ID: 971324596

View in Genome Browser
Species Human (GRCh38)
Location 4:25633700-25633722
Sequence CACAGGCACGTGTCTTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971324596_971324605 27 Left 971324596 4:25633700-25633722 CCAGCTGAAGACACGTGCCTGTG No data
Right 971324605 4:25633750-25633772 GAATTTGGCTCCCCTCAGTATGG No data
971324596_971324598 -8 Left 971324596 4:25633700-25633722 CCAGCTGAAGACACGTGCCTGTG No data
Right 971324598 4:25633715-25633737 TGCCTGTGTGTGGCAGTCCCTGG No data
971324596_971324601 -1 Left 971324596 4:25633700-25633722 CCAGCTGAAGACACGTGCCTGTG No data
Right 971324601 4:25633722-25633744 GTGTGGCAGTCCCTGGCTGTGGG No data
971324596_971324600 -2 Left 971324596 4:25633700-25633722 CCAGCTGAAGACACGTGCCTGTG No data
Right 971324600 4:25633721-25633743 TGTGTGGCAGTCCCTGGCTGTGG No data
971324596_971324604 12 Left 971324596 4:25633700-25633722 CCAGCTGAAGACACGTGCCTGTG No data
Right 971324604 4:25633735-25633757 TGGCTGTGGGCAGAAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971324596 Original CRISPR CACAGGCACGTGTCTTCAGC TGG (reversed) Intergenic
No off target data available for this crispr