ID: 971329865

View in Genome Browser
Species Human (GRCh38)
Location 4:25673567-25673589
Sequence ACCTGGGGTCCTTTTTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971329865_971329876 16 Left 971329865 4:25673567-25673589 CCCTTAGAAAAAGGACCCCAGGT 0: 1
1: 0
2: 5
3: 33
4: 340
Right 971329876 4:25673606-25673628 ACCTCCCTTCACTCTTGTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971329865 Original CRISPR ACCTGGGGTCCTTTTTCTAA GGG (reversed) Intronic
900552490 1:3263805-3263827 CCCAGGGGTCGCTTTTCTAATGG - Intronic
901243675 1:7711207-7711229 CTCTGGGGTCCCTTTTATAAGGG + Intronic
901252094 1:7786865-7786887 ACCTGGGTGACTTTTCCTAAGGG + Intronic
902089250 1:13890200-13890222 CCCTGGGATCCCTTTTATAAGGG + Intergenic
902652894 1:17848207-17848229 TCCTGGGGTCTCTTTTATAAGGG + Intergenic
904153010 1:28458580-28458602 ACCTAGGGTCCTTTTGTGAAGGG + Intronic
906606066 1:47173146-47173168 TGCTGGGGTCCCTTTTATAAGGG + Intergenic
906817436 1:48893380-48893402 GCCTGGAGTCTTTTTTATAAGGG - Intronic
907928353 1:58975605-58975627 CTCTGGGGTCTTTTTTATAAGGG + Intergenic
907969434 1:59366438-59366460 ACCTGGGGAGGCTTTTCTAAAGG - Intronic
908182654 1:61621691-61621713 ACCTGTGTCCCTTTTTCTCAGGG - Intergenic
908429330 1:64040711-64040733 CCCTGGGGTCTATTTTATAAGGG + Intronic
909491579 1:76232518-76232540 GTAAGGGGTCCTTTTTCTAATGG + Intronic
910113875 1:83711349-83711371 ACATGGCGTCCTTCTTCTTAAGG + Intergenic
910619485 1:89236790-89236812 ACCTGAAGTCCTTTTTTTCATGG - Intergenic
911754580 1:101538165-101538187 TCCTGGGGTCTCTTTTATAAGGG + Intergenic
912523464 1:110263625-110263647 AACTGGAGTCCTTTATGTAAGGG - Intronic
912653920 1:111468563-111468585 ACCAGGGGTCCCTTTTCAGAGGG + Intergenic
913285667 1:117224366-117224388 GCCAGGGGTCCCTTTTATAAAGG - Intergenic
913661857 1:121011586-121011608 CCCTGGGGTCCCTTTTATAGTGG + Intergenic
914013232 1:143794771-143794793 CCCTGGGGTCCCTTTTATAGTGG + Intergenic
914164594 1:145166414-145166436 CCCTGGGGTCCCTTTTATAGTGG - Intergenic
914523441 1:148439133-148439155 ACCTTGGGTCCTTTTAGTCAGGG - Intergenic
914651854 1:149703380-149703402 CCCTGGGGTCCCTTTTATAGTGG + Exonic
915485729 1:156219224-156219246 CCTTGGGGTCTTTTTTATAAAGG + Intronic
916086080 1:161270545-161270567 GCCTGGGGTCTCTTTTATAAGGG - Intronic
916685083 1:167136905-167136927 CCCTGGGGTCTCTTTCCTAAGGG - Intergenic
917454136 1:175171152-175171174 ATCAGGAGGCCTTTTTCTAATGG + Intronic
918868046 1:189929474-189929496 ACCTGAGGTTCATTTTCTCATGG + Intergenic
918984217 1:191602189-191602211 ACCTGAGATTCTTTTTCTCATGG - Intergenic
920287402 1:204890520-204890542 ACCAGGCATCCTTTTTCTCAAGG - Intronic
921244372 1:213221292-213221314 ACCTTGGGTACTTTTTCCATAGG + Intronic
921779629 1:219147107-219147129 CTCTGGGGTCCCTTTTATAAAGG + Intergenic
922219625 1:223548542-223548564 TCCTGGGGTTCCTTTTATAAGGG - Intronic
922514232 1:226195016-226195038 GCCTGGGGTCTCTTTTATAAGGG + Intergenic
922823608 1:228501932-228501954 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
922991808 1:229920657-229920679 ATCTGAGGTCCTCTTTCTACAGG + Intergenic
923068055 1:230538291-230538313 CTCTGGGGTCTTTTTCCTAAGGG + Intergenic
923230358 1:231980802-231980824 TCCTGGGGTCCTTTTTTTGAGGG + Intronic
1062766603 10:71008-71030 CCCTGGGGTCCTTTTTTGATGGG - Intergenic
1065737378 10:28766393-28766415 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1066452568 10:35544592-35544614 ACCTTGGGTGCTGTCTCTAATGG - Intronic
1067210757 10:44258965-44258987 CCCTGGGGTCCCTTTATTAAGGG - Intergenic
1068727512 10:60319951-60319973 AACTGGGGTCCCTTTTCTCCAGG - Intronic
1069744042 10:70703618-70703640 CCCTGGGCTCCATTTTTTAAAGG + Intronic
1069887992 10:71635941-71635963 TTCTGGGGTCCCTTTTATAAGGG + Intronic
1070417267 10:76202626-76202648 TTCTGCAGTCCTTTTTCTAAAGG - Intronic
1070693591 10:78545302-78545324 ACATGGGGTCCCTTTTATAAGGG + Intergenic
1071090569 10:81913275-81913297 ACCTGGGCTCATTATTCCAAAGG - Intronic
1071966926 10:90860756-90860778 GCCTGGGGTCCCTTTTATGAGGG + Intergenic
1074381878 10:112987845-112987867 GCCTGGGATTCTTTTTCTAGGGG + Intronic
1075657045 10:124168939-124168961 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1076451786 10:130561387-130561409 TCCTGGGGTCCCTATTCTCAGGG + Intergenic
1076451913 10:130561896-130561918 TCCTGGGGTCCCTGTTCTCAGGG + Intergenic
1076451941 10:130562043-130562065 TCCTGGGGTCCTTGTTCTGGAGG + Intergenic
1077280334 11:1741871-1741893 CCCTGGGGCCCCTTTTATAAGGG - Intronic
1077646787 11:3932358-3932380 CTCTGGGGTCTCTTTTCTAAGGG - Intronic
1077917344 11:6619941-6619963 AGCTGGGGTCCTGTTTATTATGG + Intergenic
1078154890 11:8790891-8790913 ACCTGGGGTTGTTTTTCCAAGGG - Intronic
1079884238 11:25966281-25966303 ACCTGGGGTTCTTGGTCTCACGG + Intergenic
1080660990 11:34295829-34295851 ACCTGGGGTCCCTTTTATAAGGG + Intronic
1080760898 11:35247906-35247928 ATCTGAGGTCATTTTTATAAGGG - Intergenic
1081260822 11:40958022-40958044 AGCTGGGATCCCTTTTATAAAGG - Intronic
1081326734 11:41754431-41754453 ACCTGGTGGCCTTTCTCTACTGG - Intergenic
1081810094 11:45909652-45909674 GCCCGATGTCCTTTTTCTAAGGG + Exonic
1082267975 11:50140053-50140075 CCCTGGGGTCTCTTTTATAAGGG + Intergenic
1084081047 11:66825173-66825195 GCCTGGGGCCTTTTTTATAAAGG - Intronic
1084536677 11:69761407-69761429 CCATGGGGTCCCTTTTTTAAAGG - Intergenic
1087396132 11:97601824-97601846 ACCTAGGGTCCTTTTTTTTCTGG + Intergenic
1087698359 11:101407186-101407208 GTCTGGGGTCCCTTTTATAAGGG + Intergenic
1088962691 11:114685412-114685434 CTCTGGGGTCCTTTTTGTAAAGG + Intronic
1089176349 11:116551589-116551611 ATCTGAGGTCCTTGTTCTAAGGG - Intergenic
1089627694 11:119762083-119762105 ACCTGGGCTGCTTTCTCTCAGGG + Intergenic
1090655108 11:128837213-128837235 ACCTGGAGTCTCTTTTTTAATGG - Intronic
1092182446 12:6454990-6455012 ACATGAAGACCTTTTTCTAATGG - Intronic
1093140323 12:15502557-15502579 AACTGTGGTGCTTTTTCTAGAGG - Intronic
1093905228 12:24683529-24683551 ACCAAGAGTCCCTTTTCTAAGGG - Intergenic
1094233702 12:28138634-28138656 CTCTGGGGTCCTTTCTGTAAGGG + Intronic
1094566665 12:31604860-31604882 TCCTGGGGTCTCTTTTATAAAGG + Intergenic
1094722867 12:33083166-33083188 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
1097717758 12:62984219-62984241 CCCTGGGGTCCCTTTTATAATGG + Intergenic
1098423417 12:70329808-70329830 TCCTGGGGAGCTTTTTCAAAAGG + Intronic
1098857131 12:75665593-75665615 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1101512670 12:105407033-105407055 TTCTGGGGTCCCTTTTATAAAGG - Intergenic
1101786830 12:107891603-107891625 CTCTGGGGTCTTTTTTATAAGGG - Intergenic
1102870287 12:116408850-116408872 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
1103392951 12:120587437-120587459 GCCTGGGGTCCCTTTTATAAGGG - Intergenic
1103977184 12:124710717-124710739 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1104593114 12:130100301-130100323 CTCTGGGGTCCGTTTTATAAGGG - Intergenic
1104604490 12:130177913-130177935 ACCTGGCTTCCTGTTTCTAAGGG + Intergenic
1105234544 13:18536568-18536590 CTCTGGGGTCTTTTTTATAAGGG + Intergenic
1106475579 13:30095454-30095476 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1107930352 13:45301936-45301958 GTCTGGGGTCTTTTTTATAAGGG + Intergenic
1108238930 13:48441246-48441268 CTCTGGGGTCCCTTTTATAAGGG + Intronic
1110624556 13:77638184-77638206 ACCTATGTTCCATTTTCTAAGGG + Intronic
1110727300 13:78840064-78840086 CCCTGGGGTCCCTTTTATAAGGG + Intergenic
1110854114 13:80278561-80278583 ACCTGGGCTCCTGAGTCTAATGG - Intergenic
1114852681 14:26400096-26400118 ACCTGGGATCCATATACTAAAGG + Intergenic
1116438045 14:44915905-44915927 CTCTTGGGTCTTTTTTCTAAGGG - Intergenic
1117532992 14:56677023-56677045 GCCGGGAGTCCTTTTTATAAGGG + Intronic
1118499622 14:66346986-66347008 ACCTCAGCTCCTTTATCTAAAGG - Intergenic
1118611654 14:67546113-67546135 ACCTGGGTTACATTTTCTTATGG - Intronic
1119422734 14:74517147-74517169 ACCTGAGTTCCTTTCTCTCAGGG + Intronic
1119933568 14:78570212-78570234 CTCTGGGGTCCTTTTTCTAAGGG - Intronic
1120095617 14:80384463-80384485 CTCTGGGGTCCCTTTTATAAGGG + Intronic
1121577702 14:95001788-95001810 TTCTGGGGTCCCTTTTATAAGGG + Intergenic
1122709075 14:103642227-103642249 CCCTGGGTTCCCTTTTTTAAAGG + Intronic
1123805046 15:23861882-23861904 ACCTGCGATACTTATTCTAAAGG + Intergenic
1124839546 15:33229049-33229071 CCCTGAGGTCCCTTTTGTAATGG + Intergenic
1126262871 15:46714665-46714687 ACATGGGCTTCTTTTTCTGAGGG + Intergenic
1126615704 15:50577253-50577275 ACCTGGCCTGATTTTTCTAAAGG - Intronic
1128078022 15:64840714-64840736 GCCTGGGATCCTTTAGCTAAAGG - Intergenic
1128473157 15:67973811-67973833 TCCTGGGATTCTTTTTCTAGGGG - Intergenic
1131668576 15:94595957-94595979 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
1134186885 16:12091483-12091505 CTCTGGGGTCCCTTTTTTAAGGG - Intronic
1134557471 16:15177870-15177892 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1134654511 16:15938012-15938034 GCCTGGGGTCCCTTTTATAAGGG - Intergenic
1134903490 16:17959647-17959669 CCCTGGGGTCCCTTTTAAAAGGG + Intergenic
1134918040 16:18089549-18089571 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1135596231 16:23745418-23745440 CCCTCGGGTCTTTTTTATAAGGG - Intergenic
1136616195 16:31399971-31399993 TGGTGGGGTCCTTTTTCAAAAGG + Intronic
1137860980 16:51846524-51846546 CTTTGGGGTACTTTTTCTAAAGG + Intergenic
1138024057 16:53508962-53508984 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
1138941228 16:61793077-61793099 CCCTGGGGTCTTTTTTATAAGGG - Intronic
1140328192 16:74026560-74026582 TCCTGGGGTTCTTTTTGAAATGG - Intergenic
1141733674 16:85838804-85838826 GCCTGGGGTCCTTTTCCTGGGGG + Intergenic
1143699869 17:8650421-8650443 CTCTGGGGTCCCTTTTATAAAGG + Intergenic
1144359065 17:14474199-14474221 CACTGGGGTCCCTTTTATAAGGG + Intergenic
1146531412 17:33610487-33610509 ACCTGGGCTCCTTTCCCTAATGG + Intronic
1148703265 17:49604876-49604898 CCCTGGAATCCTTTTTCTCAAGG - Intronic
1150141773 17:62736302-62736324 AAATGGAGTCCTATTTCTAATGG + Exonic
1150473373 17:65456372-65456394 ACCTGGAGTGGTTTTTCTATTGG - Intergenic
1151271410 17:72999164-72999186 ACCTATGATCTTTTTTCTAACGG - Intronic
1152959447 18:70329-70351 CCCTGGGGTCCTTTTTTAATGGG - Intronic
1154213416 18:12398396-12398418 CCCTGGGGTCCCTTTTATAAGGG - Intergenic
1154514998 18:15153290-15153312 CTCTGGGGTCTTTTTTATAAGGG - Intergenic
1155727866 18:29112264-29112286 CCCTGGGATCCCTTTTATAAGGG + Intergenic
1157757554 18:50232049-50232071 ACTTGGGGTGCACTTTCTAAAGG - Intronic
1158429832 18:57375413-57375435 CTCTGGGGTCCCTTTTATAAAGG - Intergenic
1161946975 19:7443499-7443521 CCCTCAGGTCCTTTTCCTAAGGG + Intronic
1163296316 19:16415139-16415161 CTCTGGGGTCCTTCTTATAAGGG - Intronic
1164628013 19:29742214-29742236 GCCTGGGGTCCTTTATATAAGGG - Intergenic
1166292747 19:41873482-41873504 ACCTGGGGTCCTGGTTCCCAGGG + Intergenic
1166492824 19:43273906-43273928 TTCTGGGGTCCTTTTTTGAAAGG + Intergenic
1167228077 19:48263057-48263079 CTCTGGGGTCTCTTTTCTAAGGG + Intronic
1168667600 19:58216542-58216564 TCCTGGGATTCTTTTTCTAGGGG + Intergenic
927286537 2:21362848-21362870 ACCTGAGGTTCTTTGTCTCATGG + Intergenic
927290829 2:21403316-21403338 CCCTGGGGTCTGTTTTATAAGGG - Intergenic
928071836 2:28224874-28224896 ATCTGGGGCCCTGTTTCTCAAGG + Intronic
928773623 2:34732505-34732527 ACCTGGGGTTCTTGGTCTCATGG + Intergenic
929459456 2:42091550-42091572 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
929613261 2:43287730-43287752 ATCTGGGGTTCTTTTACTATAGG - Intronic
929653242 2:43703254-43703276 ACCTGTGGTCCCTTTTCTCAAGG + Intronic
929877649 2:45809948-45809970 ACCTAGGCTCCTTTATCTAGAGG + Intronic
931967925 2:67554026-67554048 CACTGGGGTCCTTTTAATAAGGG + Intergenic
935189653 2:100766613-100766635 ACCAGGATTCCTTTTTCTCAGGG - Intergenic
937595015 2:123661848-123661870 ACCTGGGGTTCTTGGCCTAATGG - Intergenic
938219939 2:129557317-129557339 ATCTGTGTTCCTTTCTCTAACGG - Intergenic
938515263 2:131998073-131998095 CTCTGGGGTCTTTTTTATAAGGG - Intergenic
938576084 2:132606005-132606027 ACCTGGGCTCCTGCTTCTCAGGG - Intronic
938983041 2:136544859-136544881 AGCTTGGGTCCTTTCTCTGAAGG + Intergenic
939518887 2:143204479-143204501 AACTGGGGTCCCTTTTAAAAAGG + Intronic
940008369 2:149030432-149030454 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
940122102 2:150278318-150278340 GTCTGGGGTCCCTTTTATAAGGG - Intergenic
940795143 2:158069937-158069959 CTCTGGGGTCCCTTTTATAAGGG + Intronic
942857262 2:180564091-180564113 ACCTGGAGTCTTTTGTCCAAGGG + Intergenic
943818905 2:192293193-192293215 TTCTGGGGTCTTTTTTATAAGGG + Intergenic
946317921 2:218930546-218930568 ACCTGGAGTCCGATGTCTAAGGG + Intergenic
946443142 2:219713942-219713964 TTCTGGGGTCTTTTTTATAAGGG - Intergenic
946541133 2:220685780-220685802 AACTGGCATCTTTTTTCTAAGGG - Intergenic
946825895 2:223677499-223677521 CTCTAGGGTCCTTTTTATAAGGG + Intergenic
948337085 2:237218042-237218064 ACCTGTGGTCCTTCTCCCAATGG + Intergenic
948534390 2:238635212-238635234 ACCTGCCCTCCCTTTTCTAAGGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1173368076 20:42406507-42406529 ACCTGAGGTGGTTTTTATAAAGG - Intronic
1174193284 20:48755364-48755386 ATCTGGAGTTCTGTTTCTAAAGG - Intronic
1175720240 20:61281333-61281355 CTCTGGGGTCCCTTTTGTAAGGG - Intronic
1176778532 21:13164854-13164876 CTCTGGGGTCTTTTTTATAAGGG + Intergenic
1176963431 21:15185696-15185718 CTCTGGGTTCCTTTTTATAAAGG - Intergenic
1177183370 21:17767244-17767266 CTCTGGGGTCATTTTTATAAGGG + Intergenic
1177949032 21:27510767-27510789 ATCTGGTGTCTTTTTTCAAAAGG + Intergenic
1177976155 21:27853868-27853890 CTCTGGGGTCTTTTTTATAAGGG + Intergenic
1178387446 21:32164575-32164597 AACTGGGATACTTTTTCCAAAGG + Intergenic
1178482065 21:32988089-32988111 TCCTGGGGTCCCTTTTAAAAGGG + Intergenic
1179121553 21:38550489-38550511 CCCTGGGGTCCCTTTTGTAAAGG - Intronic
1179647280 21:42783770-42783792 TCCTGGGGTCCCTTTTGCAAGGG - Intergenic
1182778658 22:32850194-32850216 ATCTGGTGTTCTTTTTCTTAAGG - Intronic
949091898 3:38773-38795 TCCAGGTGTCCTTTTTCTATTGG + Intergenic
951374511 3:21896940-21896962 AACTGGGATCATTTTTCTGATGG + Intronic
951837688 3:27001416-27001438 ACCTGGGGTTCTTGGTCTCACGG - Intergenic
954698160 3:52438412-52438434 ACCTGGGATGTTTTCTCTAAGGG + Intronic
954729630 3:52648498-52648520 ATGTGGGGTTCTTTTTTTAAAGG - Intronic
955847500 3:63181510-63181532 CGCTGGGGTCCCTTTTATAAAGG + Intergenic
957032209 3:75254999-75255021 TCCAGGTGTCCTTTTTCTATTGG + Intergenic
957144521 3:76406477-76406499 ACCTGTGGGCCATTTTCTTAAGG - Intronic
957246692 3:77724496-77724518 CTCTGTGGTCCCTTTTCTAAGGG - Intergenic
957504201 3:81098583-81098605 ACCTGGGTTCTTTTTTAGAATGG - Intergenic
957971598 3:87389785-87389807 ACATGTGGTCCTTTTACTTAAGG - Intergenic
958712160 3:97730603-97730625 ATATGGGGTGCTTTGTCTAAAGG - Intronic
958868242 3:99526268-99526290 CCCTGGAGTCCCTTTTATAAGGG + Intergenic
958975642 3:100665509-100665531 ACTTGGGCACCTTTTTCTAGTGG + Intronic
959025091 3:101231913-101231935 ATCTGAGATCCATTTTCTAAAGG - Intronic
959349077 3:105237931-105237953 GTCTGGGGTCTTTTTTATAAGGG - Intergenic
960461155 3:117937552-117937574 TTCTGGGGTCCTTTGTATAAGGG - Intergenic
960557223 3:119042975-119042997 ACCTGGGGTTCTTGGCCTAACGG + Intronic
961098530 3:124177983-124178005 ACCTGGGCTGCTCTTTCAAAGGG + Intronic
962405925 3:135099996-135100018 AACTGGGTGCCTTTTTCTCAAGG - Intronic
964341314 3:155711599-155711621 AACTGGGGTGCTATTTCTAGAGG - Intronic
964661196 3:159122151-159122173 ATCTGGGGTCCCTGTTATAAAGG + Intronic
964831047 3:160885002-160885024 ACCTGTGGAGCTTTTTCAAAAGG + Intronic
965011011 3:163091016-163091038 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
965407485 3:168288141-168288163 ACTTGGGGTCCGATTTCTCATGG + Intergenic
965596179 3:170413719-170413741 GCCTGGGGACCTCTTTTTAAGGG - Intergenic
966099445 3:176248896-176248918 CCCTGGGATCCCTTTTATAAGGG - Intergenic
966239737 3:177743149-177743171 CCCTGGGGTCTCTTTTATAAGGG + Intergenic
966380634 3:179341441-179341463 CTCTGGGATCCCTTTTCTAACGG - Intergenic
966637161 3:182148267-182148289 ACCAGGTGTGCTTTTTCTCATGG + Intergenic
966981534 3:185140648-185140670 CCCTGGCGTCTTTTTTATAAGGG - Intronic
966994353 3:185265291-185265313 ACTTGGGGTTCTTTTCCTCATGG - Intronic
968844586 4:3033305-3033327 CCCTGGGGCCCCTTTTCTAATGG + Intronic
970319287 4:14859985-14860007 ACCTGAGCTGCATTTTCTAAGGG - Intergenic
970362417 4:15323064-15323086 CTCTGGGGTCTTTTTTCTAAGGG - Intergenic
970482956 4:16496123-16496145 AGCAGGGGTCCCTTTTATAAGGG - Intergenic
970923123 4:21418327-21418349 AACTGGGGTTCCTTTTTTAATGG - Intronic
971225232 4:24745808-24745830 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
971329865 4:25673567-25673589 ACCTGGGGTCCTTTTTCTAAGGG - Intronic
971504053 4:27347447-27347469 CTCTGGGGTCACTTTTCTAAGGG + Intergenic
972411631 4:38801245-38801267 CTCTGGGGTCTTTTTTATAAAGG - Intronic
972470054 4:39395501-39395523 GCCTGGGGTCCTTTTTATAAGGG + Intergenic
973856262 4:55013326-55013348 ACCTTGGGTCATTTTTCTGAAGG + Intergenic
974487808 4:62526618-62526640 ACCTGGGGTTCTTGTCCTCATGG + Intergenic
974519999 4:62971668-62971690 ACCTGGGGTTCTTGGTCTCATGG - Intergenic
975675024 4:76818869-76818891 TCCTGTCTTCCTTTTTCTAAAGG + Intergenic
976486802 4:85615477-85615499 ACCAGGGTACCATTTTCTAAGGG + Intronic
976920874 4:90441467-90441489 CTCTGGGGTCTTTTTTTTAAGGG + Intronic
977618515 4:99110397-99110419 AATTGGGGTTCTCTTTCTAAGGG + Intergenic
977809648 4:101345838-101345860 CCCTGGCATCCTTTTTGTAACGG - Intronic
977901315 4:102425416-102425438 CTCTGGGGTCCCTTTTATAAGGG - Intronic
981414482 4:144475299-144475321 AACTGGATTCCTTTTGCTAATGG + Intergenic
981631847 4:146827927-146827949 TCCTGGTGTCTATTTTCTAAGGG + Intronic
981671021 4:147287076-147287098 ATCTGGGTTACTTTTTCTTATGG - Intergenic
982165200 4:152607879-152607901 GCCTGGGGTCTTCTTTCAAAGGG - Intergenic
982572553 4:157068531-157068553 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
982773613 4:159420643-159420665 ACCTGGAGTTCTTTGTCTCACGG - Intergenic
984714154 4:182911217-182911239 CCCTGGGGTCCCTTTTAGAAGGG + Intronic
985936094 5:3099802-3099824 ACTTGGGGTCCCTCTTTTAAGGG + Intergenic
987197417 5:15540806-15540828 CTCTGGGGTCCCTTTTATAAGGG + Intronic
989098542 5:37803429-37803451 CCCTGGGGTCTCTTTTATAAGGG - Intergenic
989182626 5:38593757-38593779 GTCTGGGGTCCCTTTTATAAGGG - Intronic
990559227 5:56966981-56967003 GCCAGGGGTCTCTTTTCTAAGGG - Intronic
990802209 5:59617576-59617598 ACATGGTGTTCTTTTTATAAAGG - Intronic
990902887 5:60772335-60772357 CCCTGGGGTGCCTTTTATAAGGG - Intronic
990910821 5:60850455-60850477 ACCTGGGGCCTCTTTTATAAAGG + Intergenic
991536174 5:67671571-67671593 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
991656752 5:68911975-68911997 CCCTGGGGTCCCTCTTCAAATGG + Intergenic
994654670 5:102576550-102576572 ACTTGGAGTCATTTCTCTAAAGG - Intergenic
995245238 5:109927922-109927944 CTCTGGGGTCTTTTTTATAAAGG + Intergenic
995456960 5:112362049-112362071 AAATGGGATCCTTTGTCTAATGG - Intronic
996573897 5:124961668-124961690 CCCTGGGATCTTTTTTATAAGGG - Intergenic
997943359 5:138178404-138178426 ATCTGGGGTCTTGTTTCTCAGGG - Intronic
998409869 5:141901513-141901535 AACTGGAGTTCTCTTTCTAATGG + Intergenic
999136586 5:149324340-149324362 CCCTGGGGTCTCTTTCCTAAGGG + Intronic
999509397 5:152232592-152232614 CTCTGGGGTTCTTTTTATAAGGG + Intergenic
1001117271 5:168950173-168950195 CTCTGGGGTCCCTTTTATAAGGG - Intronic
1001553226 5:172619251-172619273 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1001688111 5:173610866-173610888 TCCTGGGGTCCCTTTTGTAAGGG - Intronic
1001852351 5:174980554-174980576 ACATGGGGTCCATTTGCAAAAGG + Intergenic
1002345202 5:178543976-178543998 CCCTGGGGTCCCTTTTCTAAGGG + Intronic
1002398602 5:178977308-178977330 CCCTGGGGTCTCTTTTATAAGGG - Intergenic
1003846890 6:10183070-10183092 GTCTGGGGTCCCTTTTATAAAGG - Intronic
1004679211 6:17876112-17876134 ACCTGGGCTGCATTTGCTAAGGG - Intronic
1004945416 6:20607092-20607114 ACATGGGCTGCTTTTTCTGAAGG + Intronic
1005180847 6:23104483-23104505 CTCTGGGGTCCCTTTTGTAAGGG - Intergenic
1005904877 6:30253563-30253585 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
1005922012 6:30410166-30410188 ATCTGGGGTCCCTTTTATAAGGG + Intergenic
1006682908 6:35810153-35810175 CTCTGGGGTCCCTTTTATAAGGG + Intronic
1006784787 6:36659016-36659038 CCCTGGGATCCCTTTTATAAGGG - Intergenic
1007539890 6:42631982-42632004 TCCTGAGGTCTTCTTTCTAAAGG - Intronic
1009546420 6:65025860-65025882 CCCTGGGGAGTTTTTTCTAATGG - Intronic
1009563381 6:65277132-65277154 CCCTGGGGTCCCTTTTGTAAGGG - Intronic
1009962681 6:70542800-70542822 TCCTGTTGTCCTTTTTTTAATGG + Intronic
1010390538 6:75331940-75331962 CTCTGGGATCCCTTTTCTAAAGG - Intronic
1011071239 6:83386796-83386818 CTCTGGGGTCCCTTTTATAAAGG - Intronic
1011292424 6:85790634-85790656 ACCATGGGTCTTTTTTCTAAGGG + Intergenic
1011441377 6:87390951-87390973 GCCTGGGGTCTCTTTTATAAGGG + Intronic
1013410552 6:109879879-109879901 ACCTGGGGTCCTTGGCCTCACGG - Intergenic
1013966946 6:115966120-115966142 ACCTGTGTTACTTTTTCAAATGG - Intronic
1013979190 6:116109720-116109742 AAATGGGCTCCTTTTTATAAAGG - Intronic
1014801707 6:125786053-125786075 AACTGGGGTCATTTGTCTACTGG - Intronic
1015803997 6:137090271-137090293 TTCTGGGGTCCCTTTTATAAGGG - Intergenic
1018760593 6:166891474-166891496 ACCTGGGGTTCTTGGTCTCACGG - Intronic
1018979061 6:168588420-168588442 AGCTGGAGCCCCTTTTCTAAAGG + Intronic
1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG + Intergenic
1021298026 7:18933417-18933439 CTCTGGGGTCCCTTTTGTAAGGG + Intronic
1021566924 7:22025487-22025509 TCCTTGGGTCCTTTTGCTCATGG + Intergenic
1022206807 7:28172742-28172764 ACCTGGGGTCCTTACACAAAGGG - Intronic
1023174780 7:37425288-37425310 CTCTTGGGTCCTTTTTATAAGGG + Intronic
1024250717 7:47503899-47503921 CTCTGGGGTCCCTTTTATAAAGG + Intronic
1026425042 7:70282523-70282545 TCCTAGGGCCTTTTTTCTAAAGG + Intronic
1026726970 7:72877669-72877691 ACCTGGAGTCTTTTCTGTAAGGG - Intergenic
1027272697 7:76532468-76532490 ACCTGAGGTCCTGTTTCTTACGG - Intergenic
1027274941 7:76547648-76547670 ACCTGGAGTCTTTTCTGTAAGGG - Intergenic
1027397339 7:77769716-77769738 ACCTGAGGTTATTTTTCTACTGG - Intronic
1027723464 7:81772313-81772335 ACTTTGGGTCTTTGTTCTAAAGG + Intergenic
1028564419 7:92212522-92212544 TCTTGGGGTCCCTTTTATAAAGG - Intronic
1028737158 7:94228861-94228883 ACCTAGGGATATTTTTCTAATGG - Intergenic
1028906529 7:96160594-96160616 CCCTGGGATCCCTTTTATAAGGG + Intronic
1029016011 7:97316211-97316233 ACCTGGGGTTCTTGTCCTCATGG - Intergenic
1029720638 7:102362111-102362133 ACCTGGAGTCTTTTCTGTAAGGG - Intergenic
1029804434 7:102981725-102981747 ATCTGGGATCCCTTTTATAAGGG + Intronic
1030374115 7:108735703-108735725 CTCTGGGGTCCATTTTATAAGGG + Intergenic
1030823213 7:114121198-114121220 CTCTGTGGTACTTTTTCTAAGGG - Intronic
1030904300 7:115163204-115163226 ACCTTGGCTCCTTTTACTCATGG + Intergenic
1033805050 7:144944487-144944509 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1035698479 8:1620195-1620217 AGCTGGGGTCATTTTTAAAAAGG - Intronic
1037143661 8:15547729-15547751 CTCTGGGGTCCTATTTATAAGGG - Intronic
1037610690 8:20473706-20473728 GCCTGGAGTCCCTTTTATAAGGG - Intergenic
1038491835 8:27977138-27977160 CGCTGGGGTCCCTTTTATAAGGG + Intronic
1041010884 8:53542371-53542393 CTCTGGGGTCCCTTTTTTAAGGG - Intergenic
1041550050 8:59090534-59090556 TCCTGGGCTCCTTTTTCTGTGGG - Intronic
1041741870 8:61164964-61164986 ACCTGGGGTTCTTGGTCTCACGG + Intronic
1042120297 8:65480143-65480165 ATCTGGGGTCCCTTTTAAAAAGG - Intergenic
1042425531 8:68643640-68643662 TTCTGGGGTCTTTTTTATAAGGG + Intronic
1043544564 8:81300799-81300821 ACCTGGGGTACATGTTCTCAGGG - Intergenic
1043701669 8:83295829-83295851 ACCTTTTGTCCTTTTTATAATGG + Intergenic
1044163381 8:88948908-88948930 ATCTGGGGTCCCTTTTCTAATGG + Intergenic
1044718127 8:95119954-95119976 CTCTGGGGTCCTTTATATAAGGG + Intergenic
1046064111 8:109176188-109176210 TACTGGGGTCCTTCTTCAAAGGG + Intergenic
1047606533 8:126480157-126480179 GCCTGGGATCTCTTTTCTAAGGG + Intergenic
1048160749 8:132018830-132018852 GGCTGGGGTCCTTATCCTAAGGG - Intergenic
1048431363 8:134374580-134374602 ATCTGGGGTCTCTTTTATAAGGG - Intergenic
1048489695 8:134881115-134881137 CTCTGGGGTCCTTTTTCCAAGGG - Intergenic
1049250189 8:141584071-141584093 CCCTGGGGTCCCTTTTATCAGGG - Intergenic
1049397089 8:142405921-142405943 AACTGGGGTTCTGTTGCTAAGGG - Intergenic
1051066695 9:13113149-13113171 ACCTAGGTTTCTTTTTTTAAGGG + Intronic
1051187355 9:14474327-14474349 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1051676376 9:19562660-19562682 ACATGGGTTCCATTTTCTGAAGG - Intronic
1051832108 9:21291201-21291223 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
1051890970 9:21942572-21942594 TTCTGGAGTCATTTTTCTAAGGG - Intronic
1052352771 9:27473948-27473970 TTCTGGGGTCCCTTTTATAATGG - Intronic
1052399120 9:27978480-27978502 TTCTGGGGTCCCTTTTATAAGGG - Intronic
1054812649 9:69447110-69447132 TGCTGGGGTCCCTTTTTTAAGGG + Intronic
1056421428 9:86431370-86431392 CTCTGGTGTCCTTTTTATAATGG + Intergenic
1057170486 9:92960499-92960521 ACCTGGGGTGCATTTTTTCAGGG - Intronic
1059037011 9:110765544-110765566 ATCTGGGGTCTTTATTCTGAAGG - Intronic
1059969846 9:119654809-119654831 ACATGAGGTCCCTTTTCTAGTGG + Intergenic
1185513576 X:681070-681092 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1185636199 X:1553946-1553968 GCCTGGGGTCCCTTTTATAAGGG - Intergenic
1185671040 X:1810368-1810390 CTCTGGGGTCCCTTTTCTCAGGG - Intergenic
1185758130 X:2668303-2668325 CCCTGGGGTCCCTTTTGTAAGGG - Intergenic
1185808312 X:3080696-3080718 CTCTGGGGTCCCTTTTGTAAGGG + Intronic
1185827375 X:3264874-3264896 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
1185839068 X:3371780-3371802 TTCTGGGGCCCTTTTTCTAAGGG - Intergenic
1185855449 X:3530683-3530705 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1185872248 X:3673862-3673884 CTCTGGGGTCCCTTTTATAAGGG - Intronic
1185881547 X:3745723-3745745 TTCTGGGGTCCCTTTTCTAAGGG + Intergenic
1186082795 X:5951721-5951743 CTCTGGGGTCCCTTTTATAATGG + Intronic
1186268400 X:7857810-7857832 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1187426223 X:19179833-19179855 CTCTGGGGTCCCTTTTATAAGGG - Intergenic
1188923428 X:36008436-36008458 CCCTGGGGTGATTTTTCTAGAGG + Intergenic
1188980189 X:36720511-36720533 ACCTGGGGTCTTTCATCTATGGG - Intergenic
1189083093 X:37994843-37994865 ACCTGGGGTCTTTCATCTATGGG - Intronic
1189375226 X:40461301-40461323 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1190241062 X:48658602-48658624 GCCTGGGGTCCCTTTCATAAGGG + Intergenic
1190838796 X:54127081-54127103 ATCTGGGGTTCCTTTTATAAGGG + Intronic
1190990197 X:55540717-55540739 ATCTGCAGTCCTTTTCCTAAGGG + Intergenic
1192078556 X:68024859-68024881 ACAGGTTGTCCTTTTTCTAAAGG - Intergenic
1192150236 X:68707585-68707607 TCCTGGGGAGCTTTTACTAATGG - Intronic
1196303401 X:114071929-114071951 ACCTGGAGATCTTTGTCTAATGG - Intergenic
1196387636 X:115175602-115175624 TCCTTGGGTCCTTATTCTGAAGG + Intronic
1198589128 X:138156665-138156687 TCCTGGGGTCCCTTTTATAAGGG + Intergenic
1199225309 X:145366078-145366100 CCCTGGGGTCTTTTTTATAAGGG + Intergenic
1199431288 X:147763171-147763193 AGCTGTGGTCCTGTTTCTCAAGG + Intergenic
1199635537 X:149808520-149808542 ACCTGGCGTCCTTGTTCCAATGG + Intergenic
1199915210 X:152332317-152332339 CCCTGGGTTCCTTTTTCTGGTGG + Intronic
1200783480 Y:7238016-7238038 CTCTGGGGCCCATTTTCTAAGGG - Intergenic
1200791656 Y:7304819-7304841 CTCTGGGGTCCCTTTTATAAGGG + Intergenic
1201236725 Y:11919063-11919085 CTCTGAGGTCCTTTTTCTAAGGG + Intergenic
1201451644 Y:14121891-14121913 CCCTGGGGTTCCTTTTATAAGGG - Intergenic