ID: 971327468

View in Genome Browser
Species Human (GRCh38)
Location 4:25655893-25655915
Sequence GAGTACCGCCGCCGGGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971327455_971327468 11 Left 971327455 4:25655859-25655881 CCTCCAGCCCAGCACCTGCGGAG 0: 1
1: 0
2: 2
3: 48
4: 371
Right 971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
971327459_971327468 4 Left 971327459 4:25655866-25655888 CCCAGCACCTGCGGAGGGAGCGC 0: 1
1: 0
2: 1
3: 31
4: 233
Right 971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
971327458_971327468 8 Left 971327458 4:25655862-25655884 CCAGCCCAGCACCTGCGGAGGGA 0: 1
1: 1
2: 5
3: 242
4: 820
Right 971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
971327462_971327468 -3 Left 971327462 4:25655873-25655895 CCTGCGGAGGGAGCGCTGGTGAG 0: 1
1: 0
2: 0
3: 17
4: 147
Right 971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
971327452_971327468 17 Left 971327452 4:25655853-25655875 CCGCCGCCTCCAGCCCAGCACCT 0: 1
1: 0
2: 9
3: 128
4: 1208
Right 971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
971327460_971327468 3 Left 971327460 4:25655867-25655889 CCAGCACCTGCGGAGGGAGCGCT 0: 1
1: 0
2: 26
3: 181
4: 547
Right 971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
971327453_971327468 14 Left 971327453 4:25655856-25655878 CCGCCTCCAGCCCAGCACCTGCG 0: 1
1: 1
2: 11
3: 81
4: 724
Right 971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
971327451_971327468 22 Left 971327451 4:25655848-25655870 CCTGGCCGCCGCCTCCAGCCCAG 0: 1
1: 1
2: 7
3: 94
4: 746
Right 971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
971327450_971327468 25 Left 971327450 4:25655845-25655867 CCACCTGGCCGCCGCCTCCAGCC 0: 1
1: 1
2: 4
3: 93
4: 669
Right 971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971327468 Original CRISPR GAGTACCGCCGCCGGGGCAG GGG Intronic
900586673 1:3435929-3435951 GGGTGGCCCCGCCGGGGCAGCGG + Exonic
900605330 1:3521229-3521251 GAGGACCGAGGCCTGGGCAGAGG + Intronic
902923134 1:19679156-19679178 GAGTCCGGCGGCAGGGGCAGCGG - Exonic
905639078 1:39576380-39576402 GATTACAACCGCCGGGGCAGAGG + Exonic
905867251 1:41382815-41382837 GAGGCCGGCCGCCGGGGAAGGGG + Exonic
907284439 1:53370936-53370958 GAGGACCCCCACGGGGGCAGAGG - Intergenic
907508831 1:54943459-54943481 GAGAACCTCTGCTGGGGCAGTGG + Intergenic
910866108 1:91789442-91789464 CAGTCCCTCTGCCGGGGCAGGGG + Intronic
923763686 1:236872283-236872305 GAGAACAGGCGCTGGGGCAGAGG - Intronic
1062873958 10:931158-931180 GAGGACCGGGGCCGGGGCAGGGG - Intronic
1069680700 10:70283610-70283632 GGGTACCGACTCCGGGGCATGGG - Intronic
1076741177 10:132486466-132486488 GCGATCCGCCGCCGGGGGAGAGG + Intergenic
1078442505 11:11379113-11379135 GAGTGCCACCACAGGGGCAGTGG + Exonic
1082868415 11:57920581-57920603 GAGTACCGCTGTTGGGGCTGAGG + Intergenic
1084902460 11:72319995-72320017 GAGAGCCGCCTCTGGGGCAGTGG - Intronic
1085593669 11:77789443-77789465 GACTACTGCCGCCGGGGCTGAGG + Intronic
1086951314 11:92892938-92892960 GATTACGGCCGCCTGTGCAGTGG + Exonic
1089520047 11:119057251-119057273 GAGTACGCGCGCCGGGGCGGCGG - Intergenic
1091170557 11:133516428-133516450 CACCACCGCCGCCGGGGCTGGGG + Intronic
1092579342 12:9821327-9821349 TAGTACCGCTGCAGAGGCAGTGG - Intergenic
1100186469 12:92145314-92145336 GAGTCCGGCCGTCGGGGCTGCGG - Intronic
1100869317 12:98894541-98894563 TGGTGCCGCAGCCGGGGCAGAGG - Intronic
1107225735 13:38045439-38045461 CAGTACCGCTGCAGTGGCAGTGG - Intergenic
1117803143 14:59465101-59465123 GAGCACGGCCGCCGTGGCCGCGG + Exonic
1118323931 14:64768976-64768998 GAGTACCCCCGCAGGAGTAGGGG - Intronic
1132174986 15:99706096-99706118 AAGTACTGCCGACAGGGCAGTGG - Intronic
1132691131 16:1182431-1182453 GAGCACCGCCCCCAGCGCAGGGG - Intronic
1133784426 16:8963594-8963616 GCCTCCCGCCGCCGGGGCCGGGG + Intronic
1138590433 16:57996552-57996574 CAGTGCCGCCGCCGCGGCAGCGG - Exonic
1142812157 17:2400482-2400504 GAGAGCCGCCGCCTGGGGAGGGG - Intronic
1143078874 17:4366725-4366747 GGGTTCCGCCGCCGGGGGCGGGG - Intergenic
1147139646 17:38453925-38453947 GCGTACTGGGGCCGGGGCAGTGG + Intronic
1151630550 17:75308110-75308132 GAGGACAGCGGCTGGGGCAGAGG + Intergenic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1157815081 18:50724334-50724356 GAGTACCACCACTGGGGCAGTGG - Intronic
1160178907 18:76617811-76617833 AAGGACCTCCGACGGGGCAGAGG - Intergenic
1162752787 19:12838851-12838873 GAGGACGGCCGCGGGGGGAGGGG + Intronic
1166304101 19:41928011-41928033 GAGCGCCGCGGCCGGCGCAGGGG - Intronic
1167103836 19:47419310-47419332 GCGCATCGCCGCCGGGGCGGGGG + Intronic
1168209666 19:54881360-54881382 CAGTACCACCGCAGTGGCAGCGG + Intronic
927890236 2:26743537-26743559 GAGGTCCGCAGCAGGGGCAGGGG + Intergenic
927980324 2:27370768-27370790 GAGTCCCGCAGCGGGGACAGCGG + Exonic
932722463 2:74147939-74147961 GAGAGCCGCCGCCGTGGGAGAGG + Exonic
934761373 2:96858796-96858818 GCCGACCGCCCCCGGGGCAGCGG + Intergenic
938451441 2:131425007-131425029 GGGAACCGCCGCGGGGGCGGCGG + Intergenic
1175195359 20:57239614-57239636 GAGAACCTCCGCTAGGGCAGTGG - Intronic
1175270489 20:57730487-57730509 GAGCACCGCAGCAGTGGCAGCGG + Intergenic
1175878010 20:62239419-62239441 GAGGACCGGCGACGAGGCAGTGG + Intronic
1175935728 20:62513086-62513108 GAGGAGCTCTGCCGGGGCAGAGG + Intergenic
1177792493 21:25735581-25735603 GAGTGCGGCCGCCGGGGAGGAGG + Intronic
1181014555 22:20061717-20061739 GTGTCCCGCCACCAGGGCAGAGG + Intronic
1181085158 22:20436480-20436502 GAGCCCCGCCTCCGGGGCGGGGG - Intronic
1181266732 22:21635044-21635066 GAGGACGGCCGTCGCGGCAGTGG - Exonic
956151789 3:66251290-66251312 GAGAACCACAGCTGGGGCAGAGG + Intronic
960141158 3:114152906-114152928 GAATACCGCCGCGAGCGCAGCGG - Intronic
967272170 3:187740964-187740986 GGGTACCGCCGCCCGGGAGGTGG + Intronic
969441968 4:7222642-7222664 GGGTAGTGCGGCCGGGGCAGAGG + Intronic
971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG + Intronic
972283767 4:37629008-37629030 GAGTACCGCTCTCTGGGCAGTGG + Intronic
975552849 4:75630831-75630853 TAGCATCGCCGCTGGGGCAGGGG + Intergenic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
993413699 5:87601071-87601093 TAGAACCGCCGTCGTGGCAGTGG + Intergenic
993899031 5:93572051-93572073 GGGTCCCGCCGCCCGGTCAGAGG - Intergenic
998366583 5:141636523-141636545 GAGTTCCGCCGCCTCGGCCGGGG - Intronic
1001902595 5:175444234-175444256 GAGGACCGCCCCCAGGGCAGGGG - Intergenic
1002174918 5:177396467-177396489 GAGGACCTCCGCGGGGGCACTGG - Intronic
1002174927 5:177396494-177396516 GAGGACCTCCGCGGGGGCACTGG - Intronic
1002174945 5:177396548-177396570 GAGGACCTCCGCGGGGGCACTGG - Intronic
1002174954 5:177396575-177396597 GAGGACCTCCGCGGGGGCACTGG - Intronic
1008499850 6:52170034-52170056 GAGAACCTCTGCTGGGGCAGTGG - Intergenic
1019426972 7:982555-982577 GAGGGCTGCCGCCCGGGCAGGGG - Intergenic
1028077438 7:86533945-86533967 CAGTACCACTGCAGGGGCAGTGG + Intergenic
1029424878 7:100489046-100489068 GAGCAAGGCGGCCGGGGCAGGGG - Exonic
1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG + Intergenic
1053003749 9:34591396-34591418 GAGCTTCGCCGCAGGGGCAGGGG - Intergenic
1054835668 9:69672609-69672631 GCCCACCGGCGCCGGGGCAGGGG - Intergenic
1055091230 9:72365812-72365834 GAACAGCGCCGCCGGGGCATTGG - Intergenic
1055611711 9:78031375-78031397 GGGAACCGCCGCGGGGGCGGCGG + Exonic
1061014554 9:127974298-127974320 GAGTACCTACCCAGGGGCAGTGG - Intronic
1201981114 Y:19911313-19911335 GAGTACCACTGCAGTGGCAGTGG - Intergenic