ID: 971305114

View in Genome Browser
Species Human (GRCh38)
Location 4:25473289-25473311
Sequence ATGAAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971305109_971305114 8 Left 971305109 4:25473258-25473280 CCGGGCCTGGAACACATATTCTT 0: 1
1: 1
2: 7
3: 84
4: 522
Right 971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG No data
971305108_971305114 11 Left 971305108 4:25473255-25473277 CCTCCGGGCCTGGAACACATATT 0: 1
1: 0
2: 0
3: 13
4: 222
Right 971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG No data
971305110_971305114 3 Left 971305110 4:25473263-25473285 CCTGGAACACATATTCTTTGAGA 0: 1
1: 0
2: 0
3: 15
4: 238
Right 971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG No data
971305107_971305114 16 Left 971305107 4:25473250-25473272 CCACTCCTCCGGGCCTGGAACAC No data
Right 971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971305114 Original CRISPR ATGAAGAAGGAGAAGGAGAA GGG Intergenic
No off target data available for this crispr