ID: 971312439

View in Genome Browser
Species Human (GRCh38)
Location 4:25537022-25537044
Sequence AAAGTCACTCCTTCTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971312432_971312439 26 Left 971312432 4:25536973-25536995 CCCAGGCATTTATACAGAAGAGA No data
Right 971312439 4:25537022-25537044 AAAGTCACTCCTTCTCCCATGGG No data
971312436_971312439 -7 Left 971312436 4:25537006-25537028 CCAAACTCACCAATCAAAAGTCA No data
Right 971312439 4:25537022-25537044 AAAGTCACTCCTTCTCCCATGGG No data
971312433_971312439 25 Left 971312433 4:25536974-25536996 CCAGGCATTTATACAGAAGAGAT No data
Right 971312439 4:25537022-25537044 AAAGTCACTCCTTCTCCCATGGG No data
971312435_971312439 -6 Left 971312435 4:25537005-25537027 CCCAAACTCACCAATCAAAAGTC No data
Right 971312439 4:25537022-25537044 AAAGTCACTCCTTCTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971312439 Original CRISPR AAAGTCACTCCTTCTCCCAT GGG Intergenic
No off target data available for this crispr