ID: 971327547

View in Genome Browser
Species Human (GRCh38)
Location 4:25656504-25656526
Sequence TCCCCAAGACGGCTGAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971327547_971327555 24 Left 971327547 4:25656504-25656526 CCGTCCTTCAGCCGTCTTGGGGA 0: 1
1: 0
2: 0
3: 14
4: 100
Right 971327555 4:25656551-25656573 CAAGCCACAAATGGGTGAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
971327547_971327552 15 Left 971327547 4:25656504-25656526 CCGTCCTTCAGCCGTCTTGGGGA 0: 1
1: 0
2: 0
3: 14
4: 100
Right 971327552 4:25656542-25656564 TATGTTTTCCAAGCCACAAATGG 0: 1
1: 0
2: 1
3: 18
4: 207
971327547_971327553 16 Left 971327547 4:25656504-25656526 CCGTCCTTCAGCCGTCTTGGGGA 0: 1
1: 0
2: 0
3: 14
4: 100
Right 971327553 4:25656543-25656565 ATGTTTTCCAAGCCACAAATGGG 0: 1
1: 0
2: 2
3: 26
4: 230
971327547_971327557 28 Left 971327547 4:25656504-25656526 CCGTCCTTCAGCCGTCTTGGGGA 0: 1
1: 0
2: 0
3: 14
4: 100
Right 971327557 4:25656555-25656577 CCACAAATGGGTGAGCAGGCTGG 0: 1
1: 0
2: 2
3: 11
4: 167
971327547_971327559 30 Left 971327547 4:25656504-25656526 CCGTCCTTCAGCCGTCTTGGGGA 0: 1
1: 0
2: 0
3: 14
4: 100
Right 971327559 4:25656557-25656579 ACAAATGGGTGAGCAGGCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 242
971327547_971327558 29 Left 971327547 4:25656504-25656526 CCGTCCTTCAGCCGTCTTGGGGA 0: 1
1: 0
2: 0
3: 14
4: 100
Right 971327558 4:25656556-25656578 CACAAATGGGTGAGCAGGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971327547 Original CRISPR TCCCCAAGACGGCTGAAGGA CGG (reversed) Intronic
900162166 1:1228906-1228928 TCCCCAGGACGGCCGCAGGATGG + Exonic
903122525 1:21225542-21225564 TCCCCATGGTGGCTGGAGGACGG - Intronic
905957742 1:42013090-42013112 TCCTCCCGAGGGCTGAAGGAAGG + Intronic
914428831 1:147601134-147601156 CCTCCAAGAGGTCTGAAGGAGGG + Intronic
914453149 1:147811212-147811234 TTCCCAAGACGGAGGAAGTATGG + Intergenic
917057129 1:170995273-170995295 TCTTCAAGGAGGCTGAAGGAGGG + Intronic
920816713 1:209341247-209341269 TCCTCAAGCCAGCTGAAGGATGG + Intergenic
922705804 1:227789421-227789443 ACCCCCAGAAGGCTGCAGGAGGG - Intergenic
923119582 1:230978352-230978374 GCCCAAAGGCGGCTGCAGGAGGG + Intronic
1063860007 10:10296538-10296560 GCCCCTAGATGGGTGAAGGAGGG - Intergenic
1069466770 10:68646987-68647009 TCACCAAGACAGCTGCAGGTGGG - Exonic
1069571475 10:69496888-69496910 TCCCCAAGCCAGCTAAAGGCTGG - Intronic
1071588451 10:86847825-86847847 TCCCCAAGATGGCAGTGGGATGG - Intronic
1074915383 10:117950431-117950453 TTTCAAAGACAGCTGAAGGAAGG - Intergenic
1075731518 10:124639326-124639348 TCCCCAAGAGGGCTGAGGACAGG + Intronic
1077366142 11:2162119-2162141 TCCCCAGGGTGGCAGAAGGAGGG + Intergenic
1077614667 11:3666335-3666357 GCCCCCAGTCGCCTGAAGGAGGG - Exonic
1083099100 11:60284436-60284458 TCCCCAAGACCGGAGAAGGTTGG - Intronic
1085942499 11:81221789-81221811 TTGCCAAGAAGGATGAAGGAAGG + Intergenic
1088963039 11:114689998-114690020 TCCTGAAGACAGCAGAAGGATGG + Intronic
1089163935 11:116460412-116460434 GCCCCAAGATGGCTAAAGAAGGG - Intergenic
1090947643 11:131446119-131446141 TCCCCAAGCCTACTGGAGGAAGG + Intronic
1091694363 12:2617999-2618021 ACCCCAAGCTGGCTGGAGGAGGG - Intronic
1092143533 12:6200116-6200138 ACCCCAAGACGGCTTGAAGAAGG + Intronic
1092436727 12:8453449-8453471 TCCCCAAGACTGCTTCAGGATGG - Intergenic
1093641468 12:21531607-21531629 TCCCCAAGAATGTGGAAGGAAGG + Exonic
1095321090 12:40828117-40828139 TCCCCAGGTTGGCTGAAGGATGG + Intronic
1096944866 12:55392730-55392752 TCCTCAAGCCGGCTGCAGCAGGG - Intergenic
1099078688 12:78146498-78146520 TCCACAGGACTGCTGAAGTAAGG + Intronic
1102006812 12:109594418-109594440 TCCCCAAGGCAGCTGTAGGGAGG + Intronic
1104682214 12:130759931-130759953 TCACCCAGTCAGCTGAAGGAAGG - Intergenic
1104829747 12:131742025-131742047 TTCCCAAGAAGGCTGTTGGAAGG - Intronic
1107448104 13:40486048-40486070 GCCCCAAGACTTCTGAAGCAAGG + Intergenic
1120051206 14:79868457-79868479 GCCACAAGAAAGCTGAAGGATGG - Intergenic
1122887959 14:104718934-104718956 ACCCCAAGAAGGCTCCAGGAGGG - Exonic
1130452112 15:84066072-84066094 TCTCAAAGACAGCAGAAGGAAGG + Intergenic
1131150850 15:90046460-90046482 TCCCCAAGAAGACTAGAGGAGGG + Intronic
1134572721 16:15305260-15305282 ACCCCAAGACACTTGAAGGATGG - Intergenic
1134729660 16:16450776-16450798 ACCCCAAGACACTTGAAGGATGG + Intergenic
1134937773 16:18261132-18261154 ACCCCAAGACACTTGAAGGATGG - Intergenic
1139345460 16:66300280-66300302 TCCCCAACAAGGGTGGAGGATGG + Intergenic
1143607538 17:7998005-7998027 TACCCAAAACAACTGAAGGAAGG + Intergenic
1147136296 17:38435957-38435979 TCCCCAAGAGAGGTGGAGGAGGG + Intronic
1147992723 17:44345007-44345029 TCCCCCAGGCGCCTGCAGGATGG + Intergenic
1151018484 17:70584738-70584760 TCACACAGACGGTTGAAGGATGG + Intergenic
1152740436 17:82016229-82016251 GCCCCAAGCCAGCTGAAGGCTGG - Intronic
1155933663 18:31732219-31732241 TCCCAAAGTCAGCAGAAGGAAGG + Intergenic
1160584747 18:79906268-79906290 ACCCCAAGCCAGCAGAAGGAAGG - Intronic
1160795996 19:945687-945709 GCCCAAAGACGGCTGCAGGAAGG - Intronic
1163548139 19:17951232-17951254 TCCCCACCAAGGCTGAAGGTGGG + Intergenic
1167071066 19:47222208-47222230 TCCCCCAAGGGGCTGAAGGATGG + Intronic
928996986 2:37303260-37303282 TCCCCCAGACACTTGAAGGATGG - Intronic
931569258 2:63650927-63650949 TTGCCAAGAAGGCTGAAAGATGG + Intronic
937322050 2:120966754-120966776 TCCCCAAGAAGGCTGTGTGAGGG - Intronic
937994287 2:127681155-127681177 TCCCCATGCCGCCTGACGGAGGG + Intronic
940419358 2:153461420-153461442 GACCCAGGATGGCTGAAGGAAGG - Intergenic
948333472 2:237190198-237190220 TCCCCAAGGTGACTGAGGGAGGG + Intergenic
948516231 2:238505440-238505462 GCCCCAAGGCAGCTGCAGGAAGG + Intergenic
948644668 2:239396923-239396945 TCCCCAGGACGCCTGGAGGCAGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170524858 20:17227294-17227316 TCCCAAAGAAGGATGAAGGGTGG + Exonic
1171465289 20:25323785-25323807 TCCCCAACAGGTCTGAAGGATGG + Intronic
1172727776 20:37059631-37059653 TCCCCAACACTGCTTAGGGATGG + Intronic
1175228433 20:57458948-57458970 TCCCAAAGCTGGCTGAGGGAAGG - Intergenic
1175230767 20:57471841-57471863 TCCCCTACAGGGCTGCAGGATGG + Intergenic
1176023789 20:62975743-62975765 TCTCCAAGCCGGAGGAAGGAGGG - Intergenic
1177338085 21:19759876-19759898 TCCCTAAGATGTCTGGAGGATGG - Intergenic
1180968033 22:19800692-19800714 TCCCCAGGACAGCTGACGGATGG + Intronic
1182833864 22:33325717-33325739 GCCCCAAGACATCAGAAGGAGGG - Intronic
950193540 3:10993582-10993604 TCCCTTAGAGGGCTGGAGGACGG + Intronic
950647077 3:14383576-14383598 TGCCCAAAAGGGCTGGAGGAAGG + Intergenic
953296986 3:41728982-41729004 TCACCAAGATGGCTGACTGAAGG + Intronic
955037562 3:55283648-55283670 TCCCCAAGATAGCTCCAGGATGG - Intergenic
956446822 3:69333966-69333988 TCCCCAAGACAGCAGAGGCAAGG + Intronic
961427602 3:126860260-126860282 TCCCCATGACGGTGGAAGGTGGG - Intronic
964348449 3:155779009-155779031 TCCCCAAAACTAATGAAGGATGG + Intronic
966030388 3:175339116-175339138 TCCTCAAGTCTGCTGAAGAATGG - Intronic
966928258 3:184659445-184659467 CCCCCCAGGCGGCTGCAGGAAGG - Intronic
968275932 3:197440195-197440217 TCCCCAAGATGGCAGCAGGGTGG - Intergenic
968964612 4:3763659-3763681 TGCCCAGGAGGGCTGAAGGCAGG - Intergenic
971327547 4:25656504-25656526 TCCCCAAGACGGCTGAAGGACGG - Intronic
974868519 4:67609501-67609523 TCCACATGCCGGCTCAAGGATGG + Intergenic
982138558 4:152295830-152295852 TCCCAAAGAAGGCTAAAGGATGG + Intergenic
985905320 5:2830675-2830697 TCCCCAAGGCGCCTGATGGAAGG + Intergenic
989192283 5:38682935-38682957 TCCCCAGGAATGCTGGAGGAGGG - Intergenic
991514665 5:67421446-67421468 TCCCAAAGTCAGCAGAAGGAAGG + Intergenic
995303436 5:110613170-110613192 TCCACAAAAGGGCTCAAGGAAGG - Intronic
995840524 5:116439385-116439407 TCCCCAAGACAGCTGAGGGGGGG + Intergenic
998135733 5:139673513-139673535 TCCCCAAAACAGCTGGAGGAGGG - Intronic
1000489201 5:161888151-161888173 TCCCCTAGACTGTTGAAGGAGGG + Intronic
1002139762 5:177132042-177132064 CCCCCAAGACAGCGGAAGGGCGG - Intergenic
1002347582 5:178558412-178558434 TCCCCAAGACAGATGATGGCTGG - Intronic
1015626226 6:135182594-135182616 GACCTAAGGCGGCTGAAGGAGGG - Intronic
1015645880 6:135387476-135387498 TGCCAAAGACGGCTTAAGGGTGG + Intronic
1016006944 6:139099046-139099068 TCACGTGGACGGCTGAAGGATGG - Intergenic
1018729554 6:166638246-166638268 TCCACAAGACCGCTGAAGTCAGG + Intronic
1019949409 7:4359240-4359262 TCCCCAGGATGGCTGAGGCAGGG + Intergenic
1021961938 7:25881654-25881676 TACACAAGGCGGCTGAAGGAGGG + Intergenic
1024046919 7:45591281-45591303 GCCCCCAGACGGCTCTAGGAGGG - Intronic
1024929970 7:54659307-54659329 CCCACAAGACGATTGAAGGAGGG + Intergenic
1031258854 7:119490411-119490433 TCACGAAGATGGCAGAAGGAAGG + Intergenic
1031363422 7:120874655-120874677 TCCCCAAGAGGGTTGCACGAGGG + Intergenic
1031631026 7:124042864-124042886 TTCCGAAGACAGGTGAAGGAAGG + Intergenic
1038919253 8:32064479-32064501 CTACCAAGACAGCTGAAGGATGG - Intronic
1042850379 8:73210759-73210781 TCCCCATGGGGGATGAAGGAGGG - Intergenic
1043560742 8:81490303-81490325 TCCAAAATAAGGCTGAAGGATGG + Intergenic
1047113981 8:121820040-121820062 TCTCCAAGAAGGCTGATGAAAGG + Intergenic
1050238946 9:3613699-3613721 GCCACAAGATGGGTGAAGGATGG + Intergenic
1055990674 9:82102295-82102317 TCCACAAGAAGGGTGCAGGAAGG - Intergenic
1061163628 9:128910176-128910198 TCCCCAGGACGGGTGGAAGAGGG - Intronic
1061969511 9:134036310-134036332 TGCCCCAGACAGCTGAAGAAAGG - Exonic
1062522689 9:136964848-136964870 CCCCCAAGGCGGCTACAGGAAGG + Intergenic
1190551176 X:51582538-51582560 ACCCAAAGAAGGCAGAAGGAAGG - Intergenic
1193722506 X:85003762-85003784 TTGCCAAGGCGGCTGGAGGAGGG + Intergenic
1197809599 X:130429634-130429656 TTCCCAAGAGGGCTTAGGGAAGG + Intergenic