ID: 971329852

View in Genome Browser
Species Human (GRCh38)
Location 4:25673452-25673474
Sequence AGGACCTTGCCAAGATGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971329852_971329857 30 Left 971329852 4:25673452-25673474 CCATTGCATCTTGGCAAGGTCCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 971329857 4:25673505-25673527 GTCAGGCCTTCCTTCTTAGCGGG 0: 1
1: 0
2: 0
3: 18
4: 119
971329852_971329856 29 Left 971329852 4:25673452-25673474 CCATTGCATCTTGGCAAGGTCCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 971329856 4:25673504-25673526 AGTCAGGCCTTCCTTCTTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 115
971329852_971329855 13 Left 971329852 4:25673452-25673474 CCATTGCATCTTGGCAAGGTCCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 971329855 4:25673488-25673510 TATCTAGAGAGCTGTGAGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971329852 Original CRISPR AGGACCTTGCCAAGATGCAA TGG (reversed) Intronic
900126509 1:1071166-1071188 AGCCCCTTGCCAAGAAGGAAGGG - Exonic
900436451 1:2633392-2633414 GGGATCTTGCCAAGGTGCAAGGG + Intergenic
900814744 1:4834865-4834887 AGGACCCTACCAACCTGCAATGG + Intergenic
901156206 1:7141203-7141225 AGAACCTTGCAAAGGTGAAAAGG + Intronic
901468149 1:9436651-9436673 AGGACCTTGCCATGTTGCCCAGG - Intergenic
901618809 1:10564622-10564644 AGGGCCTTGCCATGTTGCCAAGG + Intronic
905811577 1:40917113-40917135 ATGACATTGCCAGGATGCCAGGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906675990 1:47694078-47694100 GGGTCCTTACCAAGATGCCATGG + Intergenic
913467931 1:119161752-119161774 AGGGTCTTGCCAAGATGCCCAGG - Intergenic
914228148 1:145739347-145739369 AGGTCCTTGCCAAGGAGCACAGG - Exonic
916321037 1:163504625-163504647 AGCACTTTGACAAAATGCAAAGG - Intergenic
916900211 1:169214616-169214638 AGGACCATGTCAAGAAACAAAGG + Intronic
920357007 1:205381173-205381195 AGAACCTTGCTAAGTTTCAAAGG + Intergenic
923134762 1:231108189-231108211 GGGACCTTGCCTACATGCTAAGG + Intergenic
924216289 1:241825702-241825724 AGAACCTGGCCAAAATCCAATGG + Intergenic
1063166488 10:3468077-3468099 CTGACCATGCCAAGATGCACTGG - Intergenic
1063637994 10:7803211-7803233 TGGACCTTCCCAACATGCAATGG - Intronic
1063873810 10:10450294-10450316 TGGACCATGCCAAGGTGAAAAGG - Intergenic
1065976251 10:30845385-30845407 GGGACCTTCCCAGGAAGCAAGGG - Exonic
1073516329 10:104078634-104078656 TAGACCTTGCCAAGATCCAGAGG - Intronic
1074969542 10:118524666-118524688 AGCACCTTGCCTTGCTGCAAGGG - Intergenic
1077597955 11:3550708-3550730 AGGGCCTTGCCATGTTGCCAAGG + Intergenic
1078267153 11:9763998-9764020 ATGGCCTTGCCAAGCTGGAATGG + Intergenic
1078664342 11:13312185-13312207 AGGTCATTGCAAAGATGAAATGG - Intronic
1078734645 11:14008775-14008797 AGGACCTTATCAAGAAGAAAAGG - Intronic
1080851094 11:36070866-36070888 AGGACCTTGACAAAGGGCAAGGG - Intronic
1080851200 11:36071847-36071869 AGGACCTTGTTAAAATGCAGTGG - Intronic
1081103066 11:39029160-39029182 AGGGACTTGCAAATATGCAAAGG + Intergenic
1081606037 11:44527583-44527605 AAGAAATTGCCAAGAAGCAATGG - Intergenic
1084885871 11:72206509-72206531 TGGGCCTGGCCAAAATGCAACGG + Intergenic
1085481262 11:76824715-76824737 AGGACTTTGGCAAGCTGCAGTGG + Intergenic
1087420574 11:97920317-97920339 AGTAACTTGCCAAAATTCAAAGG - Intergenic
1095250030 12:39968368-39968390 AGGTCCCTCCCAAGATGCATGGG + Intronic
1095783702 12:46087455-46087477 AGTACATTGCAAAGAAGCAATGG + Intergenic
1097584140 12:61494805-61494827 AGGACATTGCCAAGAGGGAATGG - Intergenic
1102347656 12:112169910-112169932 AGGACCTCCCCAAGAGGCAGAGG - Intronic
1103891248 12:124240637-124240659 ATGACCCTGCCTAGAGGCAAGGG - Intronic
1105605441 13:21922940-21922962 AGGCCCTTGCCCAGCTGCAGTGG + Intergenic
1107530485 13:41278115-41278137 AGGAACCTGACAAGATGGAATGG - Intergenic
1108824003 13:54389581-54389603 AGGAAGTTGCCTAGATACAAAGG + Intergenic
1114838036 14:26227104-26227126 AAGAACTTACCTAGATGCAAGGG - Intergenic
1120584263 14:86291533-86291555 AAGACCTTGTCAAGCTGCAGAGG - Intergenic
1121169313 14:91839939-91839961 ATGACCTTACCTAGATGCAAGGG - Intronic
1122337850 14:101005636-101005658 GGGACATTGCCCAGATGAAAGGG - Intergenic
1127127619 15:55827621-55827643 AGGACATTTCCAAAATGCATTGG + Exonic
1129964058 15:79717975-79717997 ATGGTCTTGCCAAAATGCAAGGG + Intergenic
1130320876 15:82839457-82839479 AGTATCTTGTCAAGATACAAAGG + Intronic
1132353116 15:101152888-101152910 AGGACCTTGCTAAGAGTGAAAGG - Intergenic
1133364102 16:5197358-5197380 AGGACCTTCAAAAGATGGAAGGG + Intergenic
1133643846 16:7744465-7744487 AGGACCTTCCAGACATGCAATGG + Intergenic
1134300715 16:12988192-12988214 AGGACCTTCCAAAGAGGCACTGG - Intronic
1135044569 16:19144653-19144675 AGGACCATCCCTAGGTGCAAAGG - Intronic
1135407868 16:22211041-22211063 ATGACCTTACCTAGCTGCAAGGG + Intronic
1137692509 16:50438815-50438837 AGGACATTCTCAAGAAGCAATGG + Intergenic
1137756957 16:50910068-50910090 AGGAGCTTGGCAAGATTCAGGGG - Intergenic
1141280395 16:82625820-82625842 TGGACCATGCCAAGATCCAGTGG - Intergenic
1141470771 16:84236946-84236968 AGGAGCTGGCCAAGCTGCACAGG - Exonic
1143318827 17:6054457-6054479 AGGGCCAGGCGAAGATGCAAAGG - Intronic
1145793621 17:27643379-27643401 AGGGCCCTGCCAAGATGGGATGG - Intronic
1145808432 17:27750935-27750957 AGGGCCCTGCCAAGATGGGATGG - Intergenic
1146460014 17:33038933-33038955 AGGACCTTGCCAAGCTCCCTGGG + Intronic
1146608969 17:34287994-34288016 AGGACCTTTACAAGATTCCAGGG - Exonic
1150484926 17:65537028-65537050 AGTACCTTGCCCAAACGCAATGG - Exonic
1152142802 17:78547994-78548016 AGGAAATTGCTAATATGCAAAGG - Intronic
1153341876 18:3983843-3983865 AAGAACTTGCCTAGCTGCAATGG - Intronic
1154013516 18:10595894-10595916 AGGACTTTGGCTAGGTGCAATGG - Intergenic
1154221192 18:12455689-12455711 CGGACCCTGCCAGGCTGCAAGGG + Intronic
1168334512 19:55590142-55590164 GGGATCTTGGTAAGATGCAAGGG + Intergenic
925452866 2:3985531-3985553 AGGACCCTGCACAGATTCAAGGG + Intergenic
925903497 2:8525277-8525299 AGGACCTTGACAAGATCCCCTGG + Intergenic
926705089 2:15831514-15831536 AGAACTTTGCCAAGGAGCAATGG - Intergenic
928256843 2:29730107-29730129 AGGTCCTTGCCAAGGGGCGAGGG - Intronic
928866401 2:35922139-35922161 AGGACCTAGCTAACATGCACTGG - Intergenic
933668798 2:84987032-84987054 AGGCCTTTGTCAAGATGAAATGG + Intronic
935199858 2:100846948-100846970 AGCGCCTTGACAACATGCAATGG - Intronic
936722881 2:115275001-115275023 AACACCTTGTCAAGATGCCATGG - Intronic
937285995 2:120751671-120751693 AGGAACTCACCAAGATGCTAGGG - Intronic
937648690 2:124296309-124296331 AGCACCCTGCAAAGTTGCAAAGG + Intronic
937790760 2:125958607-125958629 AGTACCTTGCCATGATAAAAAGG + Intergenic
940965825 2:159836421-159836443 AGGACCTTGGCAGGGTGTAAAGG - Intronic
944039591 2:195338729-195338751 AGGTCCTGGCCAAGAAGCCAAGG + Intergenic
944085721 2:195845940-195845962 AGGCCCTGGCCAAGATTAAATGG + Intronic
944927084 2:204476601-204476623 AGTACATTGCAATGATGCAAGGG + Intergenic
945477106 2:210296591-210296613 AGGACCTTGCCATGTTGCCCAGG - Intronic
946343096 2:219084793-219084815 AGGACCTACCCAAGAAGCCAAGG + Intronic
1169744956 20:8934334-8934356 AAGGTCTTGCCTAGATGCAAAGG - Intronic
1171068074 20:22038545-22038567 AAGACTTTGCAAAGATGTAAGGG - Intergenic
1172726092 20:37043115-37043137 AGGATCTTGCCATGTTGCACAGG - Intronic
1172794124 20:37525429-37525451 AGGGCTTTGCCAAGATGATATGG - Intronic
1173280628 20:41623818-41623840 ATGACCATGCCAAGCTGCAAAGG + Intergenic
1174747489 20:53077830-53077852 AGTCACTTGCAAAGATGCAATGG + Intronic
1174925049 20:54750284-54750306 AGTTCCCAGCCAAGATGCAATGG + Intergenic
1175146845 20:56903422-56903444 ATGACCAAGCCAAGATCCAAAGG - Intergenic
1176298206 21:5085576-5085598 AGGGACTTGCCAAGAGGAAATGG - Intergenic
1177214465 21:18110451-18110473 AGGAGCATTCCAAGAGGCAAAGG - Intronic
1178589957 21:33901484-33901506 AGGATCTTGCCATGATGCTCAGG - Intronic
1179257478 21:39729338-39729360 ATGACCATGCCTAGATTCAAGGG + Intergenic
1179283718 21:39957405-39957427 AGCAACCTGTCAAGATGCAATGG + Intergenic
1179858823 21:44176373-44176395 AGGGACTTGCCAAGAGGAAATGG + Intergenic
1182104479 22:27679592-27679614 AGAACCATGCAGAGATGCAAGGG + Intergenic
1185036542 22:48480827-48480849 AGGACGTGGCCAAAATGCAGAGG + Intergenic
950104150 3:10377656-10377678 AGGACATTGCCAAGAGCCCAGGG - Intronic
954218114 3:49135581-49135603 AGGGCCTGGGCAAGATGAAATGG - Intergenic
954746392 3:52789865-52789887 AGGGCCTGGGCAAGATGCAGGGG + Intronic
955275648 3:57544430-57544452 AGGCAGTTGCCAAGCTGCAAGGG + Intergenic
958932815 3:100225630-100225652 AGGACCTTGCCAAACTCCATCGG + Intergenic
959996124 3:112682514-112682536 TGGGCCTTGCCAACAGGCAAAGG + Intergenic
960046168 3:113200449-113200471 AGGACCCTGCCAAGTGGCAGAGG - Intergenic
962268281 3:133959056-133959078 AGGACCATGCCTAGATGCCTAGG + Intronic
964043649 3:152295738-152295760 AGGAATTTGCCAAGTTGCAGGGG + Intronic
967843785 3:194028789-194028811 ATGACCATGCCTAGCTGCAAGGG + Intergenic
968814906 4:2817295-2817317 AGGGGGTTGCCAAGAGGCAATGG + Intronic
970648281 4:18147939-18147961 AGGGCCTCACCTAGATGCAAGGG + Intergenic
971329852 4:25673452-25673474 AGGACCTTGCCAAGATGCAATGG - Intronic
973579692 4:52331129-52331151 TGGACCTGGGGAAGATGCAAAGG + Intergenic
973826654 4:54714278-54714300 ATGACATTGCCAAGATGCTATGG + Intronic
977125428 4:93160547-93160569 GGAACCTTGCCAAAAAGCAAAGG - Intronic
977242394 4:94588736-94588758 AGGACCTTGCCTACATTCAAGGG + Intronic
978545094 4:109862883-109862905 AGGATCTTGCCATGTTGCACAGG + Intronic
979015062 4:115421843-115421865 GAGGCCTTGCCAAGATGTAAAGG - Intergenic
981083273 4:140656636-140656658 AGTACATTGCAAGGATGCAATGG - Intronic
982257000 4:153460558-153460580 ATAGCCATGCCAAGATGCAAGGG + Intergenic
983815455 4:172120937-172120959 AGGACTTTGCCTAGAGGAAAAGG - Intronic
984776286 4:183483743-183483765 AGGACCTTGCCAAACTCCATCGG + Intergenic
986396487 5:7335748-7335770 AAAACCTTGCCAAGTTGCTATGG - Intergenic
990473958 5:56143649-56143671 GAAACCCTGCCAAGATGCAAAGG - Intronic
990954336 5:61328905-61328927 AGGAATTTGACAAGTTGCAAGGG + Intergenic
992544976 5:77804609-77804631 AGGGCCTTGCCAAGTTGCCCAGG - Intronic
997785287 5:136705571-136705593 AGGACCCTCCCTAGATGCATGGG + Intergenic
999200619 5:149813633-149813655 AGTACCTTCCCAAGGTGCAGCGG - Intronic
1000379354 5:160614980-160615002 AAGGCATTGCCAAGAAGCAAGGG - Intronic
1002712548 5:181204129-181204151 AGGACCTCGCCAAGATGTCCAGG - Intronic
1005174972 6:23034172-23034194 AGGACCTTGGCCAGGCGCAATGG - Intergenic
1005980418 6:30832035-30832057 AGGACATTCCCAGGATGCCAGGG - Intergenic
1007672444 6:43566999-43567021 AGGAGTTTGCCAATATTCAAGGG - Intronic
1008143171 6:47855876-47855898 AGATCCCTGTCAAGATGCAAAGG - Intergenic
1009359590 6:62795441-62795463 AGGACTTTGCCACTATGCAAAGG - Intergenic
1012162363 6:95902036-95902058 AACATCTTGCTAAGATGCAAAGG - Intergenic
1012920149 6:105213350-105213372 AGGACCATGCCAACTTGCAAAGG + Intergenic
1015503229 6:133953817-133953839 GGGACCGTGCAAAGATGCTAGGG + Intronic
1018299846 6:162389467-162389489 ATGAGCATGCCAAGATGCAAAGG - Intronic
1019290382 7:247329-247351 AGGACCTTGCCCTGGTGCAGTGG + Intronic
1019794567 7:3040300-3040322 AGGGCCTGGCCAAGAGGGAATGG + Intronic
1021108900 7:16671737-16671759 AGGATCTTGCCATGTTGCATAGG - Intronic
1022649884 7:32264983-32265005 ATGGCTTTGCCAAGAAGCAATGG + Intronic
1023976070 7:45031093-45031115 AGGGCCTTGCCCAGGTGCAGTGG + Intronic
1025175871 7:56802207-56802229 AGGACCTGGAGAGGATGCAAAGG + Intergenic
1025695922 7:63774215-63774237 AGGACCTGGAGAGGATGCAAAGG - Intergenic
1030778325 7:113564672-113564694 AAGAGATTGCCAAGATGGAAAGG - Intergenic
1034480238 7:151314239-151314261 AGGACCTTGGTAAGATGCGCTGG - Intergenic
1034489509 7:151385838-151385860 AGGCCCTCGCCAAGATGGACGGG + Intronic
1036657081 8:10683618-10683640 AGGGCTTGGCCAAGATGCACTGG + Intronic
1042162709 8:65912951-65912973 AGGACCTTGCCACCCTGAAAAGG + Intergenic
1044508787 8:93051228-93051250 AGGATCTTGCCATGTTGCACAGG + Intergenic
1045498135 8:102725647-102725669 AGGTCCTTGCCAAGATCAAGAGG - Intergenic
1045502064 8:102751239-102751261 ATGACCATGCCTAGCTGCAAGGG - Intergenic
1046359518 8:113131869-113131891 GAGAACTTGCCTAGATGCAAGGG - Intronic
1047023291 8:120800112-120800134 AGGAACTTGCCAGGATGCCAGGG - Intronic
1052533210 9:29714824-29714846 AGGACCTTATGAAGATCCAATGG + Intergenic
1053177359 9:35937477-35937499 ATGGCCTTACCCAGATGCAAAGG - Intergenic
1058352583 9:104043427-104043449 TGGGCCTTTCCAAGATGCTACGG + Intergenic
1059728447 9:117031827-117031849 CTGACCTTGCAAGGATGCAAAGG + Intronic
1060475290 9:123982430-123982452 AGGAACTTTCTAAGATGAAAGGG - Intergenic
1060726161 9:126007244-126007266 ACGTCCTGGCCAAGATGCATGGG - Intergenic
1060825468 9:126685187-126685209 AGGAGTTTAGCAAGATGCAAAGG + Intronic
1062536296 9:137022509-137022531 GGCACCTTGCCAAGGTGCAGCGG - Intronic
1185786564 X:2896098-2896120 CGGTCCCTGCCAAAATGCAAAGG - Intergenic
1191691639 X:63945318-63945340 AGGTACTTGTCAAGATACAAGGG - Intergenic
1195715743 X:107817167-107817189 AGGATCATGACAAGATTCAAGGG + Intergenic
1196783309 X:119401315-119401337 AGGACAATGCCAGGATGGAAGGG + Intronic
1198395958 X:136219450-136219472 AGGACTTTGGCAAGATGTCATGG + Exonic
1201420944 Y:13797796-13797818 ATGACCTTGGCCAGATGCAGTGG - Intergenic
1201712918 Y:17012200-17012222 AGGATCTCGCCAAGAGGAAAAGG + Intergenic
1201768889 Y:17598603-17598625 AGGACCTTGCCATGTTGCCCAGG + Intergenic
1201832665 Y:18307382-18307404 AGGACCTTGCCATGTTGCCCAGG - Intergenic
1202167158 Y:22002173-22002195 AGATCTGTGCCAAGATGCAAAGG + Intergenic
1202224202 Y:22584196-22584218 AGATCTGTGCCAAGATGCAAAGG - Intergenic
1202318912 Y:23611464-23611486 AGATCTGTGCCAAGATGCAAAGG + Intergenic
1202551857 Y:26058593-26058615 AGATCTGTGCCAAGATGCAAAGG - Intergenic