ID: 971339585

View in Genome Browser
Species Human (GRCh38)
Location 4:25755598-25755620
Sequence AAATGTATGAAAGAACTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 424}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971339585 Original CRISPR AAATGTATGAAAGAACTATG GGG Intronic
901920875 1:12536658-12536680 AAATATATGAAACAATTATTAGG - Intergenic
902364565 1:15963357-15963379 AAATGTATCAAAGAACTGATAGG + Intronic
903818220 1:26081102-26081124 AAACGTATGTAACAAATATGTGG + Intergenic
905112072 1:35602947-35602969 AAATATATGAAAGAGCTAGTTGG + Exonic
905965384 1:42089562-42089584 AAATGTATAAGAGAAATATGGGG + Intergenic
906056466 1:42922018-42922040 AAATATATAAAAGATCTCTGGGG + Intergenic
906593611 1:47052365-47052387 AAATGTGTGACAGAAATATAAGG - Intergenic
906728620 1:48062406-48062428 CAATGTTTGAGAGAACTCTGGGG - Intergenic
906905356 1:49884075-49884097 ATATGGGTGAAACAACTATGTGG - Intronic
908668687 1:66521572-66521594 AAATGTAATAAAGAACTTGGGGG + Intergenic
909937409 1:81569093-81569115 AAAGGTTTGAAAGAATTATTAGG + Intronic
910923967 1:92379278-92379300 AAATATCTGAAAGAGCTTTGTGG + Intronic
911089192 1:94004285-94004307 AAAAGCAAGAAAGAACTGTGAGG - Intronic
911526507 1:98994025-98994047 AAATCTTTCAAAGAAATATGTGG - Intronic
912043912 1:105429535-105429557 TAATGTAGAAAAGAAATATGTGG + Intergenic
912129824 1:106587404-106587426 AAATGTAGGGAAGAGGTATGTGG - Intergenic
912454104 1:109786403-109786425 AAATGAATGAATGAAGAATGAGG - Intergenic
915866358 1:159503635-159503657 AAATGTAAGAAAGAACTAAAGGG - Intergenic
916513463 1:165494222-165494244 AAATGAATGAATGACCTATCTGG - Intergenic
916632511 1:166631491-166631513 AAATAAATGAAAGAACACTGAGG + Intergenic
916897909 1:169185283-169185305 AAGTGTATGAAGGAATGATGAGG - Intronic
916948397 1:169754416-169754438 AAATGTATGATTTAACCATGTGG - Intronic
917148839 1:171923641-171923663 AAATGGATCAAAGACCTAAGTGG - Intronic
918607436 1:186445188-186445210 AAAGGTATAAAGGAACAATGGGG + Intronic
918654036 1:187002025-187002047 ATATGTGTCAGAGAACTATGTGG - Intergenic
919005184 1:191889996-191890018 AATTATAAGAAAGAAATATGAGG - Intergenic
919192391 1:194239267-194239289 AAAAGTATGAAATGGCTATGGGG - Intergenic
919210965 1:194485608-194485630 AGGTGTATGAGAGAAATATGAGG - Intergenic
919237419 1:194864166-194864188 TAATGTATAAAAGATATATGTGG - Intergenic
921190733 1:212706257-212706279 AAAAGTATTAAAGAGGTATGTGG + Intergenic
921383990 1:214551590-214551612 AAAAGTTGGAAAGAACTTTGAGG + Intronic
921657574 1:217758964-217758986 GAAGGCATCAAAGAACTATGAGG + Intronic
923889685 1:238199157-238199179 AAATGAATCAATGTACTATGTGG + Intergenic
923926100 1:238629162-238629184 AAATTTGGGAAAGAAGTATGCGG - Intergenic
923929376 1:238676399-238676421 AAATGAATAAAAGAGCTAAGTGG + Intergenic
924018351 1:239753016-239753038 ATTTGTTTGAAAGAACTATTTGG + Intronic
924167447 1:241299333-241299355 AAATGTATGAATCATCTAGGAGG - Intronic
1063819160 10:9814286-9814308 AAATGTATTAATGACTTATGTGG + Intergenic
1065530053 10:26660274-26660296 AAATATATAAAAGATCTATGAGG - Intergenic
1065556906 10:26924925-26924947 AAATATATAAAAGATCTATGAGG + Intergenic
1066072764 10:31837165-31837187 TAATGTATAAAAGATCTTTGTGG + Intronic
1066136566 10:32452839-32452861 AAATGTACCAAATAACAATGAGG + Intronic
1067313340 10:45136588-45136610 AAATGTATCAAATCACTGTGTGG + Intergenic
1067582323 10:47453378-47453400 AAATGTAGTAAAGCACTCTGAGG + Intergenic
1067920614 10:50453571-50453593 AAAAATATGAAAGAAGGATGTGG + Intronic
1068008174 10:51414802-51414824 AAATGCAGAAAAGAATTATGTGG - Intronic
1068107057 10:52631679-52631701 AAATGAATGAAATAACATTGAGG + Intergenic
1068188750 10:53622026-53622048 AAATGTATGAATGATCTACATGG + Intergenic
1068839726 10:61597068-61597090 AAATGTTGGTAAGCACTATGAGG - Intergenic
1069009788 10:63359321-63359343 AAATGTATGAACATAATATGTGG - Intronic
1070077986 10:73156920-73156942 AAATATACGAAAGTACTATAGGG + Intronic
1070097292 10:73350133-73350155 AAGTGTTTGAGAGAAGTATGTGG - Intronic
1070194161 10:74140874-74140896 AAATGTATCAAAGACCTAATTGG + Intronic
1071947012 10:90657081-90657103 AAATATGTGAAAGATGTATGTGG - Intergenic
1072686169 10:97538487-97538509 AAATGTCTGAGAAAACTAAGAGG + Intronic
1073028535 10:100506479-100506501 AAATGTATAAAAGACATATAAGG - Intronic
1073409322 10:103326984-103327006 AAATGTCTGAAACAACTTTGAGG + Intronic
1074237192 10:111597536-111597558 AAATGTATGCAAGAGCAATGAGG - Intergenic
1075361542 10:121840285-121840307 AAATGAATCAAAGTAATATGAGG - Intronic
1075361667 10:121841972-121841994 AAATGCATGAGAAAAATATGAGG + Intronic
1075390707 10:122089155-122089177 AATTGTATGAGTGAATTATGTGG - Intronic
1078899886 11:15631933-15631955 AAATGTATGAAAATACTTGGAGG - Intergenic
1079719914 11:23797323-23797345 AAATTAATGAAAAAACTAAGAGG + Intergenic
1079882104 11:25941265-25941287 AAATGAATATAAGAATTATGTGG - Intergenic
1080998849 11:37641853-37641875 AAATATATGAAGGAACTAAATGG - Intergenic
1082291366 11:50376714-50376736 AAATCTATGAAAGAACATTTGGG + Intergenic
1085942649 11:81223229-81223251 AAAAATAAGGAAGAACTATGTGG - Intergenic
1086166173 11:83781407-83781429 AAATGAATAAATGAACCATGTGG + Intronic
1087562331 11:99805953-99805975 AAATGTAGTAAAGAAATATTTGG + Intronic
1089521099 11:119064169-119064191 AAAAGAACGAAAGAAATATGCGG + Intergenic
1089605379 11:119638484-119638506 AAATGAATGAAAGGACTGTGAGG + Intronic
1090116192 11:123976992-123977014 AGATGTAGGAAATAACGATGAGG + Exonic
1090862587 11:130667020-130667042 AAAAGTATGACAGAATTTTGAGG + Intergenic
1090892696 11:130940171-130940193 AAATATATATAAGAACTTTGTGG + Intergenic
1091162527 11:133438108-133438130 AAATGTATAAAATAACCATCTGG + Intronic
1091673569 12:2470397-2470419 AAATGTTGGAAAGAAAAATGAGG + Intronic
1091707879 12:2711948-2711970 TGATGTAAGAAAAAACTATGTGG - Intergenic
1092669128 12:10842558-10842580 AAATATATGAAAGAACTGAATGG - Intronic
1093323983 12:17750038-17750060 AATTGTATTTAAGAACAATGTGG + Intergenic
1095485793 12:42683308-42683330 AATGGTATGAAACAACTATTTGG - Intergenic
1096760911 12:53841217-53841239 AAATGTAAGAATGAATTATTGGG + Intergenic
1098385884 12:69918075-69918097 AAATGTTTTAAAACACTATGGGG - Intronic
1099068434 12:78013855-78013877 AACAGAATGAAAAAACTATGTGG - Intronic
1100906712 12:99308803-99308825 AAATGTGTGAAAGACATTTGTGG - Intronic
1102508819 12:113400637-113400659 AAATATATAAAAGAAACATGTGG - Intronic
1102593566 12:113975351-113975373 AAATGTATCATATAGCTATGCGG + Intergenic
1104314811 12:127687914-127687936 AAATGGATCAAAGACCTATAAGG + Intergenic
1104600045 12:130146824-130146846 ACATCAATGAAAGAACTAAGTGG + Intergenic
1106224785 13:27776844-27776866 AAATGAATGAAAGAGCTATGTGG + Intergenic
1106241328 13:27915989-27916011 AAAAGTATGAAAGGACTTTCAGG - Intergenic
1107154025 13:37145707-37145729 AAATCTGTGAAAGAAAAATGTGG + Intergenic
1108343651 13:49522575-49522597 AAATGTATGAAAATATTTTGGGG + Intronic
1108896165 13:55331925-55331947 AAATGTAGCAAAGAAGTATTTGG + Intergenic
1108904364 13:55450598-55450620 AAATTTATGGAAGAGATATGTGG + Intergenic
1109042869 13:57362818-57362840 AAATATATCAAAGACCTATTTGG + Intergenic
1109086332 13:57975536-57975558 AAATGTATTAAAGGAAAATGTGG + Intergenic
1109326354 13:60871983-60872005 CAATTTATCAAAGAAATATGTGG + Intergenic
1110683346 13:78342485-78342507 AAATGTATGCTAGAGCTTTGGGG - Intergenic
1110756225 13:79177578-79177600 AAATTAATGAAAAAACAATGAGG - Intergenic
1111207162 13:85026302-85026324 AAATTTATCAAAAAACTTTGAGG - Intergenic
1111402966 13:87765272-87765294 AAATGTATGAATGAAATATATGG - Intergenic
1111511271 13:89266454-89266476 AAATGTAGGCAAAAATTATGAGG - Intergenic
1111541133 13:89668575-89668597 CAATGTATGTAAGAAATATATGG + Intergenic
1111618976 13:90699223-90699245 AAATGTATGGAAGATGTGTGTGG + Intergenic
1111942163 13:94622011-94622033 AAATGTATTAATGAAGGATGGGG + Intronic
1111990117 13:95108123-95108145 AAATGTCTAAAAGAATTTTGGGG + Intronic
1113178229 13:107592737-107592759 AAATGTATGAATGATCTGTTTGG - Intronic
1114202532 14:20535888-20535910 AAATACATGAAAGACCAATGCGG - Intergenic
1115347158 14:32355112-32355134 AAATGTATTGAAGGAATATGAGG - Intronic
1115415536 14:33128299-33128321 AAATGTATGTAGGATCTGTGTGG + Intronic
1115604821 14:34990500-34990522 AACTGTAAGAAAGTACTGTGTGG + Intronic
1116023070 14:39484774-39484796 AAATGTATGAAATGACCAGGTGG + Intergenic
1116104497 14:40483755-40483777 AAATGTATAAAATAATTATATGG + Intergenic
1117531221 14:56662304-56662326 AAATGGCTGACAGAATTATGAGG + Intronic
1118048344 14:61997432-61997454 AAATGAATGAAGGGACTATGAGG - Intronic
1119408703 14:74414615-74414637 AAATGTATGAGAGATTTAGGAGG + Intronic
1119943509 14:78666913-78666935 AAATTTAGGGAGGAACTATGAGG - Intronic
1120605086 14:86564849-86564871 AAATTTATGAAAGCATTGTGGGG + Intergenic
1120937688 14:89914007-89914029 AAATGGATGAATGAACTGTTGGG + Intronic
1121132558 14:91461638-91461660 AAATTTAAAAAAGAAGTATGGGG - Intronic
1122609673 14:102973446-102973468 AAATTTATAAACGAATTATGGGG + Intronic
1124040582 15:26098806-26098828 ATATGTATGAAAGAAAGATTTGG - Intergenic
1127409212 15:58688595-58688617 AAATATGTTAAAGAATTATGGGG + Intronic
1127560527 15:60132302-60132324 AAATGAATAAATGAATTATGAGG + Intergenic
1127936779 15:63648313-63648335 AAATGCATTAAAGAGCTATTTGG - Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1128794401 15:70454469-70454491 AAACGTATGAAAGACATATTTGG - Intergenic
1129503829 15:76064387-76064409 AGATGAATGAAAGATATATGTGG - Intronic
1129577444 15:76765486-76765508 AAATGTTTTATAGACCTATGTGG - Intronic
1129971173 15:79779325-79779347 AAATGTTTTAAAAAACTATTTGG - Intergenic
1130758368 15:86790797-86790819 AAATGTATAACAGTTCTATGTGG + Intronic
1131997432 15:98145781-98145803 AAGTGGATGAAAGATCAATGAGG + Intergenic
1132930790 16:2458210-2458232 AAATGTAAGAAAGAACCACTTGG + Exonic
1134387493 16:13787485-13787507 AAATGTATAAAAGAAAAAGGGGG + Intergenic
1136860566 16:33699097-33699119 AAAAGTGTGAAAGAATTATTTGG - Intergenic
1137325458 16:47430719-47430741 GAATGGATGAAAGAACTAAAAGG + Intronic
1137755058 16:50894550-50894572 AAATGTTTGAGAGAAATATGGGG - Intergenic
1138469411 16:57221235-57221257 AAATGTGTCAATCAACTATGAGG - Intronic
1140649749 16:77074840-77074862 AAATGTAAAAAAGAATAATGAGG + Intergenic
1141230224 16:82160300-82160322 AAATTTATGAAATAATTTTGTGG - Intronic
1203122066 16_KI270728v1_random:1547280-1547302 AAAAGTGTGAAAGAATTATTTGG - Intergenic
1144245602 17:13360958-13360980 AAATATTTGAAAGAAAAATGAGG - Intergenic
1145045097 17:19607710-19607732 GAATGTATGCAAGATCTAAGTGG + Intergenic
1146166565 17:30594246-30594268 AAAAGTATGAAAGGTATATGGGG + Intergenic
1146537264 17:33663632-33663654 AACTGTATGTAAGTACCATGTGG + Intronic
1147711754 17:42471986-42472008 AAAGGAATGAAAGAACTTTATGG - Intronic
1148251120 17:46081650-46081672 AAATAAATAAAAGAACTATAAGG + Intronic
1148404742 17:47400957-47400979 AAAAGTATAAAAGAAGCATGAGG + Intronic
1149617908 17:58017072-58017094 AAATGAATGAAAGAATGAGGTGG - Intergenic
1149914499 17:60596701-60596723 AAATGTATAAAATTAATATGAGG - Intergenic
1151864323 17:76790329-76790351 AAAAGAAAGAAAGAAATATGAGG - Intergenic
1153184479 18:2471344-2471366 AAATGTGGGGAAGAAATATGTGG + Intergenic
1153245805 18:3071992-3072014 AACTGTATAAAAGAACTATCAGG - Intronic
1153541132 18:6156715-6156737 AAATGGATGAAACAACTCAGTGG - Intronic
1154345256 18:13538404-13538426 AAATGGGTGAAAAAAATATGGGG - Intronic
1155687700 18:28575767-28575789 AAATGTCTGCAAGACTTATGTGG + Intergenic
1156272659 18:35551296-35551318 ACATGTATGAAAGGAATGTGGGG + Intergenic
1156624060 18:38887178-38887200 AAATGTATGAAAGCAGTCCGAGG - Intergenic
1156949250 18:42873521-42873543 AAGTGTATAAAATAAATATGGGG - Intronic
1156999116 18:43503200-43503222 AAAAGCATGAAAGAACCAGGAGG - Intergenic
1157459450 18:47874415-47874437 AAGAGTATGAAAGAACTTTCTGG + Intronic
1157835856 18:50902305-50902327 AAATTTATTAAAGAACTAGCCGG - Intronic
1158258715 18:55585410-55585432 AACAGTATGAAAGATCTTTGAGG - Intronic
1158791789 18:60788724-60788746 ATATATATGAAAAAATTATGAGG - Intergenic
1164665307 19:30028436-30028458 AAATGTAAGAAATAAATTTGTGG - Intergenic
1165335863 19:35169191-35169213 AAATGTATGAAGGTGCTAAGTGG - Intronic
1165659895 19:37568746-37568768 AAATTAATGAAAAAACTATATGG + Intronic
1166240882 19:41492870-41492892 GAATGAATGAATGAACTATGTGG + Intergenic
1166940755 19:46363588-46363610 AAAAGTATGAAAAAATTAGGTGG - Intronic
1166943220 19:46381266-46381288 AAATGTGTGAAAGGACTTGGTGG - Intronic
925123120 2:1434921-1434943 AAAAGAAGAAAAGAACTATGAGG - Intronic
926439174 2:12869885-12869907 CAATGTATGAAAGAAACATCTGG + Intergenic
927009385 2:18886970-18886992 ATATTTATGAAAGAATTTTGTGG + Intergenic
928354837 2:30602137-30602159 AAATGGATGAAAGACCTGTAGGG + Intronic
928457495 2:31435843-31435865 AAAGGGATGAAAGAACTCTCTGG - Intergenic
928921047 2:36528428-36528450 AGAGGTATGAAAGAACAGTGTGG - Intronic
928931876 2:36633297-36633319 AAAGGGTTGAAAAAACTATGGGG - Intronic
929400441 2:41574235-41574257 AAATGCAAGAGGGAACTATGAGG - Intergenic
930796534 2:55398153-55398175 AAATCTATGAAATAAGTACGTGG + Intronic
930967342 2:57345883-57345905 ATATGTATGAATGGAATATGGGG - Intergenic
932931118 2:76040584-76040606 AAATGTATGAAAAAACCCTGAGG + Intergenic
932964643 2:76457501-76457523 AAATTTTTTAAAGAAGTATGGGG + Intergenic
933494698 2:83034416-83034438 AAAAGGAAGAGAGAACTATGTGG - Intergenic
933501071 2:83112104-83112126 GAATTTATGAAAAAACTATAAGG + Intergenic
934458945 2:94200249-94200271 AAAAGTGTGAAAGAATTATTTGG - Intergenic
935184029 2:100715522-100715544 AAATCTAGGGAAGAAGTATGTGG + Intergenic
935379696 2:102439130-102439152 AAATTTATGAAGGAACAATGGGG + Intronic
935427950 2:102940679-102940701 AAATGAATGAAAGGACAAAGAGG - Intergenic
936034467 2:109099741-109099763 AAAAGTATGCAAAAACGATGTGG - Intergenic
937531748 2:122837434-122837456 AGAGGCATGAAACAACTATGAGG - Intergenic
937784547 2:125879859-125879881 ACATATATGAAAGAAGTATATGG - Intergenic
938609672 2:132934703-132934725 ACATTTATGAAAGACCTATTTGG + Intronic
939154174 2:138504344-138504366 AAATGTTGGAAGGAACTATGTGG - Intronic
940109484 2:150135803-150135825 AAATGAATGAAAGAACAACAGGG - Intergenic
940584127 2:155622594-155622616 AAATATATGAAAGAACCTTAAGG + Intergenic
941380458 2:164786220-164786242 ACATGTATCAAAGTACTGTGTGG - Intronic
941542798 2:166807398-166807420 AAATATTTGAGAAAACTATGTGG - Intergenic
943626266 2:190204135-190204157 TAAGGTATGAAAGAACTAAAAGG - Intronic
945525256 2:210880742-210880764 CAATGAATGAGAGAACTAAGGGG - Intergenic
945570331 2:211459325-211459347 AAAAATATGAAAGAAACATGAGG - Intronic
945692127 2:213049990-213050012 AAATGTTTAAAAGACTTATGAGG - Intronic
945780844 2:214169898-214169920 AAATATATGAGTGAACTATTTGG + Intronic
945786856 2:214251297-214251319 AAAGCTATGGAAGAAGTATGAGG + Intronic
948419046 2:237842495-237842517 AAATGAATGCAAGCACTATAGGG - Exonic
948780078 2:240314391-240314413 AAAAGTATGAGAGAAATATAGGG + Intergenic
1168736552 20:144399-144421 CAATAAATGAAAGAAATATGAGG - Intronic
1169561538 20:6805935-6805957 AATTGTATAAAATAACTAAGTGG + Intergenic
1169690864 20:8330099-8330121 AAATGTAGGACAAAACCATGGGG + Intronic
1170281776 20:14657071-14657093 AAATGTATGAAATAACATTATGG - Intronic
1172570308 20:35964999-35965021 AAAGCTATGAAAGATATATGAGG - Intronic
1173089602 20:39957878-39957900 AGATGAAGGAAAGAACCATGGGG + Intergenic
1177030389 21:15975879-15975901 AAATATATAAAATAACTCTGAGG - Intergenic
1177168110 21:17625721-17625743 AAATGTATAAGAGAAATATCAGG - Intergenic
1178387776 21:32168464-32168486 AAATGTATGAAGGAATTAAAGGG + Intergenic
1180191156 21:46163487-46163509 AAATGGATCAAAGACCTAAGAGG - Intronic
1181608361 22:23994503-23994525 AAATGTAATAATGAAATATGTGG + Intergenic
1183288895 22:36985809-36985831 ATATGTTTAAAAGAACTCTGTGG - Intergenic
1183733855 22:39632715-39632737 GAATGAATGAATGAACGATGGGG + Intronic
1183797271 22:40130070-40130092 AAATGGAAGAGAGAACAATGAGG + Intronic
1185184456 22:49389381-49389403 AAATGTTTGAAAGAATTGTCTGG + Intergenic
949499336 3:4664111-4664133 AAATGTATGAAATAACCTTAAGG - Intronic
949911343 3:8911093-8911115 AAATGTATGAATAAACTAAAAGG + Intronic
951272216 3:20640077-20640099 AAATGAATCACAGAACTATGAGG - Intergenic
952033773 3:29175623-29175645 AAATATATCAAAGAAATATTAGG + Intergenic
952063647 3:29541415-29541437 AAAAGAATGAAAGAAATTTGAGG - Intronic
952245388 3:31584058-31584080 AAATGGATCAAAGACCTAAGTGG - Intronic
952262749 3:31756244-31756266 GAATATATGAAAGAAATACGAGG - Intronic
952776693 3:37053246-37053268 AAATGTTAGAAAAAAATATGGGG - Exonic
953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG + Intronic
953401535 3:42625167-42625189 AAATGTCTTAAAGAAGTATTGGG + Intronic
954906414 3:54067016-54067038 AAATGTAAAAAATAACTAGGAGG - Intergenic
955785056 3:62528856-62528878 AAATGTTTGGAAGCACTTTGTGG + Intronic
955813221 3:62813938-62813960 AAATGAATGAATGAAATATGTGG + Intronic
956141959 3:66155207-66155229 AAATGAATGAGTGAAATATGTGG + Intronic
956410938 3:68978726-68978748 AAATGTATGAAAGAGGCAAGGGG + Intronic
956499308 3:69864808-69864830 CAACATATGTAAGAACTATGAGG - Intronic
957398978 3:79684381-79684403 AAATGTAGGAAAGAATCATAAGG - Intronic
959235321 3:103714061-103714083 AAATGTATAAAATAATTATACGG + Intergenic
959271587 3:104218591-104218613 AAATGTAGAAAATAACTAGGTGG + Intergenic
959314095 3:104779968-104779990 GAATGTATGAAAAAGCTATAGGG - Intergenic
959765434 3:110021680-110021702 AAATGGGTAAAAGAAGTATGAGG + Intergenic
960485114 3:118242200-118242222 AAATGTCTGAAAGATATATGGGG + Intergenic
960788861 3:121404235-121404257 TAGGGTATGAAAGAAATATGGGG - Intronic
961119232 3:124359371-124359393 AAAGGGATGAAATAACTATCTGG - Intronic
961187259 3:124926545-124926567 AAATCTATCAAAGAACATTGAGG + Intronic
962002232 3:131310170-131310192 AGATGAATGAATGAAATATGAGG + Intronic
962493563 3:135917598-135917620 AACAGCTTGAAAGAACTATGTGG + Intergenic
962919577 3:139938191-139938213 AATTGTACGAAAGAAGTATCTGG - Intronic
963201287 3:142589057-142589079 CAAATTATGAAAGAGCTATGGGG - Intergenic
966133661 3:176673454-176673476 AAATGTATAAAAGATATTTGGGG + Intergenic
967441472 3:189514023-189514045 AAAGATAGGAAAGAACTATGAGG + Intergenic
967576700 3:191103137-191103159 AAATTTATGAAAGAATTATAGGG - Intergenic
971020022 4:22525391-22525413 AAATATAAGGAAGAAATATGAGG + Intergenic
971203860 4:24542180-24542202 GAATGTCTGAAAGAACTTTAAGG - Intronic
971339585 4:25755598-25755620 AAATGTATGAAAGAACTATGGGG + Intronic
971568900 4:28184608-28184630 AAATGTCGGTTAGAACTATGAGG + Intergenic
972106007 4:35487947-35487969 AAATGTAGGCAAGATCTGTGTGG + Intergenic
972319131 4:37956525-37956547 AAATGTGTTAAAGCACAATGAGG - Intronic
974129355 4:57734133-57734155 AAATGTATTAAAGGGCTATTAGG + Intergenic
974149458 4:57987916-57987938 GAAAGTATGAAGGAACAATGAGG - Intergenic
974649529 4:64736138-64736160 AAATATATGAAAGAAAAATTAGG + Intergenic
974670645 4:65025826-65025848 AAAGGGTTGAAAAAACTATGGGG - Intergenic
974713132 4:65629684-65629706 AAAAGTATCAAAAAACTATCTGG - Intronic
974941039 4:68468131-68468153 AAATGTAAGAAAGAATTAAAAGG + Intronic
975099104 4:70491721-70491743 AAAAGAAAGAAAGAAATATGAGG + Intergenic
975945669 4:79703049-79703071 AAATGTAAAAAATAAGTATGGGG - Intergenic
976060342 4:81120496-81120518 AAATATATGTAAGATCTATGAGG - Intronic
977145554 4:93435508-93435530 AAATGAATGAAGGAAATATTTGG + Intronic
977200586 4:94110436-94110458 AAAGGCAAGAATGAACTATGTGG + Intergenic
977260121 4:94787550-94787572 AAATATATGAAAGGACAAAGAGG - Intronic
977489997 4:97699449-97699471 AAATTTATGGAAGAGGTATGTGG - Intronic
977719777 4:100225423-100225445 AAATTTATGGAAGTAATATGTGG - Intergenic
978077057 4:104543988-104544010 AAGTGAATGAAACAACTTTGAGG - Intergenic
978290167 4:107128338-107128360 AAATGAATGAAGGGATTATGTGG - Intronic
978370676 4:108026955-108026977 AAATGGATGAAAGGCATATGTGG + Intronic
979077403 4:116290254-116290276 AAATGTATAAATAAACTCTGAGG - Intergenic
979271126 4:118763439-118763461 ACATCTATGAAAGAAATCTGTGG + Intronic
979888481 4:126061551-126061573 AAATTTAGGGAAGAGCTATGTGG - Intergenic
979954663 4:126937413-126937435 AAATGTATGTCATAACTGTGAGG + Intergenic
979962097 4:127033444-127033466 AAATGTATGCAAGTAATATCAGG + Intergenic
981460355 4:145006906-145006928 AATTTTAGGACAGAACTATGAGG - Intronic
981534890 4:145788905-145788927 CAATGTCTAACAGAACTATGTGG + Intronic
981666819 4:147237443-147237465 AAATGTAAGAGACAGCTATGTGG - Intergenic
981969602 4:150651492-150651514 CAATGAATGAATGAACTCTGTGG - Intronic
982578064 4:157142705-157142727 AAATAAATGAAACAATTATGGGG - Intronic
982610172 4:157564036-157564058 ATATGTGTGAAAGAAATAGGTGG - Intergenic
982623606 4:157735911-157735933 AAATGTAGGAAGTAACTAAGGGG + Intergenic
982628166 4:157794790-157794812 GAATGTATGAGACAAATATGGGG + Intergenic
983991487 4:174125308-174125330 ACATGTGTGAAAGAATTTTGGGG - Intergenic
984112601 4:175637962-175637984 AAATGCTTGTAAGAACCATGAGG - Intronic
984932467 4:184859175-184859197 AAATGTATAATGGAACTGTGAGG - Intergenic
985184769 4:187304144-187304166 AAATGAATTACAGGACTATGGGG + Intergenic
986106379 5:4663306-4663328 AAATGTGAGAAAGAAATGTGTGG + Intergenic
987072388 5:14350770-14350792 AAATTTATGAAGGATGTATGGGG - Intronic
987338058 5:16914590-16914612 AAATGTAGGAAAGACATATCTGG - Intronic
988289049 5:29261012-29261034 AAATGTATGAAAAAAGTATATGG + Intergenic
989363033 5:40624965-40624987 AAATGAATGAAAGTGCTAAGGGG - Intergenic
989676836 5:43982583-43982605 AAATTTTAGAAAGAAGTATGTGG - Intergenic
990035619 5:51314981-51315003 AAATATATCAAAGAACTAAAAGG - Intergenic
990549294 5:56857257-56857279 AAATGTTTAATAGACCTATGGGG + Intronic
990853731 5:60239054-60239076 AAATGTATGAAATATCTTTGTGG - Intronic
990973770 5:61538991-61539013 AAACGAATGAAACAATTATGAGG - Intronic
991229717 5:64318316-64318338 ACATGTATGAAATAACTAACAGG + Intronic
991266939 5:64730713-64730735 AAAGGTATAAAATAAGTATGTGG + Intronic
991406040 5:66301995-66302017 AAATGTAAGGAAGAAAGATGTGG + Intergenic
991417036 5:66403955-66403977 AAATGAAGGAAAAAACTTTGAGG - Intergenic
992301488 5:75386667-75386689 CAATTTATGAAGGACCTATGGGG + Intronic
993520254 5:88890873-88890895 AAATTTATGACATAACTTTGGGG - Intronic
993523378 5:88933773-88933795 AAATGTCTGAAAGAATTTGGAGG - Intergenic
993717354 5:91288883-91288905 AAATGAATTAAAGACCTATCTGG + Intergenic
994275346 5:97830163-97830185 TATTGTATGAAAGAACTATCTGG - Intergenic
994560094 5:101358210-101358232 AAATTTATGAAATAACTTAGTGG + Intergenic
995483560 5:112616225-112616247 AAATTTGTGCAAGAAGTATGTGG - Intergenic
995788504 5:115857785-115857807 AAAATTATGAAATAACTATGAGG - Intronic
996623207 5:125535998-125536020 AAATGAATGAATGAACCAAGGGG - Intergenic
996828390 5:127711351-127711373 AAATATATGAAAGCACTTTTTGG + Intergenic
997547570 5:134722048-134722070 AAATGAAGGGAAGAACTAAGAGG + Intronic
997883297 5:137609679-137609701 AAATGGATGCATGAACCATGTGG + Intergenic
998503750 5:142655390-142655412 AAATGAATACAAGAACTATGAGG + Intronic
998793551 5:145792754-145792776 AAATATGTTAAAGAAGTATGTGG + Intronic
999547322 5:152644271-152644293 AAATGTAAGCCAGAACTGTGAGG + Intergenic
999966436 5:156814825-156814847 AAATATATTAAAGAAATTTGAGG + Intergenic
1000483900 5:161814779-161814801 AACTGTATGAAAGATCCCTGTGG - Intergenic
1000556487 5:162732649-162732671 AAATGTATGAAATGATTTTGAGG - Intergenic
1000632518 5:163607012-163607034 AAATGTAAGAAAGCATTTTGAGG + Intergenic
1001071581 5:168589799-168589821 AAAAGTATTAAAGTTCTATGAGG - Intergenic
1001352019 5:170977867-170977889 AAAGGTATGAAATACCTTTGTGG + Intronic
1001772490 5:174306619-174306641 AAATGTGTGAACTAAGTATGTGG - Intergenic
1003583771 6:7367252-7367274 AAATATCTGAAAGAAATATTTGG + Intronic
1003620780 6:7697478-7697500 AAATGAATGAAAGATCGATTAGG + Intergenic
1004058165 6:12162144-12162166 AAATCTATGAAAGAACCAAATGG + Intronic
1004121187 6:12823883-12823905 GAATGTATGAAATCAATATGTGG - Intronic
1004719195 6:18250836-18250858 GAATTTATGAATGAACTATACGG + Intronic
1004879617 6:19994913-19994935 AAATGGAAGAAAAAACTGTGTGG - Intergenic
1005585429 6:27271989-27272011 AAATCTATATAAGAAATATGTGG - Intergenic
1006001636 6:30969699-30969721 AAATGTGGGAAAGAGTTATGTGG + Intergenic
1006505932 6:34488587-34488609 ACATGCATCTAAGAACTATGGGG - Intronic
1006577046 6:35054073-35054095 AAATGGAAGAAAGAACAAAGAGG - Intronic
1006817928 6:36865707-36865729 AAATGTATGATAGTACGGTGTGG - Intronic
1008270870 6:49487781-49487803 AAATGAATAAAACAAGTATGGGG - Intronic
1008546405 6:52587559-52587581 ACATGTATGAATGAATTATTTGG + Intergenic
1008843744 6:55936622-55936644 ATATGTTTGTAGGAACTATGGGG - Intergenic
1009378099 6:62996329-62996351 AAATGTATGATAGAAAGAAGAGG + Intergenic
1010825196 6:80464643-80464665 AATAGTATGAAAGAAGTGTGAGG - Intergenic
1010845161 6:80697829-80697851 AAATTTATGAAAGAAATGTTAGG + Intergenic
1012130060 6:95479574-95479596 AAATGAATAAAAGATTTATGAGG + Intergenic
1012730545 6:102874940-102874962 AAATTTAGGAAAGAGATATGTGG + Intergenic
1012905459 6:105059708-105059730 AAATGTATGACAATACTATTTGG + Intronic
1013505734 6:110798248-110798270 AACTGTATTAAAGAAAAATGAGG + Intronic
1014444899 6:121515681-121515703 TAATGTAGGAAAGTACTTTGTGG + Intergenic
1014506185 6:122260440-122260462 AATTATATGAATGAACTCTGAGG - Intergenic
1014884811 6:126766937-126766959 AAAAGTATGAAATATCTTTGGGG - Intergenic
1015059848 6:128950011-128950033 AAATATATGTAAATACTATGTGG + Intronic
1015599066 6:134894717-134894739 AAATGCTTGAACTAACTATGGGG - Intergenic
1015854180 6:137605911-137605933 AAATGTACTAAGGAACTAAGGGG + Intergenic
1016122152 6:140357557-140357579 AACTGTATGAGGGAAATATGGGG - Intergenic
1016132951 6:140500022-140500044 AAAGGAATGAAAGAAATCTGAGG + Intergenic
1016595769 6:145798300-145798322 AAATGTGTAAAAGAAATATAAGG + Exonic
1016632746 6:146250963-146250985 AAATGTCTTAAAGAACTTCGAGG + Intronic
1017577708 6:155823588-155823610 AAATGAATACAAGAATTATGGGG - Intergenic
1020447303 7:8282709-8282731 AAAAGGAAGAAAAAACTATGAGG + Intergenic
1021118800 7:16773755-16773777 AAAGATCTTAAAGAACTATGGGG + Intronic
1022328070 7:29351283-29351305 AAATGAATGAATGAACTCTCAGG - Intronic
1024439745 7:49403604-49403626 AAATGCATGAATAACCTATGAGG + Intergenic
1024595805 7:50936289-50936311 AAATGTATGAAACAATTTTGTGG - Intergenic
1024820230 7:53320089-53320111 AAATGTATAAATGAATGATGGGG + Intergenic
1024886268 7:54146317-54146339 AAATGTATGAAATGACCCTGTGG + Intergenic
1026559598 7:71437366-71437388 AAATGTTTTAAAGAAATATGGGG - Intronic
1026580897 7:71615776-71615798 AAAAGTAAGAAAGCACTTTGAGG - Intronic
1027507929 7:79041306-79041328 ATATGTATAAAAATACTATGAGG + Intronic
1027597330 7:80190195-80190217 AAATGAATGAAAGCAATATTAGG + Intronic
1027779313 7:82502795-82502817 AAATGTATCAAAGAACTGCAAGG - Intergenic
1027859196 7:83553615-83553637 AAATGAATGAATTAACTTTGGGG + Intronic
1027934087 7:84580278-84580300 AAATGAATGAATGAGCTATATGG + Intergenic
1028914885 7:96247823-96247845 AACTATATGAGACAACTATGTGG - Intronic
1028979282 7:96949411-96949433 AAACCTATGACAGAACTCTGTGG + Intergenic
1030362055 7:108605425-108605447 AAATGTAGGGAAGCTCTATGTGG - Intergenic
1031047824 7:116913544-116913566 GAATGTGTGAAAGAATTCTGTGG - Intronic
1031938275 7:127759452-127759474 AAATGGATCAAAGAAGGATGGGG - Intronic
1032929122 7:136645460-136645482 AAAAGTATGAAAGATTCATGGGG + Intergenic
1033039812 7:137907931-137907953 ATATTTATGATAGAACTTTGAGG + Intronic
1033375599 7:140758896-140758918 AAATGTATGAAGAAACTTTCTGG - Intronic
1033551152 7:142449387-142449409 AAATGAATGAACAAATTATGTGG - Intergenic
1033643473 7:143284333-143284355 AAATTTAGGAAGGAACGATGTGG + Intronic
1035998926 8:4580117-4580139 AAATGTATTAAACACCTATGTGG + Intronic
1036089573 8:5650834-5650856 AAAAATATGAAAGAAATATATGG + Intergenic
1036606600 8:10311254-10311276 AAAGGGCTGACAGAACTATGAGG + Intronic
1037105362 8:15100397-15100419 ATATGTATGAAACAGATATGAGG + Intronic
1037171487 8:15898210-15898232 AAATGTATGAAATAATTTTGCGG + Intergenic
1037177007 8:15959427-15959449 AAATGTATATATGAAATATGAGG - Intergenic
1038136143 8:24788103-24788125 AAATATATGAAATAGATATGTGG - Intergenic
1038159355 8:25022155-25022177 AAATGGATGATGGAACTCTGAGG - Intergenic
1038922598 8:32101373-32101395 AAACATAGGAAACAACTATGAGG + Intronic
1039683893 8:39775341-39775363 AAGTGTAGGGAAGAAGTATGTGG - Intronic
1041157101 8:54998944-54998966 AAATGCATGAAACTACTATTTGG + Intergenic
1041590177 8:59570808-59570830 AAATGGATGAAAGACCTAAATGG + Intergenic
1041623079 8:59996105-59996127 AAATGTGTAAAAGAGCTGTGAGG - Intergenic
1043085203 8:75822653-75822675 AAATATAGAAAAGGACTATGAGG + Intergenic
1043571500 8:81608561-81608583 TAATTTAAGAAAGAACTAGGAGG + Intergenic
1043636921 8:82396548-82396570 AAATGTATGAAACAAAATTGTGG + Intergenic
1044150881 8:88773698-88773720 AAATATAGGAAAGAGGTATGTGG + Intergenic
1044321548 8:90807685-90807707 AAATGTTTGCAAAAAGTATGAGG - Intronic
1044334904 8:90970189-90970211 AAACTTGTGAAATAACTATGTGG + Intronic
1044576193 8:93771858-93771880 AAATCTATAATAAAACTATGAGG - Intronic
1046038877 8:108878168-108878190 AAAAGTGGGAAAGAACTAAGAGG - Intergenic
1046238180 8:111454716-111454738 AAAAGTATCTAAGAACAATGTGG + Intergenic
1047086361 8:121520869-121520891 AAATGAATCAAAGAACTAAGTGG + Intergenic
1047455914 8:125011272-125011294 AACTGAATGAAAAAACAATGAGG - Intronic
1047872703 8:129102956-129102978 TAATGTATGAAAGATCAATTTGG + Intergenic
1048679033 8:136818452-136818474 AAATGGATGAAAGAAATAAATGG + Intergenic
1050136597 9:2472314-2472336 ATCTGTATGAAAGACCTAGGAGG + Intergenic
1050296025 9:4206156-4206178 AAATCTATAACAGAACTATCTGG + Intronic
1050716986 9:8541116-8541138 GAATGTATTACAGATCTATGGGG + Intronic
1051242865 9:15078769-15078791 AAATGTATGAAAGAGTTAGCAGG + Intergenic
1051316998 9:15849013-15849035 AAATCAATGAAAGTACTTTGTGG - Intronic
1051697656 9:19786913-19786935 AAAAGTATGAAAGAACCATCTGG - Exonic
1053092940 9:35296398-35296420 AAATATATAAAACAATTATGTGG + Intronic
1053689438 9:40576038-40576060 AAAAGTGTGAAAGAATTATTTGG - Intergenic
1054274593 9:63055019-63055041 AAAAGTGTGAAAGAATTATTTGG + Intergenic
1054300683 9:63376977-63376999 AAAAGTGTGAAAGAATTATTTGG - Intergenic
1054400231 9:64709910-64709932 AAAAGTGTGAAAGAATTATTTGG - Intergenic
1054433822 9:65194168-65194190 AAAAGTGTGAAAGAATTATTTGG - Intergenic
1054496564 9:65827502-65827524 AAAAGTGTGAAAGAATTATTTGG + Intergenic
1055735113 9:79319461-79319483 AAATATGTGTAAGAACTTTGAGG + Intergenic
1055742602 9:79406512-79406534 AAATGTATGATAGAAATATGAGG + Intergenic
1059125315 9:111679185-111679207 AAATGCATGACATAACTAAGAGG + Intergenic
1059549178 9:115211213-115211235 GAATGAATGAACGAACTGTGTGG - Intronic
1059786219 9:117587997-117588019 AAAAATATGAAAGAACTACTGGG + Intergenic
1059896323 9:118869969-118869991 ATATGTGTGAAATATCTATGTGG - Intergenic
1059904597 9:118968635-118968657 AAATCTAGGAAAGAACAGTGAGG + Intergenic
1060670198 9:125461994-125462016 AAATGTGTGAAAGAGGAATGAGG - Intronic
1060999612 9:127895822-127895844 GAATGAATGAAAGAATGATGGGG + Intronic
1185697603 X:2206896-2206918 AAATAGATGAAAGAACAATCAGG + Intergenic
1185870471 X:3660708-3660730 CAAGGAATGAAAGAACTTTGAGG + Intronic
1185935404 X:4251253-4251275 AAGAGTATCAAAAAACTATGAGG + Intergenic
1186492821 X:9987792-9987814 AAATGTATGAAAGAATAAGATGG + Intergenic
1186560840 X:10611268-10611290 AAATGTATGAAAGAATTAAATGG + Intronic
1186640701 X:11452057-11452079 TAATGAATGAATGAACAATGTGG - Intronic
1187382455 X:18816594-18816616 TAATGGATGAAACAACTAGGTGG - Intronic
1187659245 X:21520597-21520619 AGATGTATGGAAGAATTATCTGG + Intronic
1188512294 X:30949465-30949487 AAAGGCATGAAAGAACTTTCTGG - Intronic
1190794678 X:53729970-53729992 AAAAATATGCAAGAACTATGAGG - Intergenic
1190903954 X:54707784-54707806 AAATGTATGAGAGAACACTTTGG - Intergenic
1191896330 X:65997415-65997437 AAATGAATGAAAGAAATAATAGG + Intergenic
1192038860 X:67595865-67595887 AAATGTATGAAATCACAATGAGG + Intronic
1192480348 X:71479922-71479944 AAATTTTTAAAAGACCTATGAGG + Intronic
1193238139 X:79133745-79133767 AAATGTTTGAAAAATCTCTGGGG - Intergenic
1196345671 X:114654576-114654598 TAATGAATAAAAGAACAATGTGG - Intronic
1196356494 X:114800408-114800430 AAATGTATAAAAGATGGATGTGG - Intronic
1196397234 X:115277284-115277306 AAATGTATGAAGGAAATTTTGGG - Intergenic
1196506004 X:116442866-116442888 ATATATATAAAAGAACTATTTGG - Intronic
1196861633 X:120034040-120034062 AAATTGAGGAAAGAACTATTAGG + Intergenic
1197010100 X:121550452-121550474 AAAGTTATGAAAGACATATGTGG + Intergenic
1197922388 X:131609337-131609359 AAATGAATGAAAGAACCTTTTGG - Intergenic
1197948116 X:131862744-131862766 AAATGAATGAAAGAACCTTTTGG - Intergenic
1198853675 X:140993241-140993263 AAAGGCATGAAAGAACTTTTGGG - Intergenic
1199806669 X:151306951-151306973 AAATGTATGAAATAACACAGTGG - Intergenic
1200793573 Y:7320435-7320457 CAAGGAATGAAAGAACTTTGGGG - Intergenic
1201484618 Y:14479035-14479057 TAATGTTTATAAGAACTATGAGG + Intergenic
1201558311 Y:15288173-15288195 GTATGAATGAAAGAACTATGAGG - Intergenic
1202282778 Y:23207703-23207725 AAATGTTTGAAAGTACTAAAGGG - Intergenic
1202283113 Y:23210816-23210838 AAATGTTTGAAAGTACTAAAGGG + Intergenic
1202434452 Y:24822088-24822110 AAATGTTTGAAAGTACTAAAGGG - Intergenic
1202434787 Y:24825202-24825224 AAATGTTTGAAAGTACTAAAGGG + Intergenic