ID: 971336450

View in Genome Browser
Species Human (GRCh38)
Location 4:25727924-25727946
Sequence CAGGCAGAACATCTTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971336450_971336456 -2 Left 971336450 4:25727924-25727946 CCCTCAGCAAGATGTTCTGCCTG No data
Right 971336456 4:25727945-25727967 TGGCTGAGCGGCTTGGCCACAGG No data
971336450_971336460 26 Left 971336450 4:25727924-25727946 CCCTCAGCAAGATGTTCTGCCTG No data
Right 971336460 4:25727973-25727995 ACATGAAATATGAACTAGGCCGG No data
971336450_971336459 22 Left 971336450 4:25727924-25727946 CCCTCAGCAAGATGTTCTGCCTG No data
Right 971336459 4:25727969-25727991 GGTGACATGAAATATGAACTAGG No data
971336450_971336457 1 Left 971336450 4:25727924-25727946 CCCTCAGCAAGATGTTCTGCCTG No data
Right 971336457 4:25727948-25727970 CTGAGCGGCTTGGCCACAGGAGG No data
971336450_971336454 -9 Left 971336450 4:25727924-25727946 CCCTCAGCAAGATGTTCTGCCTG No data
Right 971336454 4:25727938-25727960 TTCTGCCTGGCTGAGCGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971336450 Original CRISPR CAGGCAGAACATCTTGCTGA GGG (reversed) Intergenic
No off target data available for this crispr