ID: 971340296

View in Genome Browser
Species Human (GRCh38)
Location 4:25762598-25762620
Sequence CAGAATATGGGGCAGCTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971340292_971340296 19 Left 971340292 4:25762556-25762578 CCAATAAGGTAAAGCTTAAGAAA 0: 1
1: 0
2: 0
3: 28
4: 280
Right 971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG 0: 1
1: 0
2: 1
3: 18
4: 130
971340291_971340296 22 Left 971340291 4:25762553-25762575 CCACCAATAAGGTAAAGCTTAAG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG 0: 1
1: 0
2: 1
3: 18
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971340296 Original CRISPR CAGAATATGGGGCAGCTATT AGG Intronic
901570550 1:10156586-10156608 CAGAATTGGGTGCAGATATTGGG + Intronic
908186837 1:61660579-61660601 CAGAAAAAGCAGCAGCTATTTGG + Intergenic
910286680 1:85563411-85563433 CAAATTATGGGGCAGCAAGTGGG + Intronic
913141368 1:115944564-115944586 CAGAAGATGAGGAAGCCATTTGG + Intergenic
914416515 1:147488310-147488332 CAGAATATATGGCAGTTAGTAGG + Intergenic
916953201 1:169803166-169803188 CAGACAATGGTGCAGCTCTTAGG + Exonic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
922568685 1:226618978-226619000 CAGAAGATGGGGTAGCTTCTGGG - Intergenic
1066045818 10:31594830-31594852 CAGAATCTGAGGCAGGGATTGGG - Intergenic
1069556197 10:69400167-69400189 TAAAATATGGGGCACCTAGTAGG + Intronic
1077477804 11:2798742-2798764 AAGAAAATGAAGCAGCTATTGGG + Intronic
1079264829 11:18921140-18921162 CACAATATTGGGCAGCTGTTTGG + Intergenic
1079267004 11:18943287-18943309 CACAATATTGGGCAGCTGTTTGG + Intergenic
1079799813 11:24854712-24854734 CACAAAATGGGGCAGTTGTTTGG - Intronic
1081118246 11:39232130-39232152 CACAAAATTGGGCAGCTGTTTGG + Intergenic
1085854322 11:80158775-80158797 CATAATCTGGGGGAGTTATTTGG - Intergenic
1085921109 11:80958055-80958077 TAGAATATGGGGCTCCTAATAGG - Intergenic
1087425727 11:97982939-97982961 GAGCATATGGGACAGATATTTGG - Intergenic
1090208573 11:124899325-124899347 CAGAATTTGGGGTAGGAATTGGG - Intergenic
1090688829 11:129156148-129156170 CACAAAATTGGGCAGCCATTTGG + Intronic
1092168167 12:6355643-6355665 CGGACTATGTGGCACCTATTGGG + Intronic
1095356383 12:41280272-41280294 CACAAAATTGGGCAGCCATTTGG + Intronic
1098697027 12:73572457-73572479 CACAATACTGGGCAGCCATTTGG + Intergenic
1099068537 12:78015331-78015353 CAGAAGATGTGACAGCTACTAGG - Intronic
1099898626 12:88680505-88680527 CTGAAAATGTGGAAGCTATTTGG + Intergenic
1101462192 12:104907581-104907603 AAGTACATGGGGAAGCTATTAGG + Intronic
1103398866 12:120628834-120628856 CAGAAAGTGGGGAAGCTATAAGG + Intergenic
1103741490 12:123094551-123094573 CAGAGTTGGAGGCAGCTATTTGG - Intronic
1106378847 13:29216457-29216479 CACAAAATAGAGCAGCTATTGGG - Intronic
1106698044 13:32199353-32199375 TGGAATATGTGGCAGCTATTAGG + Intronic
1110247722 13:73345926-73345948 CACAAAACTGGGCAGCTATTTGG - Intergenic
1114695523 14:24623812-24623834 CACAAAACTGGGCAGCTATTTGG - Intergenic
1115339045 14:32272769-32272791 CAGAAAACTGGGCAGCTGTTTGG + Intergenic
1117933193 14:60869377-60869399 CAAAATATTGAGCAGCTTTTTGG + Intronic
1119910663 14:78346494-78346516 TGGAATAGGGGGCAGGTATTAGG + Intronic
1120898713 14:89557518-89557540 CAGGATATGGGCCAGCTCCTGGG - Intronic
1124338618 15:28875744-28875766 CAGAAGATGGGGCAGGGACTGGG - Intergenic
1125169897 15:36754465-36754487 CTTTTTATGGGGCAGCTATTGGG + Intronic
1125191209 15:36996314-36996336 AAGAATGTGGGGCAGCTTTGGGG + Intronic
1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG + Intergenic
1136711030 16:32237188-32237210 GAAAATATGGGACAGTTATTGGG - Intergenic
1136756876 16:32692223-32692245 GAAAATATGGGACAGTTATTGGG + Intergenic
1136811233 16:33178152-33178174 GAAAATATGGGACAGTTATTGGG - Intergenic
1136817709 16:33288232-33288254 GAAAATATGGGACAGTTATTGGG - Intronic
1136824273 16:33344761-33344783 GAAAATATGGGACAGTTATTGGG - Intergenic
1136829339 16:33443532-33443554 GAAAATATGGGACAGTTATTGGG - Intergenic
1137517360 16:49158417-49158439 CAGAATATGTCTCTGCTATTTGG + Intergenic
1138095226 16:54206115-54206137 TAGAATATGGTCCAGGTATTGGG + Intergenic
1138183371 16:54958318-54958340 CAGGCGATGGGGCAGCTCTTTGG - Intergenic
1202989811 16_KI270728v1_random:1121-1143 GAAAATATGGGACAGTTATTGGG - Intergenic
1144242869 17:13331268-13331290 CAGCATATGGGGGGGATATTCGG - Intergenic
1148032239 17:44629255-44629277 CAGAATATGGGACAGCCAGAAGG - Intergenic
1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG + Intronic
1149291915 17:55225724-55225746 CAGAAACTTGGGCAGCTTTTAGG - Intergenic
1149785295 17:59429511-59429533 CAGAAATTTGGGCACCTATTTGG + Intergenic
1153717887 18:7869279-7869301 CACAAAATTGGGCAGCTGTTTGG - Intronic
1155857381 18:30850356-30850378 CAGAAAACTGGGCAGCCATTTGG - Intergenic
1158471515 18:57741256-57741278 TAGAATATGGCGCAGGTAATGGG + Intronic
1159467587 18:68804545-68804567 CAGAATGTGGGGCAGCTACCAGG + Intronic
1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG + Intronic
1162241098 19:9354988-9355010 CAGATCATGGGGCAGGAATTTGG - Intronic
925266118 2:2567724-2567746 TAGGAAATGGGGCAGCTAATGGG + Intergenic
926314547 2:11699734-11699756 CTGAATCTGGGGCTGCTTTTAGG + Intronic
935281560 2:101522234-101522256 GAGAATATAGGGCAGCTTTATGG + Intergenic
939998568 2:148943667-148943689 CAGCACTTGGGGCAGCTATAAGG - Intronic
941565387 2:167099589-167099611 CACAAAATTGGGCAGCTGTTTGG - Intronic
942013391 2:171787357-171787379 CATAATATTAAGCAGCTATTTGG - Intronic
1169522354 20:6387377-6387399 CAGAATAGAGGGCAACCATTGGG - Intergenic
1169884850 20:10387940-10387962 CTGAAAATGTGGCAGCAATTTGG + Intergenic
1169903662 20:10578666-10578688 CAGAAAATGCTGCAGCTACTTGG - Intronic
1170256296 20:14347853-14347875 AGGAATATGGGGCAGCTTTCAGG + Intronic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1175603382 20:60293064-60293086 CAGAGTAGGGGGCAGCTGTAGGG + Intergenic
1175689474 20:61055142-61055164 CAGAATGTGGGGCAGAGCTTTGG + Intergenic
1177266129 21:18786715-18786737 CAGAATATGCTGCATCGATTTGG + Intergenic
1178343648 21:31806753-31806775 CAGCAGATGGGGAAGGTATTCGG + Intergenic
1179545660 21:42111055-42111077 CAGAAGAGGGGGCAGCAATGTGG + Exonic
1182334207 22:29572363-29572385 CAAAATATGGAGCAGCCATTGGG + Intronic
1182647411 22:31821543-31821565 CAGAATATGGCGGAGCTACAAGG + Exonic
1182721662 22:32406711-32406733 CAGGATATGGGTTTGCTATTGGG - Exonic
952098643 3:29985430-29985452 CACAAAACCGGGCAGCTATTTGG - Intronic
953166160 3:40466634-40466656 CACAATATGAGGCAGGTATCAGG - Intergenic
953958857 3:47251709-47251731 CAGGCTGTGGGGCAGCTCTTGGG + Intronic
954335149 3:49911929-49911951 CAGAGGATGGGGCAGCTTCTGGG - Exonic
954950495 3:54468489-54468511 CACAAAATGGGGCAGCCGTTTGG + Intronic
954991884 3:54848424-54848446 CAGAATATGGGGCATTTGTTTGG - Intronic
958066242 3:88547140-88547162 CAGAATATGAGGCACATATTAGG + Intergenic
960680617 3:120243784-120243806 CAGAATAAGGAGGAGCTGTTAGG + Intronic
961679477 3:128589518-128589540 CAGAATATGGGGGAGTTTTTAGG - Intergenic
963418255 3:145026845-145026867 CCAAATATGTGGAAGCTATTTGG + Intergenic
964232443 3:154486840-154486862 CACAAAACTGGGCAGCTATTTGG + Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
974251813 4:59394586-59394608 CACAAAATGGGGCAGCTGTTTGG - Intergenic
974307130 4:60156478-60156500 CACAAAATTGGGCAGCCATTTGG - Intergenic
974575095 4:63708607-63708629 CAGAATATGGGGCTGTGACTTGG - Intergenic
980701394 4:136436397-136436419 CAGAATATGCTGCAGCTATCAGG - Intergenic
981016770 4:139981744-139981766 GAGAGGATGGGCCAGCTATTTGG + Intronic
982572954 4:157073820-157073842 CTGAATGTGGGGCAGATTTTAGG + Intergenic
988487825 5:31681126-31681148 CTGAATATGGGGCTGCAACTTGG + Intronic
988583302 5:32487462-32487484 CAGAATATGGAGCACATTTTTGG + Intergenic
996129903 5:119769585-119769607 CACAAAACTGGGCAGCTATTTGG + Intergenic
996270740 5:121602110-121602132 CAGAATACTGGGCAGCCATTTGG + Intergenic
998785403 5:145703455-145703477 TTGAAACTGGGGCAGCTATTTGG - Intronic
1000660484 5:163932849-163932871 CACAAAATTGGGCGGCTATTTGG + Intergenic
1002996078 6:2286577-2286599 CACAAAACTGGGCAGCTATTTGG + Intergenic
1012997097 6:105984933-105984955 CTGAAGATGGGGCAGATATAGGG + Intergenic
1013452955 6:110303220-110303242 CACAAAATTGGGCAGCCATTTGG + Intronic
1013672586 6:112421439-112421461 CACAAAACCGGGCAGCTATTTGG + Intergenic
1014129129 6:117811079-117811101 CACAAAACGGGGCAGCTGTTTGG - Intergenic
1014281896 6:119450739-119450761 CAGAATATGGATCAGATGTTTGG + Intergenic
1017273575 6:152538765-152538787 CAGATTGTGGGGCAACTACTGGG + Intronic
1017912475 6:158805924-158805946 CAAAATAAGGGGCATCTACTGGG - Intronic
1019559781 7:1650304-1650326 CAGAAAATGGGGCAGCTACTGGG - Intergenic
1024121947 7:46251130-46251152 CAAAATTTGGTGCAGATATTTGG - Intergenic
1026451633 7:70534366-70534388 CAGAATATCGGGGAGTTATTGGG + Intronic
1028016649 7:85722956-85722978 CACAATATGGTGAAGCTATAAGG + Intergenic
1028523603 7:91759100-91759122 CAGAAAACTGGGCAGCCATTTGG + Intronic
1029845294 7:103406260-103406282 CACAAAACTGGGCAGCTATTTGG - Intronic
1031397773 7:121293589-121293611 CACAAAATGGGGCAGCCATTTGG - Intronic
1032322102 7:130894883-130894905 CAGAGAATGGGGGAGCCATTAGG + Intergenic
1038045205 8:23760486-23760508 CAGAATATGGGCGACCCATTGGG - Intergenic
1038303643 8:26379243-26379265 CTGAAAATGTGGCAGCAATTTGG - Intergenic
1038876801 8:31559139-31559161 AAGAATATGGGCCAGCAAATAGG - Intergenic
1039418764 8:37418431-37418453 GTGAATATGGGGCAGCTGTCAGG + Intergenic
1042029207 8:64456472-64456494 CAGATGGTGGGGCATCTATTTGG - Intergenic
1042414498 8:68503580-68503602 GAGAATATTGGGCACCTGTTGGG + Intronic
1042478778 8:69280258-69280280 TAGAAAATGGGGCAGCCATTTGG + Intergenic
1042622753 8:70724472-70724494 CACAAAACTGGGCAGCTATTTGG - Intronic
1044542080 8:93419345-93419367 AAGAAAATGGGGCAGCTCATGGG + Intergenic
1046452098 8:114406517-114406539 CAGAAAATGTGGCAGCAACTTGG - Intergenic
1047829324 8:128613877-128613899 AAGTATATGGGTCAGCTATGAGG + Intergenic
1050852016 9:10300318-10300340 CAGAAAACTGGGCAGCCATTTGG + Intronic
1050907415 9:11022728-11022750 CAGAATATGAGTCAGATATTTGG - Intergenic
1057719110 9:97518081-97518103 GAGAAGATGGGGCAGGTGTTGGG - Intronic
1058738196 9:107915955-107915977 CAGATTATGGGCCACATATTTGG - Intergenic
1188130052 X:26419848-26419870 CAGAAAACTGGGCAGCCATTTGG - Intergenic
1188561279 X:31471232-31471254 CACAAAATTGGGCAGCTGTTTGG - Intronic
1189039799 X:37530541-37530563 CACAAAATTGGGCAGCTGTTTGG - Intronic
1189590609 X:42507083-42507105 CACAAAACTGGGCAGCTATTTGG + Intergenic
1190495125 X:51021147-51021169 CACAAAACTGGGCAGCTATTTGG - Intergenic
1191216251 X:57934611-57934633 CTGCATGTGGAGCAGCTATTTGG - Intergenic
1191799955 X:65067224-65067246 CACAAAATGGGGCAGCTGTTTGG - Intergenic
1191802674 X:65098790-65098812 CACAAAATGGGGCAGCTGTTTGG + Intergenic
1192567493 X:72177607-72177629 AAAAAGATGGGGCAGGTATTAGG - Intergenic
1195434727 X:104829212-104829234 CACAAAATTGGGCAGCCATTTGG - Intronic
1195842715 X:109192066-109192088 CAGAAAACTGGGCAGCTGTTTGG + Intergenic
1195946892 X:110224110-110224132 CATAATATGGGGCAGCCCTGTGG - Intronic
1197395637 X:125923419-125923441 CACAAAATTGGGCAGCTGTTTGG - Intergenic
1198295425 X:135282570-135282592 CACAAAACTGGGCAGCTATTTGG - Intronic
1199621639 X:149706561-149706583 CAGAAGATGAGGTAGCCATTTGG - Intronic