ID: 971297525

View in Genome Browser
Species Human (GRCh38)
Location 4:25410958-25410980
Sequence CAAGTGGCAGAAATTGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971297525_971297529 30 Left 971297525 4:25410958-25410980 CCTATAGCAATTTCTGCCACTTG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 971297529 4:25411011-25411033 ATGAATGAATGAATGAATGAGGG 0: 97
1: 206
2: 540
3: 1650
4: 5630
971297525_971297528 29 Left 971297525 4:25410958-25410980 CCTATAGCAATTTCTGCCACTTG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 971297528 4:25411010-25411032 AATGAATGAATGAATGAATGAGG 0: 115
1: 148
2: 388
3: 1100
4: 2984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971297525 Original CRISPR CAAGTGGCAGAAATTGCTAT AGG (reversed) Intronic
901284026 1:8062189-8062211 CAAGTGGCAAAATGTGATATGGG - Intergenic
907039460 1:51245523-51245545 CAGGTGGCAGAAGTTGCAGTGGG - Intronic
908391828 1:63690258-63690280 CAAGTAGCAGAAACTGATTTTGG + Intergenic
908471562 1:64449013-64449035 CAAGTGGCAGAGATTATTCTGGG - Intergenic
908484343 1:64575908-64575930 CAAATGACAGAAATGTCTATGGG + Intronic
909417445 1:75423183-75423205 TATGTGTGAGAAATTGCTATAGG - Intronic
911605262 1:99897822-99897844 CATGTGGCAGATATTACTCTAGG - Intronic
911605264 1:99897845-99897867 CATGTGGCAGATATTACTCTAGG - Intronic
912146554 1:106800971-106800993 CAAGTGGCAGAGACAGCCATTGG - Intergenic
912784482 1:112586959-112586981 CAAGAGGCAGAAATAGATTTGGG - Intronic
915691701 1:157696963-157696985 CAAGTGGAAGAAAATGTTCTAGG + Intronic
918038837 1:180899825-180899847 TAAGTGGCAGAAGCTGCTTTAGG - Intergenic
918422149 1:184375106-184375128 CTAGAGGCAGAAGTTGCGATGGG - Intergenic
922863992 1:228843143-228843165 CAAGTAGGAGAAATTTCTAAAGG - Intergenic
1064886487 10:20118940-20118962 ACAGTGTCAGAAATTGCTTTTGG - Intronic
1068031921 10:51715326-51715348 CATGTGTCAGAAATCTCTATAGG + Intronic
1068766482 10:60769821-60769843 AAAGTTGCATACATTGCTATGGG - Intergenic
1071985122 10:91042645-91042667 CAAGTGGAAGAAATTTCCAGTGG + Intergenic
1074351960 10:112746575-112746597 GAAGTGGCAGAAACTGTGATAGG + Intronic
1075289503 10:121216200-121216222 GAAGTGGCAGAAATAGCCCTGGG - Intergenic
1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG + Intergenic
1078964050 11:16316075-16316097 TAAGTGACAGAAAATGCAATGGG - Intronic
1079015923 11:16868635-16868657 CAACAGGCAGAATATGCTATAGG - Intronic
1083017717 11:59473333-59473355 CAAGTGGCTGATTTTGCTGTTGG - Intergenic
1085879005 11:80443426-80443448 CAAGTGGCAGAAAAGGCGGTTGG + Intergenic
1086498127 11:87425022-87425044 GAAGTGTCAGGCATTGCTATGGG + Intergenic
1086856360 11:91870931-91870953 CAAGTGGCATTAATTGTCATCGG - Intergenic
1087009639 11:93501081-93501103 CTAGTGAGAGAAAGTGCTATAGG - Intronic
1087222289 11:95559485-95559507 CAGGTCACAGAACTTGCTATAGG - Intergenic
1087238834 11:95752507-95752529 AAAATGGGAGAAATTCCTATAGG + Intergenic
1094404347 12:30098984-30099006 TAAGTGGTAGAAATAGCTATTGG - Intergenic
1095347211 12:41165191-41165213 CATGTGTCAGATATTGCTCTGGG + Intergenic
1096877682 12:54643401-54643423 CCTGTGGCAGAAGTTGCTACAGG + Intergenic
1097136677 12:56862992-56863014 CAACTGACAGAAATTTCTGTTGG - Intergenic
1097266965 12:57751674-57751696 CCAGTGGCTGAAATTGGTGTCGG - Exonic
1097618422 12:61910714-61910736 AAAGTGGCAGGAATTGTTCTGGG + Intronic
1097837271 12:64285712-64285734 CACGAGGCAGAAATTGCAGTGGG + Intronic
1099357265 12:81653295-81653317 AAAGTGGCATAAAATGGTATTGG - Intronic
1099504526 12:83456458-83456480 TAGATGGCAGAAATTGATATAGG + Intergenic
1102313211 12:111863678-111863700 CAGGAGGCAGAAGTTGCTGTGGG - Intronic
1106964448 13:35044420-35044442 TAAGTGGTAAAAATTGCTAATGG + Intronic
1108772311 13:53718545-53718567 CAAGTGGGAGAAATAGATCTGGG + Intergenic
1112428817 13:99331695-99331717 CAAATGGCAGAAATAACTTTGGG + Intronic
1112739554 13:102457513-102457535 CATGTGGCAGCAATGGCTACAGG + Intergenic
1117077180 14:52116397-52116419 CAAATGGAAGAGTTTGCTATGGG - Intergenic
1117680194 14:58195838-58195860 CAGGAGGCAGAAGTTGCAATGGG + Intronic
1117818494 14:59623109-59623131 AAAGCAGCAGAAATTGCTGTTGG - Intronic
1120844496 14:89114129-89114151 TAAGTGGCAGAAGTTGCCACAGG - Intergenic
1120999013 14:90437987-90438009 AAAGTAGCAGAAATTGCACTGGG - Intergenic
1121996378 14:98606683-98606705 TAAGGAGAAGAAATTGCTATTGG + Intergenic
1122487528 14:102091104-102091126 GAGGGGGCATAAATTGCTATGGG - Intronic
1124130204 15:26976950-26976972 TAAGTGGCAGCAATGGCTCTAGG - Intronic
1127476089 15:59334590-59334612 AAAGTGGCAGAAACTGCTACAGG + Intronic
1129168230 15:73791454-73791476 CAAGTGGCTGAGATTGCAACAGG + Intergenic
1131477685 15:92754182-92754204 CAAGAGGCAGAGATTGCAGTGGG + Intronic
1131913791 15:97238807-97238829 CAAATGGCAAAAGTTGCTTTGGG + Intergenic
1137415551 16:48275019-48275041 CATGAGGCAGAAATTGAAATGGG + Intronic
1144520654 17:15950457-15950479 CAAGTGGCAGAGTTTGCCAGGGG - Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1146017227 17:29243663-29243685 CATGCTGCAGAAATTGCTTTAGG - Intergenic
1146640073 17:34533686-34533708 CCAGCGGCAGAAATTGGAATGGG + Intergenic
1147431228 17:40371975-40371997 CAGGTGAGAGAAATTGCTTTGGG + Intergenic
1147442473 17:40455795-40455817 CAAGTGTCAGAACTTTCAATGGG - Intronic
1149662253 17:58340227-58340249 CACTTGGTAAAAATTGCTATAGG - Intergenic
1203174540 17_GL000205v2_random:184621-184643 CAAGTGGCGGAGTTTGCTGTGGG + Intergenic
1153117282 18:1675074-1675096 CAAGTGGAAGACTTTGCTTTAGG + Intergenic
1153268211 18:3292975-3292997 CTACTGACACAAATTGCTATGGG - Intergenic
1155282949 18:24259348-24259370 CAAAGGGGAGAAATAGCTATTGG - Intronic
1158498405 18:57977870-57977892 CAAGTGGCAAATATTTGTATAGG - Intergenic
1159533433 18:69684762-69684784 CAAGTAGCAGACAATGTTATTGG + Intronic
1164931554 19:32179674-32179696 ACAGTGGCAGAAATGGCTTTGGG - Intergenic
1166274056 19:41739166-41739188 CAAGTGGGAGCACTTGCTCTTGG - Intronic
1167430307 19:49450490-49450512 CAAGAGGCAGAAGTTGCAGTGGG - Intronic
1168062441 19:53900423-53900445 TACGCGGCAGAAATCGCTATCGG + Exonic
1168359078 19:55723228-55723250 CAAGAGGAAGAAATTACTTTGGG + Intronic
927067553 2:19488862-19488884 CAAGTGGAGAAAATTGCTTTGGG - Intergenic
931750391 2:65324966-65324988 CAGTTGGCAAAAAGTGCTATGGG + Intronic
934055749 2:88250119-88250141 ACAGTGGCAGAATTTGCCATAGG - Intergenic
934095057 2:88594112-88594134 CAAGAGCAAGAAAGTGCTATGGG + Intronic
935288094 2:101583332-101583354 CAGGAGGCAGAAATTGCAGTGGG + Intergenic
935392089 2:102563654-102563676 CATGTGGCAGACATTGTTTTAGG - Intergenic
936171326 2:110178862-110178884 TAAGTGGCAGAACTTGGGATTGG - Intronic
938634219 2:133205217-133205239 CAGGAGGCAGAAGTTGCAATGGG + Intronic
941180866 2:162257726-162257748 CAAGTAGAAGAAATTACTAGTGG - Intergenic
943466642 2:188236544-188236566 CAAGTGGCAGTACTTTCTCTTGG + Intergenic
944587474 2:201185390-201185412 CACGTGGCAGAAATAGCACTTGG - Intronic
944977676 2:205075007-205075029 CCAGAGGCAAAAATTGCAATGGG + Intronic
945637889 2:212380788-212380810 CAAATGTCATCAATTGCTATGGG - Intronic
1168796919 20:616667-616689 CAAGTGGAAAAAAATGCTTTTGG - Intergenic
1171164495 20:22958077-22958099 CAAGTGGCTGCAGTTGCTGTAGG + Intergenic
1172871247 20:38136730-38136752 CAAATGGCAGAAAGTGGGATGGG + Intronic
1173744463 20:45425879-45425901 CAAGTGGCAGAAACAGCCCTTGG - Exonic
1177046713 21:16180102-16180124 CAAGTTGCAGAAGTTGCTTAGGG + Intergenic
1179915448 21:44474822-44474844 CATGTGACAAAAAGTGCTATTGG + Intergenic
1183109178 22:35636425-35636447 CAAGTGACAGAAATCACTTTTGG - Intronic
955000487 3:54922946-54922968 GAACTGGCAGACATTGCTAATGG - Intronic
956323950 3:68029884-68029906 CAGCTGTCAGAAATTGGTATGGG + Intronic
956457868 3:69441652-69441674 CATGTGCCAGGAATTGCTGTAGG - Intronic
959433920 3:106289290-106289312 CAAGTAACAAAAATAGCTATTGG - Intergenic
959755081 3:109887651-109887673 CAAGTGGCAAAAATAGGTAAGGG + Intergenic
960929264 3:122828061-122828083 CAAGTGGCAGAAAATGAGACTGG + Intronic
961221021 3:125200035-125200057 CCAGTGGCAGTCATTGCTAATGG - Intronic
963013142 3:140794316-140794338 GAAGGAGCAGAAACTGCTATGGG + Intergenic
963240166 3:142995124-142995146 CAAGTGTCAGAAGATGCTAATGG + Intronic
966514689 3:180805872-180805894 AAAGTGGCACAACTTGCTAGGGG - Intronic
967633583 3:191775660-191775682 TAAATGGCAGAGATTGCCATTGG - Intergenic
971057535 4:22930626-22930648 CAAATGGCAGAGAGTTCTATAGG + Intergenic
971203968 4:24544135-24544157 CATGTGGGAGAAATGCCTATGGG + Intronic
971297525 4:25410958-25410980 CAAGTGGCAGAAATTGCTATAGG - Intronic
972775552 4:42236711-42236733 CCAGGGGCAGACATTGCTAATGG - Intergenic
973207019 4:47572183-47572205 CAAGTGGCAGACATTGGGATAGG + Exonic
974106934 4:57480296-57480318 CATGTGGCAGACACTGCTGTAGG - Intergenic
974204224 4:58679327-58679349 CTAGTGGCAAAAATTTCTCTTGG + Intergenic
976346153 4:84003792-84003814 CGAGTGACAGCCATTGCTATTGG - Intergenic
977382439 4:96292837-96292859 CAGTTGGCTGAAATTGTTATTGG + Intergenic
978508343 4:109485736-109485758 AAAGTGGCTGAAATTGGTGTGGG + Intronic
979926725 4:126576782-126576804 TAAGTGGCAGACATTGTTTTAGG + Intergenic
980334038 4:131445380-131445402 CACATGGCAGAACTGGCTATGGG - Intergenic
981129673 4:141144099-141144121 CAAGTAGCAGAAGTTGCTGGGGG + Intronic
982399594 4:154952390-154952412 CATGTGGCAGTAATTTCTTTGGG - Intergenic
983436410 4:167721167-167721189 CAAGGGGCAGAAGTTGCACTCGG - Intergenic
986733971 5:10654594-10654616 CTGGTGGCAGAAATGGCTTTGGG + Intergenic
987077444 5:14397391-14397413 CAAGCGACACAAAGTGCTATTGG - Intronic
987083948 5:14451593-14451615 GAAGTTTGAGAAATTGCTATAGG + Intronic
987166192 5:15201156-15201178 CACGTGGCAGTAATTTCTTTTGG - Intergenic
988888304 5:35583714-35583736 CTAGTGAAATAAATTGCTATTGG + Intergenic
990529172 5:56656829-56656851 CAATTAGCAGAAATTTCCATGGG - Intergenic
991020328 5:61973539-61973561 CAAGAGGGAGGAATTGCTTTGGG + Intergenic
991671017 5:69047580-69047602 CAAGAGGCAGGAATTGGTAATGG + Intergenic
991765480 5:69973137-69973159 GAAGTGGCTGAAATTTGTATAGG - Intergenic
991781842 5:70145020-70145042 GAAGTGGCTGAAATTTGTATAGG + Intergenic
991844716 5:70848209-70848231 GAAGTGGCTGAAATTTGTATAGG - Intergenic
991874285 5:71145331-71145353 GAAGTGGCTGAAATTTGTATAGG + Intergenic
992295275 5:75321389-75321411 CAAGTGGCCGAAACTGCATTTGG - Intergenic
993448821 5:88048148-88048170 CAAGTGGCAAGAATTTCCATGGG - Intergenic
994723034 5:103402480-103402502 TATTTGGCAGAAATTGCTAAAGG - Intergenic
997964400 5:138345961-138345983 CAAGTGGCAAAAACAGCTTTGGG - Intronic
998767135 5:145500629-145500651 CAAGTAACAGAAATTGATTTTGG + Intronic
998903858 5:146882447-146882469 TAAGTGACAGAAAATGATATCGG - Intronic
999067899 5:148711206-148711228 CAAAAGGCAGCAAGTGCTATTGG + Intergenic
1005138436 6:22598655-22598677 GAAGTGGCAGGAAGAGCTATGGG + Intergenic
1005445066 6:25914532-25914554 CAAGTGGCAGGTATTGTTTTAGG - Intronic
1008040015 6:46787709-46787731 AAAGTGGCAGATAATGCAATTGG + Intergenic
1011703281 6:89975224-89975246 GAAGAGGCAGAAATTGCTAATGG + Intronic
1012257107 6:97046916-97046938 CAACTGTTAGAAATAGCTATAGG - Intronic
1016882724 6:148926875-148926897 CAACTAGCAGAATCTGCTATAGG + Intronic
1025038493 7:55618836-55618858 CTAGTGGAAGAAATTTCTAAGGG + Intergenic
1027716218 7:81674008-81674030 AAAGTGTCAGAAAGTGCTATAGG + Intergenic
1027869760 7:83692641-83692663 CAGGTGGCAGAAATTTCTTCTGG + Intergenic
1032719117 7:134536556-134536578 CCTGGGGCAGAAATTGCTAAAGG - Intronic
1032724088 7:134575326-134575348 CCTGGGGCAGAAATTGCTAAAGG - Intronic
1033325575 7:140375078-140375100 CAGGAGGCAGAAGTTGCAATGGG + Intronic
1033408210 7:141091167-141091189 CAAGTTGTATAAAGTGCTATAGG + Intronic
1036467042 8:9008748-9008770 CATGGGGCAGAAATGGCTTTTGG + Intronic
1042372910 8:68013107-68013129 CAAGTGCCAGATATTGCTGTAGG + Intronic
1043010710 8:74878828-74878850 CATGTGGCAGAAACTGCTCTAGG - Intergenic
1046651149 8:116837875-116837897 AGAGTGGAAGAAATTACTATGGG + Intronic
1047471397 8:125176945-125176967 CAGGTGTCAGAAATGCCTATGGG - Intronic
1048110327 8:131461088-131461110 AAAATGGCAGAGATTTCTATGGG + Intergenic
1048340342 8:133533824-133533846 CAAATGACAGAAAATGCTAAAGG + Intronic
1048713362 8:137239013-137239035 CATGGGGCAGAATTTTCTATTGG - Intergenic
1050176564 9:2875295-2875317 CTAGTAACAGAAATTGCGATTGG - Intergenic
1050311273 9:4355234-4355256 CAAGTGGCAGAGTTTGCTTTGGG - Intergenic
1050413586 9:5391260-5391282 CAAGTGCCATAAACTGCAATTGG - Intronic
1051129517 9:13843964-13843986 TAAGTGCCAGACATTGCTCTAGG - Intergenic
1053184842 9:36006968-36006990 CTATGGGCAGAAATTGCCATGGG - Intergenic
1054713576 9:68535704-68535726 GAAGTGGCAGAGATTGCTTTAGG - Intergenic
1054948196 9:70819523-70819545 CAAATGTCAGATATTACTATAGG + Intronic
1056185458 9:84130011-84130033 CAAGTGGCAGAACTGGCCAGTGG + Intergenic
1056677613 9:88688494-88688516 CATGTGGCAGTATTTTCTATTGG + Intergenic
1058036664 9:100259943-100259965 CAGGAGGCAGAAGTTGCAATGGG - Intronic
1058444560 9:105043331-105043353 CAGGTGGCAAAAGTTGCCATGGG + Intergenic
1058928345 9:109691041-109691063 GCAGTGGAAGAATTTGCTATTGG + Intronic
1186132888 X:6487834-6487856 GAGCTGGCAAAAATTGCTATGGG - Intergenic
1186739441 X:12501738-12501760 CAAGTGACAGACAAAGCTATGGG + Intronic
1187249403 X:17583283-17583305 CAGGTGGCGGTAAGTGCTATGGG + Intronic
1195920111 X:109975306-109975328 TAAGTGGCAGAACTGGATATTGG + Intergenic
1198364541 X:135927622-135927644 CAAGGGGCAGAAATTACTGAGGG + Intergenic