ID: 971291094

View in Genome Browser
Species Human (GRCh38)
Location 4:25340363-25340385
Sequence GACTGTGTAAGAGTGGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971291094_971291097 -2 Left 971291094 4:25340363-25340385 CCCTATGCCACTCTTACACAGTC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 971291097 4:25340384-25340406 TCATGATTACTGTTGCTGTATGG 0: 1
1: 0
2: 2
3: 24
4: 215
971291094_971291099 15 Left 971291094 4:25340363-25340385 CCCTATGCCACTCTTACACAGTC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 971291099 4:25340401-25340423 GTATGGTAAATTTTGAAAATGGG 0: 1
1: 0
2: 3
3: 45
4: 515
971291094_971291098 14 Left 971291094 4:25340363-25340385 CCCTATGCCACTCTTACACAGTC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 971291098 4:25340400-25340422 TGTATGGTAAATTTTGAAAATGG 0: 1
1: 0
2: 3
3: 72
4: 816

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971291094 Original CRISPR GACTGTGTAAGAGTGGCATA GGG (reversed) Intronic
903403333 1:23074895-23074917 GACAGTATGATAGTGGCATATGG - Intronic
905047700 1:35020869-35020891 GACTGTTTAAGAGATGAATAGGG - Intronic
905971633 1:42146170-42146192 GTGTGTGTGTGAGTGGCATATGG - Intergenic
911056289 1:93711167-93711189 GTCTGTGTAACAATGGCACATGG - Intronic
913142938 1:115959833-115959855 GGCTGTGTAAGTCTAGCATATGG - Intergenic
913395712 1:118369533-118369555 GACTGTGTGTTACTGGCATAAGG - Intergenic
916709019 1:167385442-167385464 GACAGTGTAATACTGGCATATGG + Intronic
918401430 1:184166172-184166194 GAATCAGTAAGAGAGGCATATGG + Intergenic
918792426 1:188846626-188846648 GAGTGTGTGAGTGTGGGATATGG + Intergenic
919567695 1:199209530-199209552 GACTGGGCAAGAGGGGAATATGG - Intergenic
920527803 1:206680960-206680982 GGCTGTGTAAGAGTAGGATAAGG + Intronic
921196004 1:212758908-212758930 GACAGTGTAGTAGTGGCCTAAGG + Intronic
921341071 1:214135286-214135308 GACTGTGTGATATTGGCAGAGGG - Intergenic
924711073 1:246530531-246530553 GACTATGTAACAGTTGCATTTGG - Intergenic
1064234874 10:13564607-13564629 GTCTGTGTAAGAGTTGAAGAAGG + Intergenic
1064800418 10:19064341-19064363 GAATGTGGATGTGTGGCATATGG + Intronic
1065436017 10:25704588-25704610 GACAGTGTAAGACTGGCATCTGG - Intergenic
1067047647 10:42993569-42993591 AACAGTGTAAAACTGGCATAGGG + Intergenic
1067253011 10:44605020-44605042 GACAGTGTGATACTGGCATAAGG - Intergenic
1067778682 10:49181485-49181507 GACTGTGTGGGATTGGCAGAAGG + Intronic
1070623143 10:78029337-78029359 GACGGAGTAAGAGTGGCCAAAGG - Intronic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1072981829 10:100104864-100104886 AACTGTGTGATATTGGCATAAGG - Intergenic
1073043404 10:100622245-100622267 GACTGTGCCAGGGTGGCATTGGG + Intergenic
1073389323 10:103160020-103160042 GACTGTGTGCTACTGGCATAAGG + Intronic
1075433023 10:122405806-122405828 GACTCTGCAAGGCTGGCATAGGG + Intronic
1078987609 11:16610698-16610720 GGCTGTGTAAGAGTGACACGTGG + Intronic
1079127527 11:17729345-17729367 GACTGTGTGGTATTGGCATAAGG - Intergenic
1080669628 11:34364051-34364073 GCCTGTGTAAGACTGGAAAAAGG - Intergenic
1081943131 11:46962302-46962324 GACTGTGTGGTACTGGCATAAGG - Intronic
1082121503 11:48384483-48384505 GACTATGTAATAGTTGCATTTGG + Intergenic
1088025507 11:105176865-105176887 GATTGTGTATTATTGGCATAGGG - Intergenic
1089592272 11:119550527-119550549 TACAGTGGAAGAGTTGCATAAGG - Intergenic
1089892848 11:121898602-121898624 GACTGTGTCAAAGTGGCACTGGG + Intergenic
1092667368 12:10817390-10817412 GACTGTGTTTTATTGGCATAAGG + Intergenic
1092851243 12:12628987-12629009 GACAGTGTAATACTGGCACAAGG - Intronic
1094652488 12:32391309-32391331 GATTGTGTCAGATTGGGATAGGG + Intergenic
1095334793 12:41011694-41011716 GACTATGTAACAGTTGCATTTGG + Intronic
1096237000 12:49936017-49936039 GACTGTGTGTAACTGGCATAAGG - Intergenic
1099864818 12:88266473-88266495 GTCAGTGTAAGCCTGGCATAAGG - Intergenic
1100271724 12:93031897-93031919 GACAGTGTGGTAGTGGCATAAGG - Intergenic
1101026792 12:100615855-100615877 GACAGTGTATCACTGGCATAGGG - Intronic
1103630692 12:122257830-122257852 GACAGTGTAGTACTGGCATAAGG + Intronic
1104723894 12:131063635-131063657 GACTGTGTGGGACTGGCACAGGG - Intronic
1107248818 13:38331890-38331912 GACAGTGTATCACTGGCATAGGG + Intergenic
1107560877 13:41556110-41556132 GACTGTATAGTAGTGGCATAAGG + Intergenic
1108050431 13:46430335-46430357 GGCTGCGTAAGAGTGGCCTTGGG - Intronic
1108371224 13:49770942-49770964 GACTGTGTGATACTGGCATAAGG - Intronic
1109117899 13:58412499-58412521 GACTGTGTGATATTTGCATAAGG + Intergenic
1109199250 13:59412235-59412257 CACTGTGTAAGAGTTGGTTAAGG - Intergenic
1109543007 13:63803959-63803981 GGCTGCGTAAGAGTGGCCTTGGG - Intergenic
1115808992 14:37084814-37084836 GATTGTGTAGTACTGGCATAAGG + Intronic
1116103940 14:40475739-40475761 GACTTTGTAACAGTTGCATTTGG + Intergenic
1116487396 14:45467096-45467118 GAGTGTATAAGATTGGCAAAGGG + Intergenic
1116911869 14:50475790-50475812 GAATGTGTAAGAGTAACATCTGG - Intronic
1118853137 14:69600236-69600258 GACTGTGTAAGTGTGGTCTTTGG + Intergenic
1119283645 14:73432307-73432329 GACAGTGTAATATTGACATAGGG + Intronic
1119371322 14:74146801-74146823 GACAGTGCAGTAGTGGCATAAGG + Intronic
1120792081 14:88593499-88593521 GACTGTGTGGTACTGGCATAAGG + Intronic
1130311411 15:82758783-82758805 TACTGTGTAGGAGTGGAACAGGG + Exonic
1132407636 15:101553731-101553753 GACTGTGGACGAGAGGCACAGGG - Intergenic
1133397883 16:5462805-5462827 GGCGATGTAAGAGTGGCATTCGG + Intergenic
1137468241 16:48730700-48730722 CACTGTGCAAGAGCTGCATAAGG - Intergenic
1140097627 16:71888640-71888662 GACTGTATGATAGTGGCATAAGG - Intronic
1142678711 17:1532702-1532724 GACTGTGTAAGAGAAGCCTGAGG - Intronic
1143993615 17:10988132-10988154 GACTGTGTAGAAGAGGAATAAGG - Intergenic
1148263589 17:46206299-46206321 GACAGTGTGGTAGTGGCATAAGG + Intronic
1150096093 17:62376974-62376996 CAGTGTCTAAGAATGGCATAGGG + Intronic
1153881198 18:9423066-9423088 GAATGAGTCAGGGTGGCATAGGG + Intergenic
1155957483 18:31966083-31966105 GAATGAGGAAGACTGGCATAGGG - Intergenic
1157966224 18:52211346-52211368 GATTGTTTAAAAGTGGCACATGG + Intergenic
1159966967 18:74604406-74604428 GACTGTTCAAGTGTGGCCTATGG - Intronic
1163208815 19:15824852-15824874 GACTTCGTAAATGTGGCATAAGG - Intergenic
925733426 2:6939921-6939943 GATAGTGTAATAGTGACATAAGG - Intronic
926308873 2:11660026-11660048 GACTGAGTGAGTGTGGCAGAAGG - Exonic
926453733 2:13039397-13039419 GACAGTGTAGCAGTGGCATCAGG - Intergenic
927248429 2:20977004-20977026 TAGTGTGAAAGTGTGGCATATGG + Intergenic
930419997 2:51139085-51139107 GAATGTGTAATATTGGCATGAGG + Intergenic
931047259 2:58369253-58369275 AACTGTGGAAGAGGGGCACAAGG - Intergenic
931583755 2:63805419-63805441 GACAGAGTATGAGTGGGATAGGG - Intronic
932943153 2:76193864-76193886 AACTGAGTAAGTGTGGGATATGG + Intergenic
932998218 2:76883627-76883649 GTCAGGGGAAGAGTGGCATATGG - Intronic
934045275 2:88168706-88168728 GCCCGTGTAAGTGTGGCAGAGGG + Intergenic
935631932 2:105219198-105219220 AACAGTGTAAGTGTGACATAGGG + Intergenic
940990153 2:160088186-160088208 GACTATGTAACAGTTGCATTTGG + Intergenic
941209624 2:162621286-162621308 GAATATGTAAGAGTGACCTATGG + Intronic
944245561 2:197526866-197526888 CACTGTGTGATACTGGCATAAGG - Intronic
947126156 2:226870490-226870512 TAGTGTTTAAGAGTGGCTTATGG - Intronic
1169246668 20:4031048-4031070 GACTGTGCAATATTGGCAAAGGG - Intergenic
1169645674 20:7806934-7806956 GACTGTGAAAAAGTGGGCTAGGG - Intergenic
1173064556 20:39698073-39698095 GAATGGGAAAGAGTGGCAAAGGG + Intergenic
1175875967 20:62229993-62230015 GAGTGTGTGAGTGTGGAATAGGG - Intergenic
1176056069 20:63149972-63149994 AAGTGTGTAAGAGGGGCACAGGG + Intergenic
1176234118 20:64046297-64046319 GACAGTGTGTGTGTGGCATATGG - Intronic
1179378512 21:40876359-40876381 GACAGTGTAATATTGGCATCAGG + Intergenic
950338186 3:12217035-12217057 GACTGTGTGGTATTGGCATATGG + Intergenic
950951633 3:17006255-17006277 AAATGAGTAAGAGTGGGATAAGG + Intronic
951858117 3:27220793-27220815 CACTGTGTGAGACTGGCATAAGG + Intronic
951932086 3:27979392-27979414 GACTGTGTAATATTGGCAGAGGG - Intergenic
952276676 3:31883822-31883844 CTTTGTGTAAGAGTGGCATGTGG - Intronic
952927110 3:38328441-38328463 GAGTGTGAAGGAGTGGCCTAGGG - Intergenic
957326867 3:78706835-78706857 GACTGATTAAGAGTGAGATATGG + Intronic
958071463 3:88619156-88619178 GACTGTGTATTAGTGGCCCAAGG - Intergenic
958945151 3:100354175-100354197 GACTGGGTAGAAGTGGCATGGGG - Intronic
959207719 3:103333209-103333231 GACAGTGTAATACTGGAATAAGG - Intergenic
960544625 3:118899535-118899557 GACTATGAAAGGGTAGCATAAGG + Intergenic
960634815 3:119774052-119774074 GACAGTGTGATATTGGCATAAGG + Intergenic
961108155 3:124259902-124259924 GAGTGTGTAAGAGTAGAAGAAGG - Intronic
961915655 3:130371446-130371468 GACTATGTGATACTGGCATAAGG + Intronic
962831788 3:139148355-139148377 GACTGTGTAGTACTGGCACAAGG + Intronic
964725624 3:159811652-159811674 GACTGTGTGGTACTGGCATAAGG - Intronic
967794656 3:193586725-193586747 GACTGTGTGGTATTGGCATAAGG - Intronic
967856402 3:194120955-194120977 GGTTGTGTAAGACTGACATAAGG + Intergenic
968024867 3:195432556-195432578 GACGGTGTAGTACTGGCATAAGG - Intronic
971291094 4:25340363-25340385 GACTGTGTAAGAGTGGCATAGGG - Intronic
974360931 4:60878155-60878177 GACAGTGTGATATTGGCATAAGG + Intergenic
975365846 4:73526786-73526808 GACTCCTTAAGAGTGGCCTAAGG - Intergenic
979084268 4:116386773-116386795 GTCAGTGTAAGAGTGTCAGAAGG + Intergenic
981728988 4:147877726-147877748 GACTTAGTAAGAGTGGAAAAGGG + Intronic
982107907 4:152026608-152026630 GAGTGTGTCATACTGGCATAAGG + Intergenic
984365636 4:178795809-178795831 GATGCTGTAAGGGTGGCATATGG - Intergenic
987225805 5:15840281-15840303 GACTGTGTGATATTGGCAGAGGG - Intronic
989757094 5:44968433-44968455 GACTGTGTAAAAAATGCATAAGG + Intergenic
994528628 5:100936784-100936806 GACTGTGTAAGAGCATCACATGG + Intergenic
995417561 5:111927039-111927061 GACTATGTAATAGTTGCATCTGG + Intronic
995606631 5:113863669-113863691 GAATGTGTAAGTGTGGAATTTGG + Intergenic
997564546 5:134876877-134876899 GCCTAGGGAAGAGTGGCATAGGG - Intronic
997752862 5:136365532-136365554 ATCTGTGTGAGAGTGGCATGCGG + Exonic
1001158648 5:169294855-169294877 GATTGTGTCACAGTGGCTTACGG - Intronic
1002203789 5:177548646-177548668 GACTCTGTAAGTCTGGGATAGGG + Intronic
1003189296 6:3859663-3859685 GACAGTGTAGTTGTGGCATAAGG - Intergenic
1003526342 6:6900977-6900999 TACTATGTAAGACTGGCATTGGG - Intergenic
1004622095 6:17339946-17339968 GAGTAAATAAGAGTGGCATAAGG - Intergenic
1007009561 6:38402457-38402479 GATAGTGTAACACTGGCATAAGG + Intronic
1007058234 6:38910332-38910354 CACTGTGTAAGATTGACAAATGG + Intronic
1008016263 6:46523438-46523460 CAGTGTATAAGTGTGGCATAGGG + Intergenic
1008550984 6:52630324-52630346 GACTGTGTGGTACTGGCATAAGG + Intergenic
1010964171 6:82184072-82184094 GATTGTGTGATACTGGCATAAGG + Intronic
1012367740 6:98463152-98463174 GACTGTGGCACAGTGGCATGCGG - Intergenic
1013145130 6:107382474-107382496 GACAGTATAATAATGGCATAAGG + Intronic
1014646965 6:123985736-123985758 GAGGGTGCAAGAGTTGCATATGG + Intronic
1014723199 6:124943830-124943852 GACAGTGTGATACTGGCATAAGG - Intergenic
1020214036 7:6175504-6175526 GACATTGTAAGACTGGCATAAGG - Intronic
1022102667 7:27177851-27177873 GACTGTGTAACCGCTGCATAAGG - Intronic
1023420437 7:39973951-39973973 GACTGTGTGGTACTGGCATACGG - Intronic
1023976213 7:45032082-45032104 GAATGGGTAGGAGTGGCAGAGGG + Intronic
1024493656 7:50016723-50016745 GACTGTTTAAGACTGGTAGAGGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1040397462 8:47013244-47013266 GACTATGTAATAGTTGCATTTGG + Intergenic
1040534175 8:48292274-48292296 GACTGTGTAGTATTGGCAGAGGG - Intergenic
1044437994 8:92188459-92188481 GACTGTTTAAGAGGGGTCTAGGG + Intergenic
1044594531 8:93945542-93945564 GACTGTGTGATACTGGCATATGG + Intergenic
1045399516 8:101798780-101798802 GACTGTGGGATACTGGCATAGGG + Intronic
1050903949 9:10980315-10980337 GACAGTGTAATATTGGAATAAGG - Intergenic
1051053179 9:12954599-12954621 GACTGTAAACGAGTGACATAAGG - Intergenic
1052776956 9:32741906-32741928 TACTGTGTGAGATTGGCATTTGG + Intergenic
1053342325 9:37348025-37348047 GACAGTGTAAGAGTGGCTGTGGG - Intronic
1053439153 9:38101394-38101416 GACTGTTTGATACTGGCATAAGG + Intergenic
1055888041 9:81088504-81088526 GATTGTGTGATACTGGCATAAGG - Intergenic
1057759547 9:97861229-97861251 GGCTGTGGAAGCGTGGCATGGGG - Intergenic
1057762486 9:97888091-97888113 GACAGTGTAAGAGTGACAAGAGG - Intergenic
1059370895 9:113833932-113833954 GACAGTGTGGTAGTGGCATAAGG + Intergenic
1061597841 9:131643856-131643878 GACTGTGTAAGACTGGTCCAGGG + Intronic
1186293665 X:8125630-8125652 AACTGTGTGAGATTGGAATATGG + Intergenic
1186559008 X:10590418-10590440 CACTGTGGAAGAGTGGCACAGGG - Intronic
1187530176 X:20089323-20089345 GACAGTGTGATACTGGCATAAGG - Intronic
1187750514 X:22458912-22458934 GACAGTATAATACTGGCATAAGG + Intergenic
1189061771 X:37761293-37761315 GAGTGGATAAGAGTGACATAAGG - Intronic
1192436486 X:71146434-71146456 GACTGTGTAACTGTGTCAGAAGG + Intronic
1194652141 X:96528488-96528510 GACAGTGTGGTAGTGGCATAAGG + Intergenic
1194817406 X:98460630-98460652 GACTGTGTGGGATCGGCATAAGG - Intergenic
1195058524 X:101171124-101171146 GACAGTGTGATACTGGCATAAGG + Intergenic
1197356131 X:125438922-125438944 GACTTTGTAACAGTTGCATTTGG + Intergenic
1199237596 X:145509013-145509035 GACTGTGTAAGAGAGTAATCAGG + Intergenic