAAGAGG + Intergenic
1164787369 19:30944252-30944274 ATCACGAGTCCTTAAAAATGGGG + Intergenic
1165718565 19:38063034-38063056 GTCACCCGTGCTTCACAATGGGG - Intronic
1167757221 19:51420435-51420457 ACCTCCAGTACCTAAGAATGTGG - Intergenic
1167857668 19:52255972-52255994 ACCCCCAGTACCTCAGCATGTGG + Intergenic
926742558 2:16124936-16124958 ACCCTCACTACTTCAGAATGTGG + Intergenic
926814216 2:16784368-16784390 ACCCCCAGTACCTCTGAATGTGG + Intergenic
928825970 2:35421353-35421375 ACCCCCAGTACCTCAGAATGTGG - Intergenic
929327928 2:40640383-40640405 ATCACCAGTTATTCTGAATTTGG + Intergenic
930508552 2:52315464-52315486 ATCCCCACTACTTTAGAATAGGG + Intergenic
930985251 2:57578317-57578339 ATCTCCAGTACTCCAGAATGTGG + Intergenic
932708819 2:74047426-74047448 ATCCCCTGTACTTCAGAGGGAGG + Exonic
932849761 2:75173027-75173049 ATCCCCAGTGTCTCAGAATGTGG - Intronic
934483511 2:94677065-94677087 ATAACCAGTTCTTCTGAAGGTGG - Intergenic
934718891 2:96559193-96559215 ACCCCCAGCACTTCAGAATGTGG + Intergenic
935811248 2:106799612-106799634 ACAAGCAGTACTTAAGAATGAGG - Intergenic
936598434 2:113872216-113872238 ATCCCCAGTACCTCAGAATGTGG + Intergenic
936691038 2:114888934-114888956 ACCCTCAATACTTCAGAATGTGG + Intronic
937150060 2:119680191-119680213 ACCCCCAGTACCTCAGACTGTGG - Intronic
937812294 2:126212570-126212592 ACCCCCAGTACCTCAGAATGTGG + Intergenic
938373100 2:130786199-130786221 AGCCTCAGTACCTCAGAATGGGG - Intergenic
938627913 2:133131915-133131937 GTCACCAATACTACAGAATTTGG + Intronic
939408903 2:141798810-141798832 AACTTCAGTACCTCAGAATGTGG + Intronic
939475834 2:142685719-142685741 ATGTCCAGTAGTTCAAAATGTGG + Intergenic
940561741 2:155305557-155305579 ATCACAAGAACTGCAGCATGAGG - Intergenic
941230463 2:162905480-162905502 ATTCCCAGTACTTTAGAATGTGG + Intergenic
942188323 2:173445796-173445818 ACTAACAGTACTTGAGAATGAGG - Intergenic
942490913 2:176489055-176489077 ATCACCCGGACTTTAGAATCTGG - Intergenic
944137172 2:196412414-196412436 AACCCCAGTACCTCAGAATGTGG - Intronic
944540091 2:200746286-200746308 AGCCCCAGTTCTTCAGAATGTGG - Intergenic
946216193 2:218185649-218185671 AACTCCAGTACATCAGAAGGTGG - Intergenic
946529940 2:220560070-220560092 AACCCCAGTACATCAGTATGTGG + Intergenic
947389242 2:229622608-229622630 ATCCCCAGTACCTCAGAATGTGG + Intronic
947926096 2:233923923-233923945 ACCATCAGGACTTCAGAATAAGG + Intronic
948025318 2:234771800-234771822 CCCCGCAGTACTTCAGAATGTGG + Intergenic
948183445 2:236001015-236001037 ACCCCCACTACCTCAGAATGTGG + Intronic
949024134 2:241757376-241757398 AGCCCCAGTATTTCAGAATATGG + Intronic
1169823386 20:9739490-9739512 ATCACCAGAAATTCAGAAACAGG + Intronic
1169961598 20:11166259-11166281 TTCACCAGTGCTTCTCAATGTGG + Intergenic
1170444575 20:16412659-16412681 ATCACAAGAACAGCAGAATGGGG + Intronic
1170536813 20:17348862-17348884 ACCCCCAGTACCTCAGAATGAGG - Intronic
1171121608 20:22573278-22573300 TTCACCAGAACTCCAGAATCTGG - Intergenic
1175303477 20:57959633-57959655 CTCCCCAGAACCTCAGAATGTGG + Intergenic
1175451030 20:59068358-59068380 ACCACCAGTACTTGTGAATGTGG + Intergenic
1177377126 21:20285682-20285704 AAACCTAGTACTTCAGAATGTGG + Intergenic
1177543943 21:22532645-22532667 AGCTCCAGCATTTCAGAATGTGG + Intergenic
1177924466 21:27196768-27196790 ATTCCAAGTACTTCAGAGTGTGG - Intergenic
1178311997 21:31537217-31537239 GTCACTGGAACTTCAGAATGTGG - Intronic
1178603450 21:34014920-34014942 GTCACCAGTGGTTCAGAAGGAGG + Intergenic
1178732039 21:35113026-35113048 ACTCCCGGTACTTCAGAATGTGG + Intronic
1179175584 21:39005583-39005605 CTAACCAGAACCTCAGAATGTGG - Intergenic
1179483169 21:41691477-41691499 ATCACCAGCTCTTTAGAAGGAGG + Intergenic
1180027918 21:45178899-45178921 AGCACCAGACCTTCAGAGTGAGG + Intronic
1181021359 22:20105059-20105081 ATCTCCAGTGCTTCAAAGTGTGG + Intronic
1183161736 22:36118213-36118235 ATCACCACTGTTCCAGAATGAGG + Intergenic
1184587755 22:45459301-45459323 ATCACCAGAACCTCAGAATGTGG - Intergenic
1184833617 22:47007223-47007245 ATCATGAGTACTTCTGAATTGGG + Intronic
1185012865 22:48325465-48325487 ACTCCCAGTACCTCAGAATGTGG - Intergenic
949285673 3:2401089-2401111 ATCACCTGTATTACAGAATTAGG + Intronic
949416435 3:3819728-3819750 ATCCCAAGGACCTCAGAATGTGG - Intronic
951756705 3:26098686-26098708 AACCCCAGTACCTCAGCATGTGG - Intergenic
952830540 3:37561106-37561128 ACTCCCAGTACCTCAGAATGGGG - Intronic
955574392 3:60343722-60343744 ATCCACAGTGCATCAGAATGTGG - Intronic
956694090 3:71904015-71904037 ATTCCCAGTACCTCAGAATGTGG + Intergenic
957840157 3:85657833-85657855 ATCTCTAGTACCTCAGAAAGTGG + Intronic
959084413 3:101835723-101835745 ACCCCCAGTACCGCAGAATGTGG - Intronic
959786782 3:110308796-110308818 GTCTCCAGTACCTCAGAATATGG - Intergenic
959826471 3:110803085-110803107 ACCCCTAGTACCTCAGAATGTGG + Intergenic
960041552 3:113154992-113155014 ATCAGCAGTGCTTAAGAATTTGG - Intergenic
961327909 3:126120967-126120989 ACCCCCAGTACCTCACAATGTGG + Intronic
961502162 3:127344060-127344082 ACCCCTAGTACCTCAGAATGTGG - Intergenic
963710620 3:148743845-148743867 ATCACCATAACCTCAGAATGGGG + Intergenic
964251736 3:154725709-154725731 ACCCCAAGTACTTCAGAATGTGG - Intergenic
965635663 3:170777764-170777786 ATCCCCAATACCACAGAATGTGG + Intronic
965839925 3:172893175-172893197 ACCCCCAGTACTTTAGAATGTGG + Intronic
966558047 3:181285824-181285846 ACCCCCAGTACCTCAGAATATGG + Intergenic
966948099 3:184791703-184791725 ATCACCAGCACAGCAGAGTGAGG - Intergenic
967964454 3:194950040-194950062 ACCCTCAGTACCTCAGAATGTGG - Intergenic
968673999 4:1867265-1867287 ACTCCCAGTACCTCAGAATGTGG - Intergenic
969076270 4:4580622-4580644 ATCACCAGTACTTAAGCCTAAGG - Intergenic
969089436 4:4682662-4682684 ACCCCCAGGGCTTCAGAATGTGG - Intergenic
969577820 4:8046724-8046746 ACCCCCAGGACCTCAGAATGTGG + Intronic
970028054 4:11644959-11644981 ATACCCAGTAACTCAGAATGTGG + Intergenic
971083962 4:23248513-23248535 AACACCAGTCCTTCAGAATGAGG + Intergenic
971275251 4:25190429-25190451 ACCTACAGTACTTCAGAATGTGG - Intronic
971290981 4:25339231-25339253 ATCACCAGTACTTCAGAATGTGG - Intronic
973960026 4:56100562-56100584 ACCACCAGTACCTTAGAATGTGG + Intergenic
974241962 4:59260942-59260964 ACCCTCAGTACCTCAGAATGTGG + Intergenic
975094938 4:70446638-70446660 ACCTCCAGGACCTCAGAATGTGG - Intronic
976055803 4:81064860-81064882 AACACAAGTTCTTCAGAATACGG - Intergenic
976112258 4:81688570-81688592 ACCCCTAGTACTTCAGAATGTGG + Intronic
976469463 4:85411148-85411170 GTCACCAGTACTTGTAAATGTGG + Intergenic
976470163 4:85418877-85418899 ACCCCTAGTACCTCAGAATGTGG - Intergenic
976505039 4:85836618-85836640 ACCTCCAGTATCTCAGAATGTGG - Intronic
976513625 4:85938588-85938610 ATTTCCAGTGCTACAGAATGGGG + Intronic
977870431 4:102083817-102083839 ACCCACAGTACCTCAGAATGTGG + Intergenic
978417476 4:108491933-108491955 AGAACCAGTACTTTAGAATAGGG - Intergenic
978428666 4:108609138-108609160 AGCACCATTACCTCAGAATATGG - Intergenic
978817716 4:112928520-112928542 ACCCTCAGTACTTTAGAATGTGG + Intronic
979441759 4:120758385-120758407 AACCCCAGTACCTCATAATGTGG + Intronic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980610905 4:135162318-135162340 ACTCCCAGTACCTCAGAATGTGG + Intergenic
980737392 4:136908235-136908257 AGCACAAGTACTTCTGAGTGTGG + Intergenic
981811346 4:148779391-148779413 ATCTCCAGTTCTCCAGAAAGTGG + Intergenic
982167391 4:152626950-152626972 CTCACCAGCACATCTGAATGAGG - Exonic
984336662 4:178401183-178401205 ACCCCCAGTGCATCAGAATGTGG + Intergenic
986455877 5:7917451-7917473 ACCCCCGGTACTTCAGAATGTGG - Intergenic
986778904 5:11046123-11046145 ACCCCCAGTCCCTCAGAATGCGG + Intronic
987244363 5:16033596-16033618 AGCCTCAGTATTTCAGAATGTGG + Intergenic
987871289 5:23621066-23621088 ATCAAATGCACTTCAGAATGTGG + Intergenic
987912562 5:24167676-24167698 ATCCCCAATAATTCATAATGTGG - Intronic
988322117 5:29712394-29712416 ACCCAAAGTACTTCAGAATGTGG + Intergenic
988401912 5:30773576-30773598 ATCACCAGTAATTAAGACAGTGG - Intergenic
988422748 5:31026254-31026276 ACCCCCAGTAACTCAGAATGTGG + Intergenic
989125946 5:38052474-38052496 ATCCCCAGTACCTCAGAATGTGG - Intergenic
989263574 5:39446656-39446678 ATAACCAGCAGATCAGAATGGGG + Intronic
989437171 5:41428322-41428344 ACCCCCAGTACCTCAGAATAGGG + Intronic
992204163 5:74414157-74414179 ATGCTCAGTACTTCAGAATGTGG - Intergenic
992304559 5:75422731-75422753 ATCTCCAGTACCTTAGAATATGG + Intronic
992989169 5:82266349-82266371 ATCACTAGGGATTCAGAATGGGG - Intronic
993955749 5:94230403-94230425 ATAACCAGTGCTTCTGAATCTGG + Intronic
994499136 5:100551950-100551972 ATCCCCGGTACTGCAAAATGTGG - Intronic
994944900 5:106375102-106375124 GTCACCAGCTCTTCAGAATTAGG - Intergenic
995654331 5:114408039-114408061 GGCACCAGTACTTCTGCATGTGG - Intronic
997853062 5:137349895-137349917 ATCCCCAGTACCTCAGAATTTGG - Intronic
999020500 5:148160502-148160524 ATATCCAGTATATCAGAATGTGG - Intergenic
999893297 5:156002096-156002118 ACCTCCAGGACCTCAGAATGTGG + Intronic
1000369555 5:160521573-160521595 ATCACCAGAACAGCAGCATGGGG + Intergenic
1001904673 5:175461792-175461814 ACCCCCAGTAGCTCAGAATGTGG + Intergenic
1002812104 6:640517-640539 AGCCCCAGTACCCCAGAATGTGG + Intronic
1002954793 6:1851646-1851668 ATCACCAGTATTCCAGTATTGGG + Intronic
1003024510 6:2542352-2542374 AACCCCAGTACTTAAGAACGTGG + Intergenic
1003501927 6:6710280-6710302 AGCACCAATACATCAGGATGAGG + Intergenic
1004927761 6:20432077-20432099 ACCCCCAGTGCCTCAGAATGTGG - Intronic
1005154516 6:22789181-22789203 ACCTCCAGTATTTCAGAGTGTGG - Intergenic
1005201883 6:23355845-23355867 ATCTCTAGGACTTCAGAATGTGG + Intergenic
1005327602 6:24718663-24718685 ACCACCTGTATTTCAAAATGGGG - Exonic
1006736064 6:36273434-36273456 AACTCCAGGCCTTCAGAATGGGG + Intronic
1009539167 6:64929042-64929064 ATCACCAGGATCTCAAAATGTGG + Intronic
1013260003 6:108432456-108432478 ATCACCATTACTCCGCAATGGGG - Intronic
1013319550 6:108973555-108973577 GTTACCAGTTCTTAAGAATGAGG - Exonic
1013346219 6:109263223-109263245 ATCCCCAGTACCTCCGAATGTGG + Intergenic
1015294011 6:131569849-131569871 ACCTTCAGTACCTCAGAATGTGG + Intergenic
1015417813 6:132969614-132969636 ATCCCCAGTACCGCAGGATGTGG - Intergenic
1015971014 6:138742297-138742319 ATCACCATTACTTCAGGTGGCGG - Intergenic
1016340266 6:143054532-143054554 ATTCCCAGTACCTCAGAATGTGG - Intergenic
1016372861 6:143392644-143392666 ATCCCCAGTACCCCACAATGTGG - Intergenic
1017019077 6:150125865-150125887 GTCCCCAGTACCTCAGAATGAGG + Intergenic
1017118400 6:151000853-151000875 ACCAACAGCGCTTCAGAATGAGG + Intronic
1017658799 6:156654366-156654388 ACCATCAGTACTTCAGGCTGTGG - Intergenic
1017942061 6:159061626-159061648 GTCCCCAGTACCTCAGATTGTGG + Intergenic
1017950491 6:159131313-159131335 GCCCCCAGTACCTCAGAATGTGG + Intergenic
1018035444 6:159877509-159877531 ACCTCCAGTACCACAGAATGTGG + Intergenic
1018085670 6:160299609-160299631 ACCCCGAGTACCTCAGAATGTGG + Intergenic
1018993640 6:168693629-168693651 ACCCTCAGTACTTCAAAATGTGG - Intergenic
1019140663 6:169940381-169940403 ACCCCCAGTACTTCAGCCTGGGG - Intergenic
1019559500 7:1648938-1648960 ACCCCCAGGACCTCAGAATGGGG - Intergenic
1021097572 7:16551020-16551042 ATTCCCAGTCCCTCAGAATGTGG + Intronic
1021767499 7:23964503-23964525 GCCACCAGTACCTCAGAATGTGG - Intergenic
1022266745 7:28763682-28763704 ATCACCAAAACCTCAGAATAAGG - Intronic
1022472038 7:30688042-30688064 ACTCCCAGTACCTCAGAATGTGG + Intronic
1022796064 7:33732168-33732190 AACAGCAGTACTTCTTAATGAGG - Intergenic
1022960688 7:35423511-35423533 ACCCCCAGTACCTCAGAATATGG - Intergenic
1023157543 7:37265938-37265960 AGCCCCAGAACTTCAGCATGTGG - Intronic
1023986170 7:45097869-45097891 ATCACCAGTGTTGGAGAATGGGG - Intergenic
1024518128 7:50278332-50278354 ATCCCCAGGACTTCAGAGTAAGG - Intergenic
1026608774 7:71838702-71838724 ATCACCAGAACTGCAGAATGGGG - Intronic
1028889940 7:95975611-95975633 AACCCCAGTACCTCAGAATGTGG - Intronic
1029188280 7:98754853-98754875 ACCCCCAGTACTTCAGAATGTGG - Intergenic
1029193843 7:98790539-98790561 CACCCCAGTACTTGAGAATGTGG - Intergenic
1029353224 7:100030281-100030303 ATCCCCATTCCTCCAGAATGAGG - Exonic
1029941605 7:104486474-104486496 ATCACCAGTAAACCAGAAAGTGG - Intronic
1030085350 7:105811078-105811100 ATCCCCAATACTTGTGAATGTGG + Intronic
1031115639 7:117665185-117665207 ATCACCAGTACTTCTTTATTTGG - Intronic
1031865917 7:127039177-127039199 ACCTCCAGTAGCTCAGAATGTGG + Intronic
1032428698 7:131843092-131843114 ATAACATGAACTTCAGAATGTGG - Intergenic
1034937065 7:155207046-155207068 ACCCCCAGGACCTCAGAATGTGG - Intergenic
1035005279 7:155653324-155653346 TCCACCAGAACCTCAGAATGTGG - Intronic
1035086050 7:156258821-156258843 ACCCTCAGTACCTCAGAATGTGG - Intergenic
1036161103 8:6389162-6389184 ACTCCCAGTACCTCAGAATGTGG + Intergenic
1036718312 8:11147857-11147879 ATTCCCAGTATCTCAGAATGTGG + Intronic
1036813353 8:11883070-11883092 AGCCCCAGTCCCTCAGAATGTGG - Intergenic
1036970231 8:13347300-13347322 ATCACCATTATTACTGAATGTGG - Intronic
1037160627 8:15767676-15767698 AACACCATTTCTTAAGAATGAGG - Intergenic
1038270205 8:26068776-26068798 ATCCCTAGTATCTCAGAATGTGG + Intergenic
1038649080 8:29386022-29386044 TGCACCAGGACTTCAGAATTTGG + Intergenic
1039462218 8:37754675-37754697 AGCACCAGTACTTCCTTATGAGG - Exonic
1040698586 8:50033804-50033826 ACCCCCAATACCTCAGAATGTGG - Intronic
1040978098 8:53216078-53216100 ACCCCCAGCACCTCAGAATGTGG - Intergenic
1042161559 8:65901927-65901949 ATCTCAAGTAGTTCAGAATTGGG + Intergenic
1042705683 8:71663911-71663933 ACCCCCAGTACCTTAGAATGTGG - Intergenic
1042874137 8:73425157-73425179 ACCCCCAGTATCTCAGAATGGGG + Intronic
1042877092 8:73449478-73449500 ACCCCCAGTACCTCAGAATGTGG - Intronic
1043376544 8:79656070-79656092 ATCATCAGAACTTCAGGATAAGG - Intronic
1044250505 8:90000137-90000159 ACCCCCAGTATGTCAGAATGTGG + Intronic
1044297851 8:90549082-90549104 TTCTCCAGCACTTCAGAATGTGG + Intergenic
1045294455 8:100861347-100861369 ACCTCCAGTAGCTCAGAATGTGG - Intergenic
1045748316 8:105451433-105451455 ACCTTCAGTACCTCAGAATGTGG + Intronic
1046204027 8:110965762-110965784 ATCTCTAGTGCTTCAGAATGTGG + Intergenic
1047908018 8:129493673-129493695 ATCACCAACACTTCAGACTATGG + Intergenic
1049487123 8:142871878-142871900 ATGAACAGAACTCCAGAATGTGG - Intronic
1050874417 9:10616346-10616368 AACACCATTACTGCAGACTGAGG - Intergenic
1051533101 9:18127328-18127350 ATGACCATTACATCAGAAAGTGG - Intergenic
1051909680 9:22138997-22139019 ATCCCCAGTAGCTCAGAATGTGG + Intergenic
1053196256 9:36121358-36121380 ATCTCCAGTCCATCACAATGGGG - Intronic
1053578078 9:39372940-39372962 ACCTCTAGTACCTCAGAATGGGG - Intergenic
1053792475 9:41696691-41696713 ATCACCAGTTCTTCACAAATCGG + Intergenic
1053842605 9:42200995-42201017 ACCTCTAGTACCTCAGAATGGGG - Intergenic
1054099662 9:60931726-60931748 ACCTCTAGTACCTCAGAATGGGG - Intergenic
1054121059 9:61207350-61207372 ACCTCTAGTACCTCAGAATGGGG - Intergenic
1054152699 9:61618129-61618151 ATCACCAGTTCTTCACAAATCGG - Intergenic
1054180885 9:61908712-61908734 ATCACCAGTTCTTCACAAATCGG + Intergenic
1054472478 9:65549277-65549299 ATCACCAGTTCTTCACAAATTGG - Intergenic
1054586680 9:66975158-66975180 ACCTCTAGTACCTCAGAATGGGG + Intergenic
1054656706 9:67672430-67672452 ATCACCAGTTCTTCACAAATCGG - Intergenic
1055417154 9:76095998-76096020 ATCAGCAGCACTGCAGAAAGCGG + Exonic
1055814750 9:80191637-80191659 ATCCCCAAGACATCAGAATGTGG + Intergenic
1056395138 9:86175075-86175097 ATCACCAGTACTTAAAACAGGGG + Intergenic
1056805369 9:89724789-89724811 GTCCCCAGTACCTCAGACTGTGG + Intergenic
1057457022 9:95223517-95223539 ACCCCCAATACCTCAGAATGTGG - Intronic
1057891841 9:98875519-98875541 ACCCACAGTACCTCAGAATGTGG - Intergenic
1059034301 9:110736890-110736912 ATGACCAGTAATTCATTATGTGG + Intronic
1059627327 9:116081091-116081113 CATCCCAGTACTTCAGAATGGGG - Intergenic
1059711226 9:116869297-116869319 TTCACCAGAAATTCAGAACGTGG - Intronic
1059754943 9:117284058-117284080 ACCCTCAGTACTTCAGAATGTGG + Intronic
1060112680 9:120917908-120917930 ACCACCAGTATCTCAGAATATGG + Intronic
1060309172 9:122444056-122444078 ACCCCTAGTACCTCAGAATGTGG - Intergenic
1060394959 9:123309531-123309553 AACACCAGTATCTCGGAATGTGG + Intergenic
1061247782 9:129409911-129409933 AACTCCAGTCCCTCAGAATGCGG + Intergenic
1061723439 9:132567976-132567998 ACCCCCAGAACTTGAGAATGTGG - Intronic
1185943322 X:4345982-4346004 ACAACCAGGACCTCAGAATGTGG + Intergenic
1186062360 X:5723160-5723182 GTCAACATCACTTCAGAATGAGG - Intergenic
1186745785 X:12567135-12567157 ATCACCAGTGGTTCAGAATATGG - Intronic
1186865598 X:13717822-13717844 AGCAACAGTACCTCAGAATGTGG + Intronic
1188262668 X:28038028-28038050 ATCACCAGAACTTTAGCAGGAGG + Intergenic
1188934427 X:36155818-36155840 GTCACCAGTACTCCAAATTGAGG - Intergenic
1189016701 X:37292361-37292383 ATCCCCAGAACCTCAGAATGTGG + Intergenic
1189378845 X:40487205-40487227 ATCCCCAGGACCTCAGAATGTGG - Intergenic
1193993105 X:88333201-88333223 AACCCCAGTACCTCAGAATGTGG + Intergenic
1194741127 X:97575505-97575527 AGCTCCAGTACAGCAGAATGAGG - Intronic
1195536171 X:106011759-106011781 ATCACAAGAACTGCAGAATGGGG - Intergenic
1196352914 X:114754157-114754179 AACCCCAGTACCTCAGAATGTGG - Intronic
1196517088 X:116626887-116626909 GTCACCAGTGCTTCACATTGAGG + Intergenic
1196641020 X:118061021-118061043 CCCACCAGTATCTCAGAATGTGG - Intronic
1197311200 X:124907823-124907845 ATCTACTATACTTCAGAATGAGG - Intronic
1198326188 X:135576004-135576026 ATCCCCAGTGCTACAAAATGAGG - Intronic
1199532905 X:148869973-148869995 ACCCCCAGTATTTCAGAATGTGG - Intronic
1199990026 X:152982353-152982375 AACTCCAGTACCTCAGAATGTGG - Intergenic