ID: 971296876

View in Genome Browser
Species Human (GRCh38)
Location 4:25401603-25401625
Sequence CAGTGCACGGAGAGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971296876 Original CRISPR CAGTGCACGGAGAGGGCAGC TGG (reversed) Intronic
900266371 1:1759289-1759311 TACTGCACGGAGAGGGCAGGGGG + Intronic
900266383 1:1759346-1759368 TACTGCACGGAGAGGGCAGGGGG + Intronic
900980665 1:6044377-6044399 GACTTCACGGAGAAGGCAGCAGG + Intronic
901078827 1:6572128-6572150 GAGGGCAGGGAGAGGCCAGCAGG - Intronic
901081685 1:6587346-6587368 CTGTGCCCAGAGTGGGCAGCCGG + Intronic
901420981 1:9150894-9150916 CAGTGAACTGTGAGGCCAGCTGG - Intergenic
903352622 1:22727168-22727190 CAGAGCAGGGAGAGGCAAGCTGG + Intronic
903690621 1:25170773-25170795 GTGTGCAGGGAGGGGGCAGCAGG - Intergenic
903959537 1:27047911-27047933 CAGGGCCCGGACAGGCCAGCGGG + Intergenic
904420694 1:30389363-30389385 CAGGGCAGGGTGAGGCCAGCAGG + Intergenic
904617905 1:31759898-31759920 CATTGCACAGAGAGGGAAACAGG - Intronic
906249647 1:44301295-44301317 CAGTGCACAGTGGGGGCAGGGGG - Intronic
906254798 1:44339964-44339986 CAGTGCCTGGAGAGCACAGCTGG + Intronic
906380510 1:45329401-45329423 GACTGCACGGAGAGGACACCTGG + Exonic
907459117 1:54594707-54594729 CTGTGCATGGGGAGGGTAGCTGG + Intronic
912440168 1:109691675-109691697 GAGTGCAGTGAGAGGGCTGCAGG + Intronic
912572025 1:110631779-110631801 AAGTGTATGGAGAGGGTAGCAGG + Intergenic
912948816 1:114106582-114106604 CAGAGAAGGGAGAGAGCAGCAGG - Intronic
913209352 1:116570450-116570472 CACCGCGCGGGGAGGGCAGCAGG + Intronic
913960586 1:143335759-143335781 AAGGCCATGGAGAGGGCAGCTGG + Intergenic
914054940 1:144161331-144161353 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
914124206 1:144805030-144805052 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
914984249 1:152442550-152442572 CAGTGCACTGAGCGGGAAGAGGG - Intergenic
915267837 1:154731592-154731614 CAGTGCAAAGGGAGGGCCGCAGG - Intronic
915288411 1:154867413-154867435 CAGCCCACTGAGAGAGCAGCCGG + Intronic
915342654 1:155184856-155184878 CACTGCAGGGGGACGGCAGCGGG - Exonic
916074232 1:161191105-161191127 CGGTGCCCAGAAAGGGCAGCCGG + Exonic
916496538 1:165353038-165353060 CAGTGCGCGGGGAGCGCTGCGGG + Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
920092700 1:203465605-203465627 CGGTGCCCAGAGAGGGTAGCAGG - Intergenic
920135195 1:203763900-203763922 CAGTACACGGAAAGGGCACATGG - Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920421508 1:205837557-205837579 CTGTGCACAGGGAGTGCAGCAGG + Intronic
920577499 1:207072325-207072347 CTGGGCACGGAGAGGGCTGAGGG - Exonic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
924261719 1:242238324-242238346 AAGTGCAGGAAGAGGGTAGCAGG - Intronic
924619555 1:245648950-245648972 CAGGGCAGGGCAAGGGCAGCTGG - Intronic
924710623 1:246527627-246527649 CAGCTCACAGAGAGGGCCGCTGG + Intergenic
1063388170 10:5630040-5630062 CAGTGCACAGCCTGGGCAGCTGG + Intergenic
1063602965 10:7498640-7498662 CAGAAAACGGAGAGGGCAGTTGG + Intergenic
1064981918 10:21173984-21174006 GAGTGCACGGGGAGGGCGACGGG + Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065709907 10:28506049-28506071 GGGTGCAGGGAGAGGGGAGCAGG - Intergenic
1067029016 10:42868015-42868037 CAGGCCACGGAGAGGGCAGCTGG + Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1068287772 10:54962269-54962291 CAGTGCCAGCAGAGAGCAGCAGG - Intronic
1069050238 10:63784966-63784988 CAGTACTCTGAGAGGGCATCAGG - Intergenic
1069677726 10:70260465-70260487 AAGTTTAGGGAGAGGGCAGCTGG + Intronic
1070856196 10:79609935-79609957 CAGTGCAGGGTGGGGGCAGGTGG - Intergenic
1070976331 10:80608834-80608856 CAGTGAACAGAGAGAGAAGCTGG - Intronic
1072240512 10:93491311-93491333 GAGTCCACGTAGAGGGCAGGAGG + Intergenic
1072481198 10:95810432-95810454 CACTTCCCGGATAGGGCAGCCGG + Intronic
1074104511 10:110378338-110378360 CAGCACACAGAGAGGGAAGCAGG - Intergenic
1075443952 10:122500985-122501007 CAGGGCACACAGAGGTCAGCGGG - Intronic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1077180075 11:1208379-1208401 GAGTGCACAGACAGGGCGGCCGG + Intergenic
1077244031 11:1527259-1527281 CAGAGCATGGAGACGGCAGTGGG - Intergenic
1077394970 11:2316211-2316233 CAGTCCTGTGAGAGGGCAGCAGG - Exonic
1078353896 11:10618964-10618986 GAGTGCAGGGAGAGGGGACCAGG + Intronic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1081812944 11:45923355-45923377 CAGTGTGCGGAGGGGGCAGCAGG - Intronic
1083632688 11:64103955-64103977 CAGGGCACAGAGAGGGGATCCGG - Exonic
1083751737 11:64764750-64764772 CACTTCATGGAGAGGGAAGCGGG + Exonic
1084088264 11:66864660-66864682 AAGGGCGAGGAGAGGGCAGCGGG + Intronic
1084268966 11:68019139-68019161 CAGTGCAGGGAGAGAGCTGGAGG - Intronic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085453751 11:76654537-76654559 AAGTTCACGGAAAGCGCAGCTGG + Intergenic
1085697248 11:78715448-78715470 CAGTGCAGGGAGACAGGAGCTGG - Intronic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089662467 11:119994335-119994357 TATTGCAAGGAGAAGGCAGCAGG + Intergenic
1090785621 11:130044810-130044832 CAGTGAGCCGAGATGGCAGCAGG + Intergenic
1091139707 11:133224382-133224404 CCGTGCCCGAAAAGGGCAGCTGG + Intronic
1091740316 12:2956596-2956618 CAGGGGACGGAGAGGAAAGCAGG - Intergenic
1091799533 12:3316220-3316242 CAGCACCCAGAGAGGGCAGCAGG + Intergenic
1093699371 12:22201590-22201612 CGGTGCACTGAGAATGCAGCTGG - Exonic
1095415122 12:41968232-41968254 CAGCGCACTGGGAGGGCACCAGG - Intergenic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1096800301 12:54106337-54106359 GAGTCCTCGGAGCGGGCAGCCGG + Intergenic
1100796246 12:98184834-98184856 CAGTTCACGTAGAGGGATGCAGG - Intergenic
1101364175 12:104056152-104056174 CAAAGCATAGAGAGGGCAGCTGG - Intronic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1103414748 12:120736739-120736761 CTGTGGACGGAGCGGGGAGCAGG + Intronic
1103853937 12:123951602-123951624 AAGTGCACAGAGAGGGCAGCAGG - Intronic
1104595951 12:130120108-130120130 CGGTGCAGGGAGGGCGCAGCTGG - Intergenic
1105256218 13:18745325-18745347 CAGTGCACTGAGGGTGCACCTGG + Intergenic
1105604801 13:21918048-21918070 CAATAAAGGGAGAGGGCAGCCGG - Intergenic
1105913322 13:24891292-24891314 CTGGGCAGGGAGAGGCCAGCAGG - Intronic
1106080389 13:26495843-26495865 CAGAGCTTGGAGAGGACAGCTGG + Intergenic
1106486693 13:30179068-30179090 CTCTGCACAGAGAAGGCAGCTGG - Intergenic
1107446718 13:40475888-40475910 CAGTGAGCTGGGAGGGCAGCAGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1112329716 13:98467960-98467982 CAGTGCACAGTGAGAACAGCAGG - Intronic
1113630097 13:111876424-111876446 CGGTGCACACAGAGGGCAGTGGG + Intergenic
1113743933 13:112729727-112729749 CAGGCCACGGTGAGGCCAGCAGG + Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119804774 14:77475552-77475574 CACTGCAGGGAGAGGGCAGGCGG - Exonic
1119829259 14:77686479-77686501 TAGTGCCTGGAGAAGGCAGCAGG - Intronic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1121597223 14:95173574-95173596 CAGGGCAGGGACAGGACAGCAGG - Intergenic
1122124383 14:99571156-99571178 CAGTGCAGTGAGGGGCCAGCCGG + Intronic
1122628617 14:103097353-103097375 CAGTGCCCGGAGAGTCCAGGGGG - Intergenic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1123142376 14:106093960-106093982 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123149697 14:106169163-106169185 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123163929 14:106307796-106307818 CTGAGCACATAGAGGGCAGCAGG + Intergenic
1202848794 14_GL000225v1_random:2490-2512 AAGGGCACAGAGAGGCCAGCTGG - Intergenic
1202852910 14_GL000225v1_random:31957-31979 AAGGGCACAGAGAGGCCAGCGGG - Intergenic
1202853983 14_GL000225v1_random:38258-38280 AAGGGCACGGAGAGGTCAGCGGG - Intergenic
1202855072 14_GL000225v1_random:44699-44721 AAGGGCACAGAGAGAGCAGCGGG - Intergenic
1202857868 14_GL000225v1_random:63019-63041 AAGGGCACCGAGAGGCCAGCGGG + Intergenic
1202922314 14_KI270723v1_random:36568-36590 AAGGGCACAGAGAGGCCAGCGGG - Intergenic
1125936739 15:43643393-43643415 CAGTGAGCCGAGATGGCAGCTGG - Intronic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1129746751 15:78027248-78027270 AAGGGCACGGGGATGGCAGCTGG + Intronic
1130461922 15:84165362-84165384 CAATGCAGGGAGAGCCCAGCCGG - Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130970199 15:88726377-88726399 CAGAGGAGGGTGAGGGCAGCGGG + Intergenic
1131721188 15:95170582-95170604 CAGTACACAGGCAGGGCAGCAGG + Intergenic
1132478410 16:153806-153828 CGGTGCTCGGAGAGGGCCGCAGG + Intronic
1132480495 16:164396-164418 CGGTGCTCGGAGAGGGCCGCAGG + Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132752653 16:1465887-1465909 CAGGGCAGGGGCAGGGCAGCGGG + Intronic
1132838968 16:1968996-1969018 AAATGCCTGGAGAGGGCAGCAGG - Intergenic
1132876871 16:2143896-2143918 CATTTCATGGAGAGGGGAGCAGG + Intronic
1133256925 16:4522775-4522797 CCCTGCAGGGACAGGGCAGCGGG + Intronic
1133524056 16:6587176-6587198 CAGTGCGGAGAGAGGGGAGCTGG - Intronic
1134245122 16:12534055-12534077 CAGTGCAGAGTGAGGGCAGCAGG + Intronic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1136517158 16:30775067-30775089 CAGTGCCCGGAGAGGCCAGAGGG + Exonic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138454935 16:57115764-57115786 CAGTGCAGGGAGGGGGCTGCTGG - Intronic
1139516007 16:67452775-67452797 GACTGCACGGGGAGGGCACCTGG - Intronic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1141099270 16:81185202-81185224 CAGGGCAGGGAAGGGGCAGCTGG - Intergenic
1141920895 16:87134652-87134674 CAGTGCATGGACACGGCAGGCGG - Intronic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142200581 16:88759421-88759443 CAGGCCAGGGGGAGGGCAGCTGG - Intronic
1143301116 17:5911314-5911336 CAGTGCACAGAGTGTGGAGCAGG + Intronic
1143411321 17:6711177-6711199 CACAGCACGGGCAGGGCAGCTGG - Intronic
1143893005 17:10116612-10116634 AAGTGGACTTAGAGGGCAGCTGG + Intronic
1144179076 17:12734974-12734996 CCGTGCAAGGACAGGGCAGGGGG - Intronic
1144262762 17:13539012-13539034 TAGTTGACGGAGAGGTCAGCTGG + Intronic
1144702044 17:17346476-17346498 CAGGGCACGGAGAGGGAAGTCGG + Intronic
1145309058 17:21691601-21691623 CAGTGCCTGGAGAGTGAAGCTGG + Intergenic
1146632581 17:34481496-34481518 CACTGCAAGAAGAGGGCAGGCGG - Intergenic
1147652565 17:42070909-42070931 CAGTGCTGGGAGAGGGCAGTGGG - Intergenic
1148745231 17:49914296-49914318 CAGTCCTGGGAGAGAGCAGCCGG - Intergenic
1148795583 17:50195192-50195214 CAGTGCATGGGGTGGGCAGAAGG + Intronic
1148866075 17:50629368-50629390 CAGGCCACAGAGAGGGCTGCTGG - Intergenic
1149561587 17:57611444-57611466 CAGTGAGCTGACAGGGCAGCAGG - Intronic
1150640855 17:66948506-66948528 CAGTGCCGAGAGAGGGCAGTTGG - Intergenic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151817440 17:76478240-76478262 CAGTGCTTTGAGGGGGCAGCAGG - Intronic
1151913458 17:77100244-77100266 CAGTGCTCGGAGGGTGCAGAAGG - Intronic
1151915008 17:77111482-77111504 CAGTGCAAGCAGCCGGCAGCCGG + Intronic
1151970553 17:77455391-77455413 CAGAGCAGGGCGGGGGCAGCAGG - Intronic
1152446855 17:80349925-80349947 CTGGGGAGGGAGAGGGCAGCAGG - Intronic
1154047761 18:10922739-10922761 GAGTGCATGGAGAGGCAAGCTGG + Intronic
1154158012 18:11959118-11959140 CAGTGAGCCGAGATGGCAGCAGG - Intergenic
1154173171 18:12065544-12065566 GAGTGCATGGAGAGGCAAGCTGG - Intergenic
1155171143 18:23267586-23267608 CAGTGCAGGGAGTGGGCAGCCGG - Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156476244 18:37407261-37407283 CACTCCAGGGAGAGGGCTGCTGG + Intronic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159947799 18:74457099-74457121 CAGCGCTCGGAGAGGACACCCGG + Exonic
1160039862 18:75335809-75335831 CAGTGCAGTGAGTGGGCAGTGGG - Intergenic
1160137481 18:76284945-76284967 AGGTTCACAGAGAGGGCAGCAGG - Intergenic
1160912472 19:1481324-1481346 CAGTCCATGGAGAATGCAGCCGG - Intergenic
1160972074 19:1773986-1774008 CAGATCACGGAGAGGGCTGAAGG - Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163860872 19:19742294-19742316 CAGTGCACTGAGGGTGCACCTGG - Intergenic
1165333812 19:35155458-35155480 CAGGGCAGGGAAAGGGCTGCAGG + Exonic
1165444992 19:35851687-35851709 CGGTGCAAGGAAAGGGCAGAGGG + Intronic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167529098 19:50003835-50003857 CAGTGCAGGGAGAGCGGGGCTGG - Intronic
1202694422 1_KI270712v1_random:114006-114028 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
924996577 2:366964-366986 AAGTGCACAGAGGTGGCAGCCGG - Intergenic
925201361 2:1969733-1969755 CAGTGTCCAGAGAGGGCTGCAGG - Intronic
925788138 2:7452923-7452945 AAGTGCATGGAGAGTGCATCCGG + Intergenic
925919377 2:8628512-8628534 CATGGCACGGAGAAGGCAGTTGG + Intergenic
927813571 2:26194420-26194442 CTGTGCAGAGAGAGGGCACCAGG + Intronic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
930124280 2:47783705-47783727 CTGTGCAGGAAGAGGGCTGCAGG + Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
931516305 2:63052308-63052330 CTGGGCACAGAGAGGTCAGCTGG + Intronic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932449165 2:71798703-71798725 CACTGCAGGGAGAGGACAGTGGG - Intergenic
933952139 2:87340558-87340580 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934236383 2:90236896-90236918 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
935676383 2:105598097-105598119 CAGTGCACAGAGTGGGAGGCAGG - Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937088589 2:119189435-119189457 CATAGCACTGAGAGAGCAGCTGG - Intergenic
937961853 2:127466182-127466204 CAGTGCACAGAGAGGCCATGGGG - Intronic
938279125 2:130052104-130052126 CAGTGCACTGAGGGTGCACCTGG + Intergenic
938330113 2:130442980-130443002 CAGTGCACTGAGGGTGCACCTGG + Intergenic
938359832 2:130678523-130678545 CAGTGCACTGAGGGTGCACCTGG - Intergenic
938373878 2:130791526-130791548 CAGCACACTGAGAGGGAAGCTGG + Intergenic
938436244 2:131285244-131285266 CAGTGCACTGAGGGTGCACCTGG - Intronic
943657614 2:190526266-190526288 CAGGGCACTGAGGGGACAGCAGG - Intronic
943697137 2:190948943-190948965 CAGGGCACTGTGTGGGCAGCTGG + Intronic
945110811 2:206357684-206357706 CAGTGAGCCGAGATGGCAGCAGG + Intergenic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
946394084 2:219434742-219434764 CCGTGGAGGGAGGGGGCAGCAGG - Intergenic
946397133 2:219448817-219448839 CGCTGCTCGGAGAGGGCGGCTGG - Exonic
946526919 2:220530614-220530636 CAGTGCTGGGAGTGGGCAGTGGG - Intergenic
947797648 2:232905168-232905190 CAGTGAGCCGAGATGGCAGCAGG - Intronic
948804293 2:240446837-240446859 CAGAGGACGGAGAGGGGACCAGG + Intronic
948856857 2:240734272-240734294 CCTTGCAGGGAGAGGGGAGCGGG + Intronic
949052318 2:241903828-241903850 CTGGGCATGGGGAGGGCAGCTGG - Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169729114 20:8767411-8767433 AAGTGCTGGGAGATGGCAGCTGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1171278574 20:23878643-23878665 CTGTGCAGGGAGAGGGCTGCAGG + Intronic
1171880956 20:30617076-30617098 CAGTGCACTGAGAGTGCACCTGG + Intergenic
1171882961 20:30631590-30631612 CAGTGCACTGAGCGTGCACCTGG + Intergenic
1172408350 20:34705117-34705139 CAGTGCATGGAAGGGGCAACAGG + Intronic
1172693626 20:36807119-36807141 CACTGCAGGGCCAGGGCAGCAGG + Intronic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173849398 20:46208343-46208365 CAGAGCAGGGATGGGGCAGCTGG - Intronic
1174031944 20:47635942-47635964 CAGGGCACTGAGAGAGCTGCTGG - Exonic
1174053677 20:47784564-47784586 CGGTTCACTGGGAGGGCAGCAGG - Intronic
1174863622 20:54114846-54114868 CAGACCAGGGAGAGGCCAGCAGG + Intergenic
1175142957 20:56874136-56874158 CAATGCACGGAAAGGCGAGCCGG - Intergenic
1175900294 20:62357361-62357383 CACTGCTCGGACAGGGCACCGGG + Intronic
1176098941 20:63356294-63356316 CAGGGCCAGGACAGGGCAGCAGG + Intronic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1180018573 21:45104143-45104165 AAGTGGAAGGAGAGGGTAGCAGG - Intronic
1180149200 21:45939121-45939143 CAGGGCACCAGGAGGGCAGCTGG - Intronic
1180853498 22:19032970-19032992 GAGAGCAAGGTGAGGGCAGCTGG - Intergenic
1180945118 22:19688486-19688508 CCGGGCAGGGAGAGGGCAGTGGG - Intergenic
1182473755 22:30564596-30564618 CAGTGCAGGCAGCTGGCAGCAGG + Intronic
1182624753 22:31637784-31637806 CAGTGCCGGGTGAGGGGAGCGGG - Intronic
1182937685 22:34241207-34241229 CAGTACATGGAGAGGGCATGTGG + Intergenic
1183379947 22:37485733-37485755 CAGGGCACGGGCAGGGCCGCAGG + Intronic
1183706111 22:39475744-39475766 GACTGAACGGAGAGGGCAGGAGG - Intronic
1184235382 22:43180425-43180447 GAGTCCCCGGAGAGGCCAGCAGG + Intronic
1184438860 22:44496914-44496936 CCGTGCCCGCAGAGGCCAGCTGG + Exonic
1184458322 22:44623931-44623953 CAGCACACAGAGAGGGCAGGCGG - Intergenic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185045629 22:48527402-48527424 CAGGGCAAGGCCAGGGCAGCAGG + Intronic
1185202967 22:49519520-49519542 CAGTGCACGCAGTTGGCAGCCGG - Intronic
949859456 3:8492203-8492225 CAGGGCACTGAGAGGACAGTAGG + Intergenic
950339932 3:12234204-12234226 CTGTGCAAAGAAAGGGCAGCTGG - Intergenic
950637524 3:14325217-14325239 CAGAGCAGGGAGAGGGCTGGAGG - Intergenic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
953357294 3:42266000-42266022 CGGTGCACGGAGAGGGCGAGGGG - Exonic
953890512 3:46748891-46748913 CAGTGCAGGGACAGGGTGGCAGG + Intronic
954294336 3:49665867-49665889 CAGCTCAGGGAGAGGGCAGAAGG + Intronic
955055951 3:55456310-55456332 CAGTGAGCAGAGAAGGCAGCTGG - Intergenic
955709624 3:61764652-61764674 CATTGCAGGTAGAGGGAAGCGGG + Intronic
957476719 3:80734838-80734860 CAGTGCAGCCAGAGGGCTGCTGG - Intergenic
958921737 3:100114297-100114319 CACTGCCCGGAGAGGGAAGAGGG - Exonic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
960054765 3:113269266-113269288 CAGTGGACAGACACGGCAGCAGG + Intronic
960159491 3:114334436-114334458 CAGAGCACAGACAGGACAGCTGG + Intergenic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
963733182 3:148991832-148991854 GAGTGCAGGGATGGGGCAGCCGG + Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
967539999 3:190656293-190656315 CAGAGCTCAGAGAGGGCTGCAGG + Exonic
967869053 3:194214540-194214562 CAGTGCATAGGGAGGGCAGCTGG + Intergenic
967942509 3:194777052-194777074 CACTGGAGGGAGAGGGCTGCGGG + Intergenic
968442117 4:629327-629349 GAGTTCACAGCGAGGGCAGCTGG + Intronic
968704772 4:2072757-2072779 CAGTGAACAGGGACGGCAGCCGG - Intronic
968826955 4:2905650-2905672 CAGTCCATGCAGAGGGCAGCTGG - Intronic
968973995 4:3811639-3811661 CAGTGCAGGGAGGGGGGTGCTGG + Intergenic
969579882 4:8058485-8058507 CAGTGCTCCCAGAGGCCAGCTGG - Intronic
969618509 4:8267338-8267360 CAGTGCAGGGCGGGAGCAGCAGG + Intergenic
969640375 4:8394819-8394841 CAGTGCAGGGAGAGGCCGTCAGG + Intronic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
971384733 4:26132565-26132587 CAGTGCAGCGGGAGGGCAGGTGG - Intergenic
972551935 4:40142017-40142039 CAGTGAGCCGAGATGGCAGCAGG + Intronic
973366642 4:49213994-49214016 CAGTGCACTGAGGGTGCACCTGG + Intergenic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
979685763 4:123508840-123508862 CAGAGCACAGAGGGGGCACCCGG + Intergenic
982098130 4:151942102-151942124 CAGTACACAGACAGGGCAGTCGG - Intergenic
985701778 5:1377956-1377978 CAGAGCGCTCAGAGGGCAGCGGG - Intergenic
991114263 5:62935864-62935886 CAGGGCAGCGAGAGGTCAGCAGG + Intergenic
992662490 5:78975174-78975196 GAGTCCACTGAGAGGCCAGCAGG + Intronic
995256796 5:110056176-110056198 CAGAGAAGGGAGAGAGCAGCTGG + Intergenic
997076888 5:130689552-130689574 GAGTGGACGGAGAGGGCTGGTGG - Intergenic
997609644 5:135206657-135206679 CAGTGGAGGAAGAGAGCAGCAGG - Intronic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
998399457 5:141841037-141841059 CAAGGCACGCGGAGGGCAGCAGG - Intergenic
998976004 5:147648731-147648753 CAGGGCAGGGAGAGTGCAGAGGG + Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999371818 5:151060265-151060287 CAGGACACAAAGAGGGCAGCAGG + Intronic
1001057866 5:168464352-168464374 CAGTGTACAGAGAGGGCGGGTGG + Intronic
1001600333 5:172924175-172924197 TAGTGCCCAGAGAGGGCAGAGGG - Intronic
1002194447 5:177494631-177494653 CAGAGCGTGGGGAGGGCAGCAGG + Intronic
1002295751 5:178230237-178230259 CAGAGCAGGGAGAGAGAAGCTGG + Intronic
1002591111 5:180292107-180292129 CAGCGCGCGGAGAGCGGAGCAGG + Intergenic
1004836457 6:19537197-19537219 CATGGATCGGAGAGGGCAGCTGG + Intergenic
1006358516 6:33574449-33574471 CGGGGCACAGAGAGGGCAGAGGG + Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1011041587 6:83035253-83035275 CAGGGTAAGGAGTGGGCAGCAGG - Intronic
1011148807 6:84245543-84245565 CAGTGAGCCGAGATGGCAGCAGG + Intergenic
1013161010 6:107544862-107544884 CAGAGCAGGCAGAGGCCAGCAGG - Intronic
1013482806 6:110566661-110566683 CAGTGCCCTGAGATGGAAGCAGG - Intergenic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017852202 6:158314490-158314512 CAGTGCAGGGAGAGGACAGCAGG - Intronic
1018371308 6:163170661-163170683 CAGTGCAAGGTGGGGGAAGCTGG - Intronic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1019429751 7:993202-993224 CAGGGCAGGGGGACGGCAGCTGG + Intergenic
1019623487 7:2003725-2003747 CAGGGCAGTGTGAGGGCAGCAGG - Intronic
1019645635 7:2127367-2127389 AGGGGCAAGGAGAGGGCAGCAGG + Intronic
1019999940 7:4749917-4749939 CAGTGCAGGGAGACTGCAGAGGG - Intronic
1022974746 7:35546842-35546864 CAGGGCAGGGAGAGTGCAGAGGG - Intergenic
1023366394 7:39468277-39468299 CCGTGCCCGGAGCAGGCAGCAGG + Intronic
1023635505 7:42205505-42205527 CAAAGAACAGAGAGGGCAGCTGG + Intronic
1023909626 7:44544186-44544208 CAGTTCACTGAGGGAGCAGCCGG + Intergenic
1027232555 7:76281398-76281420 CAGGGCACGGAGGGGGGAGAGGG - Intronic
1027633305 7:80636164-80636186 CAGAGAACGGAGAGGGGAGGAGG + Intronic
1029623844 7:101707350-101707372 GAGGACTCGGAGAGGGCAGCAGG - Intergenic
1030106864 7:105994917-105994939 CAGTGCAACCTGAGGGCAGCTGG + Intronic
1030347328 7:108449358-108449380 CAGTGAAGGGAGGGGGGAGCTGG - Intronic
1034297896 7:149990392-149990414 CAGTGCAGGGACAGAGCAGTGGG + Intergenic
1034343326 7:150371484-150371506 CAGGGCAGGGCAAGGGCAGCCGG - Exonic
1034808128 7:154106461-154106483 CAGTGCAGGGACAGAGCAGTGGG - Intronic
1034837926 7:154369743-154369765 CTGGGCACAGAGAGGCCAGCTGG - Intronic
1035031473 7:155863774-155863796 CACTGCCCTGTGAGGGCAGCTGG + Intergenic
1035418474 7:158708075-158708097 CAGTGAACGGTGATGGCAGCGGG - Intergenic
1035770679 8:2144482-2144504 CAGAGCAGGCAGAGGACAGCAGG - Intronic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1036656739 8:10681813-10681835 CAGTGGAGGCACAGGGCAGCCGG + Intronic
1037750941 8:21682023-21682045 GAGTGGGTGGAGAGGGCAGCTGG + Intergenic
1038459203 8:27702377-27702399 CAGTGCCAGGACTGGGCAGCGGG - Intergenic
1041151848 8:54943577-54943599 CAGTGCTTGGAGTGGCCAGCTGG - Intergenic
1047367222 8:124222648-124222670 CAGTGGAAGGAGAGGGTAACAGG - Intergenic
1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG + Exonic
1047543866 8:125796989-125797011 CAGTGCATGTGGAGGGCAGGAGG + Intergenic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049212249 8:141392164-141392186 CCGTGCCCGGAGCGGGCGGCGGG - Intronic
1049532462 8:143161116-143161138 CAGGGCAGGGCTAGGGCAGCAGG - Intergenic
1049574254 8:143383162-143383184 CTGTGCACAGACAGGACAGCAGG - Exonic
1049823041 8:144647737-144647759 CCGTGCCAGGGGAGGGCAGCTGG + Intergenic
1052824992 9:33167709-33167731 GAGAGAACGGAGAGGACAGCTGG + Intergenic
1052880547 9:33598914-33598936 CAGTGCACTGAGGGTGCACCTGG - Intergenic
1053916363 9:42947835-42947857 CAGTGCACTGAGAATGCACCTGG - Intergenic
1056585541 9:87925116-87925138 CAGTGCACTGAGGGTGCAACTGG + Intergenic
1056611338 9:88127828-88127850 CAGTGCACTGAGGGTGCAACTGG - Intergenic
1057519880 9:95752151-95752173 CGGGACACTGAGAGGGCAGCGGG - Intergenic
1057675317 9:97132654-97132676 CAGTGCACTGAGGGTGCACCTGG + Intergenic
1058930645 9:109715550-109715572 CACTGCAGGGAGTGGACAGCAGG - Intronic
1059214738 9:112550591-112550613 CAGTGCAGGGAAAAGGCAGACGG + Intronic
1059312291 9:113396831-113396853 CAGGGCAGGAAGAGGGCAGTGGG + Intronic
1060182762 9:121545670-121545692 CAGTGCGAGGGGAGGGCCGCTGG + Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1061056487 9:128225465-128225487 CAGTGCATGGCCTGGGCAGCTGG + Intronic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061297526 9:129685056-129685078 CAGCCCAGGGAGAGGGCAGGAGG - Intronic
1061444814 9:130631849-130631871 CAGGGCACTGAGGGGGCAGTCGG - Intronic
1061864470 9:133485270-133485292 CCGTGCAGGGGGAGGGCAGCTGG + Intergenic
1061902194 9:133678623-133678645 CACTGCACGGAGAGGCCAAGGGG + Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062614649 9:137390882-137390904 CAGTGGACGCTGAGGGCAGGGGG + Intronic
1062726775 9:138078576-138078598 CAGTGTACGGGGAAAGCAGCTGG + Intronic
1185752921 X:2628411-2628433 CAGTGCATGGTGAGAGAAGCAGG + Intergenic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192204808 X:69088756-69088778 CAGGGCTCGGGGAGGGCTGCGGG + Intergenic
1193485396 X:82080332-82080354 CAGTGCCTGGAGTGGCCAGCCGG - Intergenic
1195217089 X:102712859-102712881 CTGTGCCCGGAGAGGGCTGTGGG + Intronic
1195520361 X:105822476-105822498 CGGTGCAAGGAGAGGGGACCCGG - Intergenic
1199610201 X:149606411-149606433 CAGTGCACTCACAGGGCACCAGG - Intronic
1199763512 X:150923960-150923982 CAATGCACGGGCAGGGCTGCAGG + Intergenic
1199785329 X:151100132-151100154 CCATGCACAGAGAAGGCAGCTGG + Intergenic
1201176086 Y:11308808-11308830 AAGGGCACAGAGAGGCCAGCGGG - Intergenic