ID: 971299485

View in Genome Browser
Species Human (GRCh38)
Location 4:25430001-25430023
Sequence CTGAGTATACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971299485_971299488 29 Left 971299485 4:25430001-25430023 CCATTGTCCATTTGTATACTCAG No data
Right 971299488 4:25430053-25430075 GTCTTGAAATTCTAAACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971299485 Original CRISPR CTGAGTATACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr