ID: 971296014

View in Genome Browser
Species Human (GRCh38)
Location 4:25392745-25392767
Sequence TACCTCCCAATTCTGTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971296014 Original CRISPR TACCTCCCAATTCTGTAGGT TGG Intronic
900748110 1:4375033-4375055 TGGCTCACAATTCTGTAGGCTGG + Intergenic
902672832 1:17986787-17986809 TTGCTCACAATTCTGGAGGTTGG + Intergenic
902818043 1:18927221-18927243 TCCCTCCCAACTCTGGAGGTGGG - Intronic
902987357 1:20163079-20163101 TAGCTCACAATTCTGCATGTTGG + Intronic
904941762 1:34168599-34168621 TGCCTCACAATTCTGGAGGCTGG + Intronic
905002137 1:34680812-34680834 TAACCCCCAATGCTGGAGGTGGG - Intergenic
905258807 1:36703233-36703255 TGACTCCCAATGCTGGAGGTGGG - Intergenic
907115911 1:51968231-51968253 TATCTCACAGTTCTGGAGGTCGG - Intronic
908327699 1:63039779-63039801 TAGCTCTCAATTCTGGCGGTGGG + Intergenic
909068054 1:70960179-70960201 TACCTCACAGTTCTGGAGGCTGG - Intronic
909302204 1:74027586-74027608 TTTCTCCCAGTTCTGGAGGTTGG - Intronic
909569832 1:77096686-77096708 TAGCTCACAATTCTGCAAGTTGG - Intronic
910226754 1:84943740-84943762 GCCCTCCCCATTTTGTAGGTGGG - Intronic
910269439 1:85377845-85377867 TATTTTCCAATTCTTTAGGTGGG - Intronic
911269070 1:95778450-95778472 TTTCTCACAGTTCTGTAGGTTGG - Intergenic
912119131 1:106447976-106447998 TACCTCACAGTTGTGTAGGTTGG - Intergenic
912518676 1:110231054-110231076 TGCCTCCCAGTTCTGTGGGAAGG - Intronic
915214517 1:154330911-154330933 TTCCTCCTCATTCTGCAGGTAGG + Exonic
916264502 1:162877073-162877095 TTCCTCACAGTTCTGTAGGCTGG - Intergenic
916314869 1:163437994-163438016 AACCTCACAATTCTTCAGGTTGG - Intergenic
916422643 1:164651066-164651088 TACCTCCCATCTCTGAAGGAGGG + Intronic
917132147 1:171754405-171754427 CAGCTCACAAATCTGTAGGTTGG + Intergenic
918095086 1:181327846-181327868 TTTCTCACAATTCTGTGGGTTGG + Intergenic
918193160 1:182195879-182195901 AGCCTCCCAATCATGTAGGTGGG - Intergenic
919222910 1:194654620-194654642 TACCTTCCAGTTCTGGACGTTGG + Intergenic
921884086 1:220287157-220287179 TAATTCCCAATGCTGGAGGTAGG + Intergenic
922972632 1:229755765-229755787 TTCCTCACAATTCTGGAGGCTGG + Intergenic
923356281 1:233159087-233159109 TGGCTCCTGATTCTGTAGGTGGG + Intronic
923411448 1:233713880-233713902 TATCTCACAGTTCTGGAGGTGGG - Intergenic
924356496 1:243182285-243182307 TAGCTCACAATTCTGCAGGCTGG - Intronic
1063210839 10:3879968-3879990 TTTCTCCCAATTCTGGAGGCAGG + Intergenic
1063787705 10:9403737-9403759 TATCTCACAGTTCTGGAGGTTGG - Intergenic
1066591537 10:37000305-37000327 TATCTCCAAGTTCTATAGGTTGG + Intergenic
1066756674 10:38718877-38718899 TTCCTCCCAATTTTGTATATGGG + Intergenic
1067678463 10:48408781-48408803 TTTCTCACAATTCTGTAGGCTGG + Intronic
1067799418 10:49348782-49348804 TAGCTCACAATTCTGAAGGCTGG + Intergenic
1069740420 10:70683671-70683693 TTCCTCACAACTCTGTGGGTGGG + Intronic
1069781353 10:70957878-70957900 CACCTCGCAGTTCTGTAGGTTGG - Intergenic
1070462139 10:76680938-76680960 TTTCTCACAATTCTGGAGGTTGG - Intergenic
1070578934 10:77704176-77704198 TTCCTCACAGTTCTGGAGGTTGG - Intergenic
1070777257 10:79116941-79116963 AACCTCACAATTCTGTGGTTTGG + Intronic
1071233266 10:83613964-83613986 TTTCTCACAATTCTGTAGGCTGG - Intergenic
1071257358 10:83883160-83883182 TCCTTAACAATTCTGTAGGTAGG + Intergenic
1071470289 10:85979410-85979432 TATCTCCCAGTTCTGGAGGATGG + Intronic
1072568514 10:96638351-96638373 TAGCTCACAATTCTGGAGGCTGG - Intronic
1073979998 10:109143498-109143520 TAATCCCCAATTCTGGAGGTGGG + Intergenic
1074681054 10:115908267-115908289 TACCTTACAGTTCTGGAGGTCGG + Intronic
1075596826 10:123737940-123737962 TAATTCCCAATGCTGGAGGTGGG + Intronic
1075978394 10:126716592-126716614 TCTCTACCAATTCTGTGGGTTGG - Intergenic
1078553744 11:12300800-12300822 TATCTTACAGTTCTGTAGGTTGG - Intronic
1078698462 11:13658543-13658565 TAATTCCCAATGCTGGAGGTGGG + Intergenic
1078698731 11:13660578-13660600 TAATCCCCAATGCTGTAGGTGGG + Intergenic
1078862537 11:15263652-15263674 TATCTTACAGTTCTGTAGGTAGG + Intergenic
1080155590 11:29106913-29106935 TAATTCCCAATGCTGGAGGTGGG + Intergenic
1080763726 11:35276927-35276949 TTCCTCAGAATTCTGGAGGTTGG + Intronic
1081720035 11:45281955-45281977 TTACTCCCAATTCTTTAGGTTGG + Intronic
1082143031 11:48631864-48631886 TAACCCCCAATGCTGGAGGTAGG - Intergenic
1086985890 11:93248704-93248726 TTGCTCCCAATTCTATGGGTTGG - Intergenic
1087723008 11:101688081-101688103 TTCCTTACAATTCTGGAGGTCGG - Intronic
1087957628 11:104308229-104308251 TTTCTCACAAATCTGTAGGTGGG - Intergenic
1088115876 11:106312364-106312386 TTTCTCACAATTCTGTAGGCTGG - Intergenic
1089468337 11:118700738-118700760 TTGCTCACAATTCTGTAGTTTGG - Intergenic
1090027527 11:123180494-123180516 TTCCTCACAGTTCTGGAGGTTGG - Intronic
1092292126 12:7166692-7166714 TTCCTCACAATTCTGTTGGCTGG + Intergenic
1093009878 12:14095495-14095517 TAGCTCACAATTCTGTAGGTTGG - Intergenic
1093698344 12:22189008-22189030 TAACTCCCAATTTTGGAGGTGGG + Intronic
1096065349 12:48735283-48735305 AATCTCACAGTTCTGTAGGTCGG - Intergenic
1097834378 12:64258654-64258676 TATCTCACAATTCTGTGGATTGG + Intergenic
1098182585 12:67863758-67863780 TTCCTCACAATTCTGAAGGCTGG + Intergenic
1099288336 12:80743691-80743713 TTTTTCACAATTCTGTAGGTTGG - Intergenic
1099438508 12:82671201-82671223 TTCCTCTCAGTTCTGGAGGTGGG - Intergenic
1099805995 12:87519195-87519217 TAGCTCACAATTCTGGAGGTTGG + Intergenic
1100000385 12:89827610-89827632 GAGCTCACAATTCTATAGGTTGG + Intergenic
1100272458 12:93039340-93039362 TAATTCCCAATGCTGGAGGTGGG - Intergenic
1100438895 12:94597347-94597369 TACCTGCATATTCTGTACGTGGG - Intronic
1100687618 12:97003993-97004015 TTCCTCGCAATTCTGGAGGTTGG + Intergenic
1100728288 12:97434158-97434180 TACCCTCCAATTATGTAGGAAGG + Intergenic
1100964762 12:100000388-100000410 TATCTCACTGTTCTGTAGGTTGG + Intergenic
1101009442 12:100434339-100434361 TTTCTCACAATTCTGTGGGTTGG + Intergenic
1101267216 12:103101748-103101770 TAGCTCATAATTCTGTGGGTTGG + Intergenic
1102624832 12:114226676-114226698 TAGATGCTAATTCTGTAGGTCGG + Intergenic
1102806505 12:115785804-115785826 TTTCTCCCAGTTCTGGAGGTTGG - Intergenic
1104183043 12:126400629-126400651 TTGCTCACAATTTTGTAGGTTGG - Intergenic
1106752955 13:32793841-32793863 TAGCTCACAATTCTGGAGGCCGG + Intergenic
1106930657 13:34660601-34660623 TTTCTCACAATTCTGGAGGTTGG + Intergenic
1107026724 13:35809511-35809533 TTCCTAGCAACTCTGTAGGTTGG + Intronic
1108161478 13:47644792-47644814 TATCTCACAATTCTAGAGGTTGG - Intergenic
1108956836 13:56168257-56168279 TACTTCCCAATGCTGGAGGTGGG - Intergenic
1109885039 13:68531305-68531327 TCCCTCCAAATTTTGTATGTCGG + Intergenic
1110313323 13:74076342-74076364 TTCCTCACAATTCTGGAGGCTGG + Intronic
1112067720 13:95812615-95812637 TAGTTCCCAATGCTGGAGGTGGG + Intronic
1112332312 13:98485965-98485987 TTCCTCCCATTTCTGTGGGAAGG - Intronic
1112564459 13:100541241-100541263 AACCTCAGAATTCTGTAGATGGG + Intronic
1112742782 13:102494085-102494107 TTCCTCACAATTCTGGAGGCAGG - Intergenic
1113210639 13:107975704-107975726 TATCTCACAGTTCTGTAGGTGGG - Intergenic
1113399452 13:109977734-109977756 TGCCTCCCAGTCCTGGAGGTTGG + Intergenic
1113462836 13:110493769-110493791 TTCCTCCCAGTTCTGGAGGCTGG + Intronic
1114637970 14:24199228-24199250 TAATCCCCAATGCTGTAGGTGGG + Intronic
1114738623 14:25070058-25070080 TAGCCCCCAGTTCTGTGGGTCGG + Intergenic
1114847760 14:26344258-26344280 TATCTCACAATTCTGCAGGTCGG - Intergenic
1115140962 14:30170265-30170287 TAACCCCCAATGCTGAAGGTGGG - Intronic
1115194595 14:30782726-30782748 TTTCTCCCAATTCTGGAGGCTGG + Intergenic
1117635157 14:57735359-57735381 TATCTCATAATTCTGCAGGTTGG + Intronic
1118928096 14:70212426-70212448 TTCCTCACAATTCTGAAGGTTGG - Intergenic
1119561464 14:75593336-75593358 TACCTCACTGTTCTGTAGGCTGG + Intronic
1120920615 14:89752158-89752180 TTCCTCACAATTCTGTAGGATGG - Intergenic
1121164363 14:91777676-91777698 TTCCTCACAGTTCTGGAGGTTGG + Intronic
1123159692 14:106266419-106266441 TATTTTCCCATTCTGTAGGTTGG - Intergenic
1125007386 15:34833092-34833114 TTTCTCACAATTCTGGAGGTTGG + Intergenic
1126369849 15:47934112-47934134 TTCCTCACAGTTCTGGAGGTTGG + Intergenic
1126401582 15:48276615-48276637 TTCCTCACAATTCTGGAGGCCGG - Intronic
1127453159 15:59135991-59136013 TGCCTCACAGTTCTGGAGGTTGG + Exonic
1129269758 15:74413435-74413457 CACCTCCCAAGTCTGCAGGAAGG + Intronic
1130890566 15:88130093-88130115 TTCCTCACAATTCTGGAGGCTGG - Intronic
1133593176 16:7265845-7265867 TAACTCCCAATGCTGGAGGTGGG + Intronic
1133775326 16:8890776-8890798 TACCTCCTAGTGGTGTAGGTAGG - Intergenic
1134150898 16:11804128-11804150 TAACTCCCAATTTTTTGGGTGGG - Intergenic
1135270384 16:21064409-21064431 TAGCTCAGAATTCTCTAGGTTGG - Intronic
1135614063 16:23894655-23894677 TCCCTCACAATTCTCTGGGTTGG - Intronic
1135763612 16:25157694-25157716 TAGCTCACAATTCTTTGGGTTGG + Intronic
1136725916 16:32357445-32357467 TTCCTCCCAATTTTGTATATGGG - Intergenic
1138097488 16:54223408-54223430 TTTCTCCCAGTTCTGTGGGTTGG - Intergenic
1140420540 16:74815385-74815407 TAGCTCACAATTCTGCAGGCTGG - Intergenic
1140815627 16:78618334-78618356 TTCCTCACAGTTCTGGAGGTTGG + Intronic
1203000515 16_KI270728v1_random:160310-160332 TTCCTCCCAATTTTGTATATGGG + Intergenic
1203132117 16_KI270728v1_random:1696714-1696736 TTCCTCCCAATTTTGTATATGGG + Intergenic
1144193777 17:12871240-12871262 TAATCCCCAATGCTGTAGGTGGG + Intronic
1144800742 17:17924908-17924930 TAGTTCCCAATGCTGGAGGTAGG + Intronic
1145841362 17:27997904-27997926 TATCTCACAGTTCTGGAGGTTGG - Intergenic
1146826179 17:36024984-36025006 ATTCTCACAATTCTGTAGGTTGG - Intergenic
1150503350 17:65673005-65673027 TCCCTCACAGTTTTGTAGGTTGG + Intronic
1154126235 18:11694784-11694806 TTTCTCACAATTCTGGAGGTTGG + Intronic
1155701799 18:28754273-28754295 TAGCTCACAATTCTGGAGGTTGG + Intergenic
1155734265 18:29201546-29201568 TAATTCCCAATTTTGGAGGTGGG + Intergenic
1155937093 18:31765321-31765343 TTCCTCACAATTCTGGAGGCTGG + Intergenic
1156293522 18:35770559-35770581 AACCTCCCATCTCTGTAGGAAGG - Intergenic
1157751648 18:50184017-50184039 TAGCTCACAGTTCTGTAGGCTGG - Intronic
1158938763 18:62388121-62388143 TAGCTCCCAATTCTATGGGTTGG + Exonic
1159280546 18:66279234-66279256 TACCTGATAATTGTGTAGGTTGG - Intergenic
1165637561 19:37354908-37354930 TGGCTCACAATTCTGGAGGTTGG - Intronic
1165800251 19:38545190-38545212 TACCTCCTGGTTCTATAGGTGGG - Intronic
1166146454 19:40840075-40840097 TAGCTCCCAATGTTGGAGGTGGG + Intronic
1166566066 19:43766406-43766428 GCCCTCCCAACTCTGTAGGCTGG - Intergenic
925320158 2:2959894-2959916 TTCCTCACAGTTCTGGAGGTTGG + Intergenic
926493841 2:13559053-13559075 TAACTCCCAATGCTGGAGGTGGG - Intergenic
928051551 2:28001872-28001894 TAACTCCCAATGTTGGAGGTGGG - Intronic
928868276 2:35944873-35944895 TATCTCACCATTCTGGAGGTTGG - Intergenic
928952702 2:36827705-36827727 CACCTCCCATTTCTGTAAATGGG - Intergenic
929194072 2:39166933-39166955 TATCTCACAATTCTGTGGGTTGG + Intergenic
930689166 2:54341429-54341451 TGGCTCACAATTCTGTAGGCTGG - Intronic
934319968 2:91963127-91963149 TTCCTCCCAATTTTGTATATGGG + Intergenic
935708721 2:105878577-105878599 TTCCTCACAATTCTGGAGGCTGG - Intronic
935868783 2:107422200-107422222 TAGCACCTAATTCTGTAGGGTGG + Intergenic
938158184 2:128959120-128959142 TTCCTCACAATTCTGGAGGCTGG - Intergenic
939885344 2:147675503-147675525 TAGCTCACAATTCTGAAGGCTGG + Intergenic
940823547 2:158384834-158384856 TAGCTCACAGTTCTGCAGGTTGG + Intronic
940986606 2:160057753-160057775 TACCTCCCCAATCTGGAGGTGGG + Intronic
943049182 2:182894846-182894868 TACCTCCTAATGCTGGAGATTGG - Intergenic
943546072 2:189280117-189280139 TTTCTCACAATTCTGGAGGTTGG - Intergenic
944225052 2:197341285-197341307 TTTCTCACAATTCTGGAGGTTGG - Intergenic
945084764 2:206119902-206119924 TAACCCCCAATGCTGGAGGTAGG + Intronic
945354438 2:208822125-208822147 TACCTCCCAAATCCATAGGAAGG + Intronic
945828616 2:214756117-214756139 TAATTCCCAATGCTGGAGGTGGG + Intronic
945956442 2:216090655-216090677 GACCTCCAAATTCTATAGGCAGG + Intronic
946448986 2:219763703-219763725 TTCCTCCCAGTTCTGGAGGCTGG + Intergenic
947580318 2:231312091-231312113 TTCCTCCCAATTCTGTGGGTTGG + Intronic
948166490 2:235866688-235866710 TGTCTCCCAATTCTGGAGGCTGG + Intronic
948604305 2:239125157-239125179 TAGCCCCCAATACTGGAGGTGGG + Intronic
1169321059 20:4633641-4633663 TAGCTCCAAATTCCTTAGGTTGG + Intergenic
1170398923 20:15958942-15958964 TTCCTCACAGTTCTGGAGGTTGG - Intronic
1170763035 20:19268395-19268417 TAGCACACAATTCTGAAGGTGGG + Intronic
1171980971 20:31628650-31628672 TATCTCACAATTCTGGAGGCTGG - Intergenic
1172556544 20:35846851-35846873 TAGCTCACAATTCTGCAGGCTGG + Intronic
1172766402 20:37353461-37353483 TTCCTCCCACTTCTGAAGGGAGG + Intronic
1172835630 20:37871361-37871383 TTCCTCACAATTCTGGAGGCGGG + Intronic
1173162902 20:40665491-40665513 TTCCTTACAATTCTATAGGTTGG + Intergenic
1174946246 20:54988769-54988791 TAACTCACAATTCTGGAGGCTGG - Intergenic
1176953553 21:15073647-15073669 TAGCTCACAATTCTGTAGGCTGG + Intergenic
1177005351 21:15665368-15665390 TTCCTCACAGTTCTGGAGGTTGG - Intergenic
1177167973 21:17624315-17624337 TATCTCACAGTTCTGTAGTTTGG + Intergenic
1177264704 21:18767243-18767265 TGCCTCACAGTTCTGGAGGTTGG + Intergenic
1177506606 21:22027605-22027627 TACTTCCAAATTGTGGAGGTGGG + Intergenic
1177693428 21:24540154-24540176 CACCTCCCAATACTGTTGGGTGG + Intergenic
1178377682 21:32081203-32081225 TTTCTCCCAATTCTGGAGGCTGG + Intergenic
1178402151 21:32296023-32296045 TTCCTCACAATTCTGGAGGCTGG + Intronic
1178846552 21:36178567-36178589 CTTCTCCCAGTTCTGTAGGTTGG - Intronic
1178878632 21:36431391-36431413 TGTCTCCCAGTTCTGCAGGTGGG - Intergenic
1179155048 21:38842317-38842339 TGCCTGACAGTTCTGTAGGTCGG - Intergenic
1179186623 21:39089845-39089867 TTCCTCCCAGTTCTGGAGGCTGG - Intergenic
1179963994 21:44789968-44789990 TTGCTCCCAATTCTGGAGGCTGG - Intronic
1181844615 22:25697068-25697090 CATCTCCAAATTCTGTAGGTAGG - Intronic
1184092621 22:42300461-42300483 CACCTCCCACTTCTGATGGTGGG + Intronic
949398213 3:3637640-3637662 TTCCTCACAATTCTGGAGGCTGG + Intergenic
949567108 3:5255165-5255187 TACCTCAAAGTTTTGTAGGTTGG + Intergenic
950130610 3:10543219-10543241 TTTCTCACAATTCTGGAGGTTGG - Intronic
950134676 3:10572189-10572211 TAGCTCCCAAGTCTGCAGATGGG - Intronic
951044416 3:18022412-18022434 CATCTCCCAATTCTGTGGGCGGG - Intronic
951124277 3:18964970-18964992 TATCTCACAATTCTACAGGTTGG - Intergenic
952017333 3:28973297-28973319 TACCAACCACTGCTGTAGGTAGG - Intergenic
952062716 3:29529954-29529976 CACTTCCCAATACTCTAGGTAGG + Intronic
952092505 3:29906273-29906295 TAGCTCACAATTCTGGAGGATGG + Intronic
952254849 3:31686193-31686215 TAGCTCACAATTCTGCAGGCTGG - Intronic
952484068 3:33791665-33791687 TAGCTCATAATTCTGTAGGTTGG + Intergenic
953692689 3:45133342-45133364 TAGCTCACAGTTCTGTAGGTCGG - Intronic
957300113 3:78381162-78381184 TAGCTCACAGTTCTGGAGGTGGG + Intergenic
957399512 3:79690559-79690581 AATCTCACCATTCTGTAGGTTGG - Intronic
958668221 3:97168337-97168359 TAATTCCCAATTTTGGAGGTGGG + Intronic
959648827 3:108731983-108732005 TGCCTCCCAATTTTGAAGGATGG + Intergenic
960520082 3:118644495-118644517 TAATTCCCAATGCTGAAGGTGGG - Intergenic
960617122 3:119606169-119606191 TGCCTCACAATTCTGGAGGCTGG + Intronic
961063568 3:123854212-123854234 TAGCTTCCAATTCTTTGGGTTGG - Intronic
963616766 3:147549484-147549506 TAATTCCCAATTTTGTAGGTGGG + Intergenic
965068965 3:163892178-163892200 TAGCTCACAGTTCTGTCGGTCGG - Intergenic
966001032 3:174948902-174948924 TTTCTCCCAATTCTGGAGGCAGG + Intronic
967260105 3:187633796-187633818 TAACCCCCAATGCTGAAGGTGGG - Intergenic
967942145 3:194774352-194774374 TAGCTCACAATTCTGCAGCTTGG - Intergenic
969094229 4:4719895-4719917 TTCCTCCCCATTCTGGAGGCCGG - Intergenic
969328462 4:6458316-6458338 TTCCTCACAATTCTGGAGGCTGG + Intronic
969331552 4:6476080-6476102 TTCCTCCCAGTTCTGGAGGCTGG - Intronic
969625463 4:8302789-8302811 TCCCTCTCAGTTCTGGAGGTCGG + Intronic
970505287 4:16723261-16723283 CAGCTCACAATTCTGGAGGTTGG + Intronic
970933738 4:21544382-21544404 TATCTCACAGTTCTGTAGGTTGG + Intronic
970971358 4:21987994-21988016 TTCCTCACAGTTCTGGAGGTTGG + Intergenic
971016109 4:22490872-22490894 TAGCTCACAGCTCTGTAGGTCGG + Intronic
971267193 4:25106073-25106095 TACCTCATAATTCTGGAGGCTGG - Intergenic
971296014 4:25392745-25392767 TACCTCCCAATTCTGTAGGTTGG + Intronic
971368316 4:25995122-25995144 TTCCTCACAATTCTGGAGGCTGG - Intergenic
971473700 4:27052902-27052924 TATCTCCCAATTGTGCAGTTGGG + Intergenic
971513862 4:27462671-27462693 TAGCTCACAATTCTGTTGGTTGG + Intergenic
972271567 4:37515278-37515300 TTTCTCACAATTCTGGAGGTTGG - Intronic
972587861 4:40454845-40454867 TACATTTCAATTCTGTAAGTTGG - Intronic
973793409 4:54399097-54399119 TCCTTCCCAGTTCTGTATGTGGG + Intergenic
973846824 4:54921415-54921437 TAATTCCCAATGCTGGAGGTGGG + Intergenic
974755594 4:66203098-66203120 TGGCTCACAATTCTGGAGGTTGG + Intergenic
975572492 4:75832295-75832317 TAGCTCACAGTTCTGTAGGCTGG - Intergenic
976249822 4:83039092-83039114 TAGCTTATAATTCTGTAGGTTGG + Intronic
976453628 4:85220201-85220223 TAATTCCCAATGCTGGAGGTGGG + Intergenic
977255883 4:94739469-94739491 TAGCTCACAATTCTGTAAGCTGG - Intergenic
978309385 4:107369400-107369422 TTTCTCACAATTCTGTAGGCTGG - Intergenic
979245321 4:118497320-118497342 TAGCTCACAATTCTGCAGGCTGG + Intergenic
979509453 4:121535641-121535663 TTTCTCACAATTCTGTGGGTTGG - Intergenic
980174861 4:129332303-129332325 TTTCTCACAGTTCTGTAGGTTGG - Intergenic
980340373 4:131536813-131536835 GACCCCCCATTTCTGTATGTTGG + Intergenic
981058279 4:140389903-140389925 TACATTCCAACTATGTAGGTAGG - Intronic
981403473 4:144340559-144340581 TATCTTACAATTCTGGAGGTCGG - Intergenic
983209615 4:164945395-164945417 TATCTGCTCATTCTGTAGGTGGG - Intergenic
983317542 4:166151337-166151359 TATCTCACAGTTCTGCAGGTTGG + Intergenic
986363170 5:7001918-7001940 TACCTCACAATTCTGGAGTTTGG + Intergenic
986938991 5:12926926-12926948 TATCTCACAGTTCTGTAAGTTGG + Intergenic
987794039 5:22605530-22605552 CACCTCCCACCTCTGAAGGTTGG + Intronic
989192473 5:38684732-38684754 TAGCTCCTAGTTCTGCAGGTGGG - Intergenic
989487729 5:42011443-42011465 TGGCTCCCAATTCTGGTGGTTGG - Intergenic
991274120 5:64823486-64823508 TAGCTACTAATTTTGTAGGTAGG - Intronic
992281853 5:75186181-75186203 TACCTCCCAAATCTGCAGGTTGG + Intronic
992832845 5:80611805-80611827 TAATCCCCAATGCTGTAGGTGGG - Intergenic
992881736 5:81117293-81117315 TTTCTCACAATTCTGGAGGTTGG + Intronic
992929078 5:81622377-81622399 TACCTTCCACTTTTATAGGTGGG - Intronic
993946747 5:94124266-94124288 TAATTCCCAATGCTGGAGGTGGG - Intergenic
994054482 5:95400182-95400204 TACCTCACAATTCTGGAGGTTGG + Intronic
995232936 5:109791199-109791221 GACTTCCTATTTCTGTAGGTTGG + Intronic
995709808 5:115023688-115023710 AGCCTAACAATTCTGTAGGTAGG - Intergenic
996369562 5:122738910-122738932 TTTCTCCCAATTCTGGAGGCTGG - Intergenic
996657189 5:125954890-125954912 TAACCCCCAATTCTGGAGGTGGG - Intergenic
996950219 5:129117445-129117467 TACCTCATGGTTCTGTAGGTCGG - Intergenic
997725279 5:136115026-136115048 TAGCTCACAATTCCGTAAGTTGG - Intergenic
997859736 5:137405633-137405655 TACCTCTCACTTGTGTAGCTGGG - Intronic
998380734 5:141723477-141723499 TTCCTCGCAATTCTGGAGGCTGG + Intergenic
1000830146 5:166092692-166092714 TAATTCCCAATGCTGAAGGTGGG - Intergenic
1002162589 5:177324508-177324530 TATCTCGCAATTCTGGAGGCTGG + Intergenic
1002838507 6:885804-885826 TTCCTCCCAGTTCTGGAGGCTGG + Intergenic
1002848570 6:970492-970514 TACCTCCCAATGTTGTTGCTGGG + Intergenic
1003750409 6:9048977-9048999 TACCTAGCAATTCTTGAGGTAGG - Intergenic
1004684286 6:17927719-17927741 TACCTAGCAATTATGGAGGTGGG - Intronic
1004691309 6:17994542-17994564 CACATTCCAATTATGTAGGTCGG - Intergenic
1008167672 6:48159233-48159255 TTCCTCACAATTCTGGAGGCTGG - Intergenic
1008176655 6:48276262-48276284 TATCTCACAGTTCTGTAGGTTGG - Intergenic
1008737925 6:54569684-54569706 TACCACAAAAATCTGTAGGTAGG - Intergenic
1008930926 6:56938949-56938971 TATCTCACAATTCCGTGGGTTGG - Intronic
1010087678 6:71939548-71939570 TGCCTCACAATTCTGGAGGCTGG + Intronic
1010746145 6:79563777-79563799 TAGCTCACAATTCTGTAGACTGG - Intergenic
1012819277 6:104064774-104064796 TACCTCCTATTGCTTTAGGTAGG + Intergenic
1013444092 6:110203910-110203932 TATTTTCCACTTCTGTAGGTGGG - Intronic
1013707077 6:112849294-112849316 TATCTCACAGTTCTGTGGGTGGG + Intergenic
1013729934 6:113153703-113153725 TAGCTCACAGTTCTGGAGGTGGG - Intergenic
1016516409 6:144897343-144897365 AACCTCCCAATTCAGTTGGTCGG - Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1021310818 7:19093710-19093732 TATCTCACAATTCTGGAGGCTGG - Intronic
1021611779 7:22464786-22464808 TTCCTCCCAGTTCTGGAGGCTGG - Intronic
1023785138 7:43699109-43699131 TACCTCCCACTCCTGTAATTTGG - Intronic
1024657468 7:51463827-51463849 TGGCTCACAATTCTGGAGGTTGG + Intergenic
1026153801 7:67810274-67810296 TACCTCCCAAGTCTACAGGCTGG - Intergenic
1026652876 7:72230736-72230758 TATCTTTCAATTCTGGAGGTCGG - Intronic
1026805923 7:73429610-73429632 AACCTCCCAAGTCTGTGGGAGGG + Intergenic
1027992072 7:85375441-85375463 TAATCCCCAATTCTGGAGGTGGG + Intergenic
1029058583 7:97773146-97773168 TAGCTCACAATTCTGTAGTTTGG + Intergenic
1029930622 7:104366652-104366674 TGCCTCCCACTTCTATAGGATGG + Intronic
1030205903 7:106952530-106952552 GTCCTACCAATTCTGCAGGTGGG - Intergenic
1031285952 7:119868059-119868081 TATTTTCCAATTCTGTAAGTAGG + Intergenic
1031501183 7:122518931-122518953 TAAAACCAAATTCTGTAGGTTGG - Intronic
1031938887 7:127766250-127766272 TTCCTCACAGTTCTGTAGGCTGG - Intronic
1032702131 7:134391547-134391569 TAACTCCCAATGTTGGAGGTGGG - Intergenic
1033027892 7:137794156-137794178 TAATTCCCACCTCTGTAGGTTGG + Intronic
1034281026 7:149854559-149854581 TATCTCACAACTCTGCAGGTGGG + Intronic
1034725660 7:153332920-153332942 TAATCCCCAATTCTGGAGGTGGG - Intergenic
1036591245 8:10170469-10170491 TTCCTCACAATTCTGGAGGCTGG - Intronic
1037033902 8:14142687-14142709 TAACTCCCAATGCTGGAGATGGG + Intronic
1037851102 8:22329627-22329649 TAATTCCCAATACTGGAGGTGGG - Intronic
1038349269 8:26761644-26761666 TGCCTCACCATTCTGGAGGTTGG - Intronic
1038501993 8:28052656-28052678 TATCTCCCAGTTCTGGAGGCTGG - Intronic
1038541987 8:28397469-28397491 TTCCTCACAGTTCTGGAGGTTGG - Intronic
1039018345 8:33178413-33178435 AACCTCCCAATTCTGTACTCAGG - Intergenic
1039079155 8:33718819-33718841 TACCTCCCCTTTCTGTATCTTGG - Intergenic
1039686247 8:39804999-39805021 TTTCTCACAATTCTGGAGGTTGG + Intronic
1040498343 8:47986530-47986552 TTCCTCCCAGTTCTGGAGGCTGG + Intergenic
1040587429 8:48756866-48756888 TAGCTCTCAACTCTGTGGGTTGG + Intergenic
1040673159 8:49716765-49716787 TATCTCCTTATTATGTAGGTTGG + Intergenic
1040843294 8:51807441-51807463 TAACTCCCAATGTTGGAGGTGGG - Intronic
1042935238 8:74051810-74051832 TTTCTCCCAATTCTGGAGCTAGG - Intergenic
1043761122 8:84069652-84069674 TACCTCACAGTTCTGGAGGCTGG + Intergenic
1043841794 8:85114336-85114358 TACCTCTCAATTCTGAAGGGAGG - Intronic
1044688944 8:94857533-94857555 TATCTCCCAGTTCTGGAGGCCGG + Intronic
1046120715 8:109842773-109842795 TTCCTCACAATTCTGTGGCTGGG - Intergenic
1046391945 8:113585904-113585926 TAATCCCCAATTCTGGAGGTGGG - Intergenic
1046613817 8:116454223-116454245 TACCTCCAAAATGTGGAGGTGGG + Intergenic
1047075140 8:121392684-121392706 TATCTCACAGTTCTGTAGGCTGG - Intergenic
1047593335 8:126350518-126350540 TAGCTCACAATTCTGTGGGTTGG - Intergenic
1048051463 8:130821047-130821069 TCCCTCCCAATTCTGTTGCCTGG - Intronic
1048635600 8:136291979-136292001 TAACTCCCAATGCTGGAGGTGGG - Intergenic
1049907153 9:228753-228775 TTTCTCACAATTCTGTGGGTTGG + Intronic
1051224057 9:14880173-14880195 TTCCTCACAGTTCTGAAGGTTGG - Intronic
1051957108 9:22709626-22709648 TATCTCACAATTCTGGAGGCTGG + Intergenic
1053452813 9:38207400-38207422 TACTTCAAGATTCTGTAGGTTGG + Intergenic
1054962884 9:70989055-70989077 TATCTCACAGTTCAGTAGGTTGG - Intronic
1055334864 9:75223509-75223531 TAACCCCCAATGCTGCAGGTGGG - Intergenic
1055476575 9:76668869-76668891 TCGCTCACAATTCTGGAGGTTGG + Intronic
1055762196 9:79621018-79621040 TAATTCCCAATGCTGGAGGTGGG - Intronic
1056237420 9:84608862-84608884 TTCCTCACAATTCTGGAGGCTGG + Intergenic
1056328551 9:85502705-85502727 TCTCTCCCAGTTCTGGAGGTAGG - Intergenic
1056730034 9:89157487-89157509 TATCTTACAATTCTGGAGGTCGG - Intronic
1057735499 9:97655680-97655702 TACCTCCCCCTTCTCTACGTAGG + Exonic
1058204028 9:102079554-102079576 TATCTCTCAGTGCTGTAGGTTGG + Intergenic
1059906714 9:118994811-118994833 TAGCTCACCATTCTGTTGGTCGG + Intergenic
1185970629 X:4658616-4658638 TAGCTCAGAGTTCTGTAGGTTGG + Intergenic
1186594351 X:10964859-10964881 TTTCTCACAATTCTGAAGGTTGG + Intergenic
1186934506 X:14433223-14433245 CTCCTCACAATTCTGTGGGTTGG + Intergenic
1187101405 X:16196629-16196651 TAGCTCACAATTCTGCTGGTTGG - Intergenic
1187124714 X:16444527-16444549 TGACTCGCAATTCTGTGGGTTGG + Intergenic
1187127549 X:16468504-16468526 TCCCTCCCAAGTCTGTAGGGAGG + Intergenic
1187207907 X:17200362-17200384 TAGCTCACAATTCTGCATGTTGG + Intergenic
1187215582 X:17272826-17272848 TTTCTCACAGTTCTGTAGGTTGG + Intergenic
1187745165 X:22401672-22401694 TTTCTCACAATTCTGTGGGTTGG + Intergenic
1188751382 X:33909755-33909777 TCCTTCCCAATTCTGTATTTTGG - Intergenic
1188912952 X:35872796-35872818 TAATTCCCAATGCTGGAGGTGGG + Intergenic
1188962533 X:36509282-36509304 TAATTCCCAATGCTGGAGGTGGG - Intergenic
1189204209 X:39223916-39223938 TTTCTCCCAATTCTGTGGGTTGG + Intergenic
1190009863 X:46775251-46775273 TACCTCACAATTTTGTGGTTTGG + Intergenic
1192786730 X:74343644-74343666 TAATCCCCAATTCTGGAGGTGGG + Intergenic
1193612359 X:83647869-83647891 TAATTCCCAATACTGGAGGTGGG - Intergenic
1194412554 X:93574902-93574924 TATCTCACAATTCTGGAGTTTGG - Intergenic
1194599158 X:95899323-95899345 TTCCTCACAATTCTGGAGGCTGG + Intergenic
1194853884 X:98904211-98904233 TAATTCCCAATGCTGGAGGTGGG - Intergenic
1199001310 X:142640298-142640320 TGCCTCACAATTCTGGAGGCTGG + Intergenic
1199036430 X:143056058-143056080 TAGCTCACAATTCTGGAGGCTGG - Intergenic
1199334890 X:146606948-146606970 TAATCCCCAATTCTGGAGGTGGG - Intergenic
1199467197 X:148151753-148151775 CACATACCAACTCTGTAGGTGGG + Intergenic
1200331916 X:155306870-155306892 TAATTCCCAATTCTGGAGGTGGG - Intronic
1200366943 X:155676665-155676687 TTCCTCACAATTCTGGAGGTTGG + Intergenic
1201187496 Y:11418231-11418253 TTCCTCCCAATTTTGTATATGGG + Intergenic