ID: 971293290

View in Genome Browser
Species Human (GRCh38)
Location 4:25365224-25365246
Sequence CTGAATGTTGCATGCTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971293290_971293293 26 Left 971293290 4:25365224-25365246 CCACAAAAGCATGCAACATTCAG 0: 1
1: 0
2: 1
3: 10
4: 193
Right 971293293 4:25365273-25365295 TCACTTTCACTATTAAGTACTGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971293290 Original CRISPR CTGAATGTTGCATGCTTTTG TGG (reversed) Intronic
908405617 1:63811500-63811522 CAAAATGTTGCAAGCTTCTGTGG + Intronic
908761412 1:67515635-67515657 CTGAAGATTGCATGCTTTCTTGG + Intergenic
910308172 1:85790871-85790893 CTGACTGTTGCATTCCTGTGAGG - Intronic
911048448 1:93648970-93648992 CTGACTGTTCCCTGCTTTAGAGG + Intronic
912008167 1:104929887-104929909 CTGAACGTGTCATGCTTTGGGGG - Intergenic
913508923 1:119545082-119545104 CTGAGTGTTGTATTCTTCTGTGG - Intergenic
914248275 1:145901636-145901658 CTGTTTCTTCCATGCTTTTGCGG - Exonic
914889997 1:151613199-151613221 CTGACCCTTGCATGCCTTTGGGG + Intronic
915905764 1:159875828-159875850 GTGACTGTTGACTGCTTTTGGGG + Intronic
916235956 1:162588621-162588643 CTGAATGTTGTAAGATTTTCTGG + Intronic
917100664 1:171442043-171442065 CAGATTGATGCATGCATTTGCGG - Intergenic
918653624 1:186997272-186997294 CTGAGGTTTGCATTCTTTTGAGG + Intergenic
920329453 1:205195146-205195168 TTGAATTTTCCATGCTTTTATGG + Intronic
920804998 1:209224639-209224661 GTAAATATTGCAGGCTTTTGGGG + Intergenic
921356082 1:214285607-214285629 CTGAATTTTGCATTCTTTAATGG - Intronic
921687713 1:218109142-218109164 CTAAATGTTGCATCCTTTCTGGG - Intergenic
922147867 1:222966633-222966655 CTGAATGTTGATTGCCTCTGGGG + Intronic
923692432 1:236207882-236207904 CTGTGTGTAGCATGGTTTTGTGG + Intronic
924819060 1:247470714-247470736 CTGATTCTTGCATGCTGTTATGG - Intergenic
1064233774 10:13554442-13554464 AATACTGTTGCATGCTTTTGTGG - Intergenic
1064597311 10:16958966-16958988 TTGAATGGTGCATCCTCTTGTGG + Intronic
1064945476 10:20783304-20783326 CAAGATGTTGCATGCTCTTGAGG - Exonic
1065498628 10:26355828-26355850 CTGAATGCTGCATTCTGTGGAGG + Intergenic
1069283037 10:66679283-66679305 ATGAATGATGAATGATTTTGAGG + Intronic
1070448322 10:76530886-76530908 CAGAATGTGCCATGCTTCTGGGG + Intronic
1071154985 10:82677858-82677880 TTGTATGTTGCATGATTTGGTGG + Intronic
1075390754 10:122089531-122089553 CTCAAGGTTTCATCCTTTTGGGG + Intronic
1075950156 10:126470185-126470207 CTGCATGTTGCATGCTGCAGAGG + Intronic
1079701287 11:23551768-23551790 CTGATTGTTGCTTCCTTTGGAGG - Intergenic
1083407857 11:62471241-62471263 CTGTATGTTGCAGGATGTTGAGG + Intronic
1088535612 11:110857587-110857609 CAGAACTTTGCATGCTTTAGTGG - Intergenic
1089853203 11:121518076-121518098 CTAGATGTTGGATGCTTTGGAGG + Intronic
1089855269 11:121538054-121538076 CTGCATGTTTCAGGCTATTGGGG - Intronic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1093670208 12:21865242-21865264 CAAAATGTTGTATGTTTTTGTGG + Intronic
1094084876 12:26578539-26578561 CTGAATGTTGCATACTTTTTGGG - Intronic
1096189407 12:49605536-49605558 CACAATGTTGCCTGCTTTGGAGG + Exonic
1099906699 12:88779610-88779632 CTGAAAATTTCATTCTTTTGGGG + Intergenic
1100310309 12:93388912-93388934 TTGAACCTTTCATGCTTTTGAGG - Intronic
1104233505 12:126908538-126908560 ATGAATGGTGAGTGCTTTTGAGG - Intergenic
1104442448 12:128805152-128805174 ATGAATGTTGGATTTTTTTGGGG - Intronic
1105717503 13:23081929-23081951 CTGTTTGTTGCAGGCTTTTCTGG + Intergenic
1108336794 13:49451550-49451572 CAGAATGTTTCATCCATTTGTGG + Exonic
1108672328 13:52704404-52704426 TTGAATTTTACATGTTTTTGTGG - Intronic
1109919631 13:69039085-69039107 CTGAATATTGCATGATACTGAGG - Intergenic
1113743689 13:112728054-112728076 GTGAATGTTGTAGGCTTATGGGG + Intronic
1116944596 14:50824653-50824675 CTGACTGTAGTATGCATTTGGGG - Intronic
1117297235 14:54391588-54391610 CTGAATGTTAGTTGCTTTTGTGG + Intergenic
1117741215 14:58820900-58820922 CTGAAAATTGCTTGCTGTTGGGG + Intergenic
1119630560 14:76228283-76228305 TTGAATGTTGGATTCCTTTGGGG + Intronic
1119821813 14:77622818-77622840 CTGAATGTTGCAATCATTTCAGG + Intergenic
1120433577 14:84450684-84450706 CTGAATTTTGTGTGCTTTTTAGG + Intergenic
1123912786 15:24985490-24985512 CTAATTTTTGTATGCTTTTGTGG + Intergenic
1124960916 15:34393926-34393948 CAGGATTTTGCAAGCTTTTGTGG - Intronic
1124977546 15:34540147-34540169 CAGGATTTTGCAAGCTTTTGTGG - Intronic
1126652177 15:50935567-50935589 TTGAATTTTGCATGCTCTGGAGG + Intronic
1127035122 15:54907614-54907636 CTGAGAGTTGCATTCTTATGAGG - Intergenic
1127674232 15:61225616-61225638 CTGAAGGTTGAAGGCTTTTAGGG - Intronic
1127777661 15:62279453-62279475 CAGGATTTTGCAAGCTTTTGTGG - Intergenic
1130393423 15:83479691-83479713 CTGAAGGTTGCAGGTGTTTGTGG + Intronic
1132659747 16:1056000-1056022 CTGAGGGTTGCCTGCTTTGGGGG + Intergenic
1134773167 16:16828600-16828622 TTGAATGTTGCATTGTTTTGTGG + Intergenic
1137730404 16:50685471-50685493 CTCAATGTAGAATGCTTTGGTGG - Intergenic
1139019989 16:62736761-62736783 AAGAATGTTGCTTGCTTTTTGGG + Intergenic
1139320776 16:66112042-66112064 CTTATTGTTGCATCCTTTGGAGG - Intergenic
1140798797 16:78465595-78465617 CTGAATTTAACATGCTTTTCAGG + Intronic
1143723081 17:8827278-8827300 CTGGATGCTGCAGGCTTCTGGGG + Exonic
1144007360 17:11113273-11113295 CTGAATGGCGGATGCTCTTGGGG + Intergenic
1144096155 17:11902506-11902528 CTAAATCTTGCATGTTATTGGGG + Intronic
1144470862 17:15539790-15539812 CTGTATGTTGTATGGTTTTAGGG - Intronic
1144925607 17:18804887-18804909 CTGTATGTTGTATGGTTTTAGGG + Intronic
1155799763 18:30086853-30086875 CTGAATATTGCAGGCTTTGATGG - Intergenic
1157139014 18:45086749-45086771 CAGAAAGTGGCAGGCTTTTGAGG - Intergenic
1157526355 18:48385607-48385629 CTGAATGGTGCATGCGTTCCGGG - Intronic
1158142723 18:54272424-54272446 ATGAATGCTCCATGTTTTTGGGG + Intronic
1158152502 18:54388400-54388422 CTTAATGCTGCATTCTTTGGAGG + Intergenic
1159795410 18:72837195-72837217 CAGAATGTGGCATTCATTTGGGG + Intronic
1161611461 19:5245452-5245474 CTAAATGTTTCATTTTTTTGTGG + Intronic
1162391153 19:10390939-10390961 CTGAAGGTTGGGGGCTTTTGAGG + Intergenic
1166165397 19:40984250-40984272 CAAAATGGTCCATGCTTTTGTGG - Intergenic
1166572565 19:43807218-43807240 TTGAATGTTGCACGCTCTTGTGG + Intronic
1167785304 19:51630738-51630760 CAGAATGTTTCATGGTTTTTAGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926836417 2:17028458-17028480 CTGAATTCTGGATGATTTTGAGG - Intergenic
927119472 2:19942169-19942191 CTGAATATTACATGCTATTAGGG - Intronic
930418461 2:51119454-51119476 CTGCCTGTTGTATGCTCTTGTGG + Intergenic
932374651 2:71225386-71225408 CAGGATTTTGCAAGCTTTTGTGG - Intronic
934911641 2:98262343-98262365 CTGAATTTGGCAAGCTTTTTTGG - Intronic
939323606 2:140656841-140656863 CTCAAATTTACATGCTTTTGTGG - Intronic
939504946 2:143033656-143033678 CTAAATATTGCATGCTTATTTGG - Intronic
940138747 2:150469657-150469679 CTGAATGGTGCTTGCATTTTTGG - Exonic
942008501 2:171734332-171734354 CTGATTGATACTTGCTTTTGTGG + Intronic
943670078 2:190650096-190650118 CTGAATGTTGCAGGATCTCGGGG + Intronic
944903116 2:204235988-204236010 CTGAATGTTGGTTTCCTTTGAGG - Intergenic
945817176 2:214619857-214619879 CTTAATTTTTCATGCTTTTATGG + Intergenic
946653732 2:221921926-221921948 CTGAATATTAGATGCTTTTTGGG - Intergenic
1169678810 20:8186181-8186203 TTTAATGTTGCATTATTTTGTGG + Intronic
1170903981 20:20494966-20494988 CTGAATTATGCATGCTTTATAGG - Intronic
1171335233 20:24379581-24379603 CTGAATGTTAAGTGCTTTAGAGG + Intergenic
1171386732 20:24774576-24774598 CTGCACAGTGCATGCTTTTGGGG + Intergenic
1173201002 20:40955113-40955135 CTGACTGATGCATGGTTTTCTGG - Intergenic
1174285499 20:49469840-49469862 CTGAATATTGGATGATATTGAGG - Intronic
1179118085 21:38513336-38513358 CTGAATATTCCCTGTTTTTGGGG - Intronic
1183030330 22:35099049-35099071 CTGAAGCTTGCATGCTATAGGGG - Intergenic
1184096499 22:42319065-42319087 CTGAATGTTCCCTGCATGTGGGG - Intronic
949422846 3:3884594-3884616 TTGAATGCTGCATCCTTTGGAGG - Intronic
949636254 3:5984609-5984631 TTGAATGCTGCATACTTTGGAGG + Intergenic
951823957 3:26846350-26846372 CTTAATGGTGCATTCTTCTGTGG + Intergenic
951965945 3:28385073-28385095 TTGAATTTCTCATGCTTTTGGGG + Intronic
954804023 3:53204918-53204940 CTGATTATTGCATGCATCTGAGG + Intergenic
955620365 3:60856837-60856859 CAGGATGTTACATGGTTTTGAGG - Intronic
957348377 3:78991474-78991496 CTGATTTTTGCCTGCATTTGGGG - Intronic
960358436 3:116680670-116680692 TTGAATGCTGCATTCTTTAGAGG - Intronic
961230498 3:125303281-125303303 CTGAATCTTGATTGCTTTGGTGG + Intronic
963054219 3:141171568-141171590 CTTTATGTTTCATGCTTTTCTGG - Intergenic
963287603 3:143448509-143448531 ATGATAATTGCATGCTTTTGAGG - Intronic
964159634 3:153631304-153631326 GTGAATTATGCATGCCTTTGTGG - Intergenic
964493718 3:157265818-157265840 CTGAATTGTGCATTCTTTTAGGG - Intronic
964623940 3:158741011-158741033 CTGTATCTTGCATGCTCTGGGGG + Intronic
965937671 3:174134659-174134681 CTTGAAGTTGCAGGCTTTTGGGG - Intronic
968344113 3:197986158-197986180 CGGAAGGTTTGATGCTTTTGAGG - Intronic
969247063 4:5942006-5942028 CTCAATTGTGCATGCATTTGTGG + Intronic
971293290 4:25365224-25365246 CTGAATGTTGCATGCTTTTGTGG - Intronic
972921246 4:43944912-43944934 CTTAATGTTGCAATCTTATGAGG - Intergenic
976473778 4:85459433-85459455 CTGTATATTGCATATTTTTGTGG - Intergenic
977894320 4:102346336-102346358 CAAAAGGTTGCATTCTTTTGAGG - Intronic
978588754 4:110301428-110301450 CAGAATGTGGCTTCCTTTTGTGG - Intergenic
980292722 4:130865806-130865828 CTTAGGGTTGCATTCTTTTGAGG + Intergenic
980473698 4:133282306-133282328 GTGAATGTTCCATGATTTTGAGG - Intergenic
980837550 4:138215648-138215670 CTGATTGTTGCTTGCTTTCATGG - Intronic
982664015 4:158239157-158239179 CTGTATTTTGCTTTCTTTTGTGG + Intronic
982665654 4:158258760-158258782 CTGAATGTAGGCTCCTTTTGAGG - Intergenic
983186186 4:164703543-164703565 CTGAATGTTGGCTGGTTTTATGG - Intergenic
985120216 4:186632593-186632615 ATGTATGTTATATGCTTTTGGGG - Intronic
985162756 4:187061554-187061576 CTGAATGTGGCATTGCTTTGTGG + Intergenic
985333142 4:188863091-188863113 CTGATTGTTGAATACTCTTGTGG + Intergenic
985354895 4:189108309-189108331 CTGAATCTTCCATGATTCTGGGG + Intergenic
986797892 5:11230380-11230402 CTAAATGTTGCTAACTTTTGCGG - Intronic
987283259 5:16431722-16431744 CTGAGTGTTGCCTGCTTTCAAGG - Intergenic
987608191 5:20166572-20166594 CTGAATTTGTCATGCTTTCGAGG - Intronic
988888299 5:35583648-35583670 ATGCATGTTCCATGCTTCTGTGG + Intergenic
989581165 5:43034400-43034422 CTGCAGATTGCATGCTCTTGGGG + Intergenic
990141698 5:52711983-52712005 ACGAATTTTGCATGCCTTTGAGG - Intergenic
993104072 5:83578724-83578746 GAGAATGTGGCATGTTTTTGTGG + Intronic
993661487 5:90642564-90642586 CTGAATTTTGCAGGCTTTTAAGG - Intronic
996747383 5:126857081-126857103 CAGAATGGTGCATGCTTCTGGGG + Intergenic
997777698 5:136625995-136626017 CTTAATGTCGCCTGCTTTTGTGG - Intergenic
999373060 5:151067972-151067994 CTGAGTGTTGCGTGTTTTGGAGG - Intronic
999780067 5:154842079-154842101 CTTAATGATCCATGCTTTTTGGG - Intronic
1001865423 5:175100030-175100052 CTGCATTTTACATGCTTTTTAGG + Intergenic
1006963161 6:37954826-37954848 CTAATTATTCCATGCTTTTGAGG + Intronic
1010089580 6:71964810-71964832 AGGAATGTTGCATGTATTTGGGG + Intronic
1011075491 6:83434045-83434067 CAGTATGTTGCATGCATTTACGG - Intergenic
1011941596 6:92849613-92849635 ATAAATATTGCATGCTTTTCTGG + Intergenic
1012393680 6:98771393-98771415 ATGAGAGTTGCATGCATTTGGGG + Intergenic
1012788805 6:103665873-103665895 ATGATTGTTGCAGGCTTTTGTGG - Intergenic
1012978785 6:105808551-105808573 TTGAATGTTGCTTGGTTTGGAGG + Intergenic
1013292965 6:108734478-108734500 CTGAATGCTGCCTGCTCTTCAGG + Intergenic
1013743843 6:113321098-113321120 TTCAATGTTCCATGTTTTTGGGG - Intergenic
1014717318 6:124881179-124881201 ATAAATGTTGCATGCATTGGAGG - Intergenic
1016664955 6:146628280-146628302 CTGAAAGTTGCACTCTTCTGAGG - Intronic
1016871014 6:148816803-148816825 CTGAATGTTACACTCATTTGTGG + Intronic
1017508523 6:155091120-155091142 CTGATTGCTTCATGCTTTTTGGG + Intronic
1018032545 6:159853446-159853468 CTGAATGTTCTATGATTTGGTGG - Intergenic
1022066371 7:26863109-26863131 CAGTATGTTGAATGCATTTGTGG - Intronic
1022968552 7:35496600-35496622 CTGCATGTAGCATGCTCCTGGGG - Intergenic
1025749801 7:64283777-64283799 CTGAGATTTGCATGCTTGTGTGG + Intergenic
1026671885 7:72397963-72397985 CTGGATGATGCATCCTTTTAGGG + Intronic
1029065197 7:97842254-97842276 CTTACTGTTGCTTGCTTTTTGGG - Intergenic
1030428166 7:109406935-109406957 CTGCTTGTTGCAGTCTTTTGAGG - Intergenic
1032976052 7:137224060-137224082 CTAAAAGTTGCATGCTTTTAAGG - Intergenic
1033035889 7:137875957-137875979 ATTAATGTTCCATGCCTTTGTGG - Exonic
1033632685 7:143175369-143175391 CTAAATTTTGATTGCTTTTGTGG + Intergenic
1036987230 8:13548257-13548279 CTGAATGTTACATGTTTCTATGG + Intergenic
1037711044 8:21355663-21355685 AGGAATGTTCCTTGCTTTTGTGG - Intergenic
1038380521 8:27088966-27088988 CAGAAGGTTGCATGCTGGTGAGG + Intergenic
1038650650 8:29400179-29400201 CTGAATGTTTCTTTCTTTGGAGG + Intergenic
1040357904 8:46637498-46637520 GTGAGTGTTGTATTCTTTTGTGG - Intergenic
1040488498 8:47897325-47897347 CTGAATGTTGCATGTTGGAGAGG - Intronic
1041281324 8:56212559-56212581 CTGAATGTGCTATGGTTTTGTGG + Intronic
1043044548 8:75305097-75305119 TTGAATTGTGCTTGCTTTTGAGG + Intergenic
1049105081 8:140607703-140607725 CTGGATGTTGCATGTTCCTGAGG - Intronic
1050742747 9:8841265-8841287 GTGAATGTTCCACGCTTTTGTGG + Intronic
1050958631 9:11697382-11697404 CTTGATGTTGCATACTTCTGTGG + Intergenic
1051510844 9:17876161-17876183 CTGAATTTGGCATGACTTTGAGG + Intergenic
1051897139 9:21998572-21998594 CTGAATATTGGAAGTTTTTGGGG + Intronic
1052516409 9:29486437-29486459 TTGAATGTAGTATGTTTTTGAGG + Intergenic
1057373736 9:94498754-94498776 CAGAAGGTTTGATGCTTTTGAGG - Intergenic
1058080661 9:100698365-100698387 CTGAAAGGTTCATGATTTTGTGG + Intergenic
1059255239 9:112924396-112924418 CTGAGTGTAGCCTCCTTTTGGGG + Intergenic
1059705251 9:116816951-116816973 CTGAATGTTGCATGGGGTTAGGG - Intronic
1186565700 X:10659975-10659997 CTGAATTTTACATGATTTTCTGG + Intronic
1187363873 X:18651027-18651049 TTGAATTTTGCATGTTTTTCTGG + Intronic
1187424309 X:19163186-19163208 CTGTAAGTTGCTTGCCTTTGTGG - Intergenic
1187488463 X:19726593-19726615 CTTAATGTTGTATGCTGCTGGGG + Intronic
1188248855 X:27866698-27866720 CAAATTGTTACATGCTTTTGTGG - Intergenic
1191014864 X:55798245-55798267 CTGATTTTTGCATTTTTTTGTGG - Intergenic
1191991168 X:67038645-67038667 CTGGGTGTTGCATTCTATTGTGG + Intergenic
1192466589 X:71361183-71361205 CTGAATGAGGCATCTTTTTGGGG - Intergenic
1192626261 X:72731950-72731972 CTGAATGGTCCATGCTCTGGTGG - Intergenic
1192659285 X:73025186-73025208 CTGTATGGTGGATGCTTTAGAGG - Intergenic
1199220748 X:145313151-145313173 CTAAATTTTTCATGCTTTTTTGG - Intergenic
1199493626 X:148428349-148428371 CTGAATGCTGCATCCTCTGGAGG + Intergenic
1199516802 X:148686766-148686788 CTGAATGCTGCCTCCTATTGGGG + Intronic
1200844317 Y:7815760-7815782 GTGAATGTTGTAATCTTTTGTGG + Intergenic