ID: 971315797

View in Genome Browser
Species Human (GRCh38)
Location 4:25566965-25566987
Sequence GGAATGGCGTGAACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971315797_971315809 12 Left 971315797 4:25566965-25566987 CCCCCTGGGGTTCACGCCATTCC No data
Right 971315809 4:25567000-25567022 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
971315797_971315807 4 Left 971315797 4:25566965-25566987 CCCCCTGGGGTTCACGCCATTCC No data
Right 971315807 4:25566992-25567014 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
971315797_971315805 3 Left 971315797 4:25566965-25566987 CCCCCTGGGGTTCACGCCATTCC No data
Right 971315805 4:25566991-25567013 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971315797 Original CRISPR GGAATGGCGTGAACCCCAGG GGG (reversed) Intergenic
No off target data available for this crispr