ID: 971327243

View in Genome Browser
Species Human (GRCh38)
Location 4:25654743-25654765
Sequence CTGTGCAAGGGGAAGGACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971327243_971327250 -3 Left 971327243 4:25654743-25654765 CCCGAGTCCTTCCCCTTGCACAG No data
Right 971327250 4:25654763-25654785 CAGTGGAGAGAACTCGATGTTGG No data
971327243_971327252 23 Left 971327243 4:25654743-25654765 CCCGAGTCCTTCCCCTTGCACAG No data
Right 971327252 4:25654789-25654811 GAAACCAGCTAATTCCAGTAGGG No data
971327243_971327251 22 Left 971327243 4:25654743-25654765 CCCGAGTCCTTCCCCTTGCACAG No data
Right 971327251 4:25654788-25654810 TGAAACCAGCTAATTCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971327243 Original CRISPR CTGTGCAAGGGGAAGGACTC GGG (reversed) Intergenic
No off target data available for this crispr