ID: 971331045

View in Genome Browser
Species Human (GRCh38)
Location 4:25681620-25681642
Sequence ATACTCCTGTCTGTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971331040_971331045 -9 Left 971331040 4:25681606-25681628 CCCGCCTCTGCCCAATACTCCTG No data
Right 971331045 4:25681620-25681642 ATACTCCTGTCTGTCTCCCCAGG No data
971331041_971331045 -10 Left 971331041 4:25681607-25681629 CCGCCTCTGCCCAATACTCCTGT No data
Right 971331045 4:25681620-25681642 ATACTCCTGTCTGTCTCCCCAGG No data
971331038_971331045 3 Left 971331038 4:25681594-25681616 CCCTTTGCTCTGCCCGCCTCTGC No data
Right 971331045 4:25681620-25681642 ATACTCCTGTCTGTCTCCCCAGG No data
971331039_971331045 2 Left 971331039 4:25681595-25681617 CCTTTGCTCTGCCCGCCTCTGCC No data
Right 971331045 4:25681620-25681642 ATACTCCTGTCTGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971331045 Original CRISPR ATACTCCTGTCTGTCTCCCC AGG Intergenic
No off target data available for this crispr