ID: 971328166

View in Genome Browser
Species Human (GRCh38)
Location 4:25661343-25661365
Sequence GCGTGTTTTACCTACCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 45}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971328166 Original CRISPR GCGTGTTTTACCTACCACCC AGG (reversed) Intronic
902150232 1:14436997-14437019 GCTTCTTTTACCAACTACCCTGG + Intergenic
912269511 1:108194494-108194516 GCCTGTTTTCCTTATCACCCTGG - Intronic
916655688 1:166873505-166873527 GTATGTTTTGCCTACCACCGAGG + Intronic
919097598 1:193057183-193057205 GAGTGTTTCACCAGCCACCCAGG + Intronic
924452724 1:244192897-244192919 ACCTATTGTACCTACCACCCAGG + Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1075032608 10:119034770-119034792 GCGTGTTTGAAGTACCACCTTGG - Exonic
1087997627 11:104830145-104830167 GAGTGTTTTCCCCTCCACCCCGG - Intergenic
1090976235 11:131682892-131682914 GCACATTTTACCTACCAGCCGGG + Intronic
1094470818 12:30799380-30799402 CGGTGTTTTACTTGCCACCCAGG - Intergenic
1129393872 15:75234021-75234043 GCCTGTTCTGCCTGCCACCCGGG + Intergenic
1130727010 15:86449573-86449595 GAGGATTTTACCTACCACACAGG + Intronic
1137629208 16:49930463-49930485 GCGTTTTTTGCCTACCCCTCTGG - Intergenic
1146462626 17:33058212-33058234 GCCTGCCTTACCTACCTCCCAGG - Intronic
1147718105 17:42521632-42521654 GCGTCTTTTGCCCACCCCCCTGG + Exonic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1163755901 19:19106013-19106035 GCGTATTTTCCCTACGGCCCTGG - Intronic
931891319 2:66675610-66675632 GTGTTTGTTACCTACCTCCCCGG - Intergenic
940515112 2:154674173-154674195 GTTTTTTTTACCTACGACCCAGG - Intergenic
943753654 2:191536275-191536297 GAGTGTTTTCCCTGGCACCCTGG - Intergenic
948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG + Intronic
1169528384 20:6455451-6455473 GTGTGTATTACCTACTACTCAGG - Intergenic
1170509774 20:17064758-17064780 GCGTGTTAGACCTTCCACCATGG - Intergenic
1171088992 20:22266589-22266611 GTGTTTTTTAGCAACCACCCAGG - Intergenic
1175560800 20:59927958-59927980 GCATTTTTCACCTTCCACCCTGG - Intronic
1175987981 20:62773630-62773652 GCGTTTTTTCCCAGCCACCCTGG - Intergenic
949799932 3:7892636-7892658 GAATGTTTTACCTAGCAGCCTGG + Intergenic
949933020 3:9094638-9094660 GATTGTTTTACCTACCAACTGGG + Intronic
951940217 3:28069477-28069499 GCATGTTTAACAAACCACCCTGG - Intergenic
960413283 3:117354290-117354312 GAGTGTTTCACCTACCTCACTGG + Intergenic
963301281 3:143599964-143599986 TGGCGTTTTACCTACCAGCCCGG + Intronic
969212473 4:5698326-5698348 TAGTGTCTTATCTACCACCCTGG - Intronic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
987442991 5:17980098-17980120 GGGTCTTTTTCCTATCACCCAGG - Intergenic
993629734 5:90271573-90271595 GCCTGCTTTACTTACCATCCAGG - Intergenic
1002174142 5:177391873-177391895 GCTTCTTATACCAACCACCCTGG - Intronic
1003161961 6:3643843-3643865 TGGTGTATTACCTACCACCAGGG - Intergenic
1008593072 6:53013114-53013136 GCATGTCTTACCTACCAGACAGG - Intronic
1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG + Intergenic
1021980401 7:26048599-26048621 TCCTGTTTTACATACCTCCCAGG - Intergenic
1029186724 7:98744604-98744626 CCGTGTTTTAATTACAACCCTGG - Intergenic
1032832686 7:135644106-135644128 ACATGTTCTACCTAACACCCGGG + Intronic
1035360632 7:158311057-158311079 TCTTGTTTTACCTCCCATCCTGG - Intronic
1042847213 8:73180535-73180557 GCGTCTCTTTCCTACCATCCTGG + Intergenic
1045060166 8:98404000-98404022 GGGGGTTTGACCTGCCACCCAGG - Intronic
1046444760 8:114303419-114303441 AAGTGTTGTACCTACCACACTGG + Intergenic