ID: 971344583

View in Genome Browser
Species Human (GRCh38)
Location 4:25800019-25800041
Sequence CAGGATAGACAGAAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1088
Summary {0: 1, 1: 0, 2: 8, 3: 106, 4: 973}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971344583_971344587 19 Left 971344583 4:25800019-25800041 CCATCTTCTTTCTGTCTATCCTG 0: 1
1: 0
2: 8
3: 106
4: 973
Right 971344587 4:25800061-25800083 CATAAAGAAAGCGATGTGAAGGG No data
971344583_971344586 18 Left 971344583 4:25800019-25800041 CCATCTTCTTTCTGTCTATCCTG 0: 1
1: 0
2: 8
3: 106
4: 973
Right 971344586 4:25800060-25800082 GCATAAAGAAAGCGATGTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971344583 Original CRISPR CAGGATAGACAGAAAGAAGA TGG (reversed) Intronic
900182414 1:1317509-1317531 CAGGAAAGACAAACAGATGACGG + Intronic
900235992 1:1590938-1590960 AAGCAAAGACAGAAAGGAGATGG + Intergenic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
900892337 1:5458479-5458501 AAGGAAAGAAAGAAAGAAGGAGG - Intergenic
901347321 1:8557417-8557439 CAGGATCGACATAATGAAAATGG - Exonic
901903261 1:12385447-12385469 CAGGATAGAAAGAAAACAGAAGG - Intronic
902113182 1:14099959-14099981 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
902566246 1:17313545-17313567 AAGGAAAGAAAGAAAGAAAATGG + Intronic
903705691 1:25284104-25284126 CAGGACACACAGAAAAGAGAGGG - Intronic
903721550 1:25409316-25409338 CAGGACACACAGAAAAGAGAGGG + Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904037397 1:27566216-27566238 GAAGAGAGACAGAAAGATGAAGG + Intronic
904408661 1:30311709-30311731 CGGGATAGTCAGAGAGAAAAAGG - Intergenic
905021934 1:34823705-34823727 CAGCATTGTCAGGAAGAAGAGGG - Intronic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905394812 1:37660452-37660474 AAAGACAGACAGATAGAAGACGG - Intergenic
905407198 1:37742049-37742071 CAGGATAGAGAGGTAGAAGATGG + Intronic
906095710 1:43222640-43222662 CAGGACAGACGGGAAGAAGGTGG + Intronic
906301671 1:44686739-44686761 GAGGATAGAAAGAAAAAAAATGG + Intronic
907315282 1:53566732-53566754 CAGGAAAGAGAGAGAGAAGGTGG - Intronic
907649728 1:56283587-56283609 AAGGATAGAAGGAAAGCAGAAGG + Intergenic
907769030 1:57441328-57441350 AAAGAAAGAAAGAAAGAAGAAGG - Intronic
907907781 1:58799912-58799934 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
907973766 1:59410951-59410973 TAGGAGAGAAAGAAAGAAGTTGG - Intronic
908320162 1:62971107-62971129 CTCGAAAGAAAGAAAGAAGAGGG + Intergenic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908700064 1:66889331-66889353 CATTAAAGACAGAAAGGAGAAGG - Intronic
908762174 1:67522475-67522497 AAGGAGAGAAAGAAAGAAAAGGG - Intergenic
909041483 1:70658093-70658115 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
909096364 1:71293180-71293202 GAGAAGAGAGAGAAAGAAGAGGG - Intergenic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909318861 1:74257073-74257095 GAGAACAGAAAGAAAGAAGAAGG - Intronic
909437447 1:75659361-75659383 AAGGAAAGAAAGAAAGAAAAAGG + Intergenic
909456370 1:75854316-75854338 CAGCATAGGCAGAGTGAAGATGG - Intronic
909660709 1:78078711-78078733 CAGGATAGAGAAAAACAAAAAGG - Intronic
909861622 1:80612624-80612646 AAGGAAAGAAAGAAAGAAAATGG + Intergenic
910455095 1:87389394-87389416 CAGGGAAGACAGAAAGAAGTGGG + Intergenic
910455372 1:87392123-87392145 CAGGCTAGACAGAAACAATCTGG + Intergenic
910662231 1:89686207-89686229 CAGGTGGGACAGAAAGAACATGG - Intronic
910865674 1:91786297-91786319 CAAGCTAGACAGAAAGAATCAGG + Intronic
911239584 1:95450292-95450314 GAGGATAGACAGAAAAATCAGGG - Intergenic
911737503 1:101353871-101353893 AAGGAGAGATAGAGAGAAGAAGG - Intergenic
912145164 1:106784754-106784776 GAGGTTAGCCAGGAAGAAGAAGG - Intergenic
912244070 1:107942540-107942562 CAGGATACACAGATATAAAAAGG - Intronic
913251128 1:116912539-116912561 CAGGAAGGAAAGAAAGAAGCTGG - Intronic
913338663 1:117734288-117734310 CAGGAGAGGCAGAAAGACAAAGG - Intergenic
913569745 1:120108778-120108800 CAGGTTACACAGAGAGCAGATGG - Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
913698772 1:121354366-121354388 AAGGACAGAAAGAAAGAAGTGGG - Intronic
914138773 1:144925667-144925689 AAGGACAGAAAGAAAGAAGTGGG + Intronic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914290555 1:146269740-146269762 CAGGTTACACAGAGAGCAGATGG - Intergenic
914551599 1:148720523-148720545 CAGGTTACACAGAGAGCAGATGG - Intergenic
914699187 1:150115224-150115246 CAGCACAGACAGATAGCAGATGG - Intronic
914939690 1:152011985-152012007 CAGGAGAGAGAGAGAGAAGGGGG + Intergenic
915080573 1:153349102-153349124 CAGGATGGACAGAGAGAAACTGG + Intergenic
915535554 1:156533425-156533447 GAGGAAGGACAGAATGAAGATGG - Intronic
915571324 1:156746830-156746852 CAGGAGAGACAGAAAGGCCAAGG + Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915623421 1:157099665-157099687 CAGGAAAGAAAGAGAGAAAAGGG + Exonic
916142997 1:161715799-161715821 CAGGCTAGACAGAAAGAGACGGG - Intergenic
916147257 1:161750633-161750655 CAGCAAAGACAAAAAGAAAATGG + Intronic
916349034 1:163827885-163827907 CAGTATAAACAAAAAGCAGAGGG - Intergenic
916485092 1:165251517-165251539 GAGGTAAGACAGAAAGAAGGGGG + Intronic
916521452 1:165567190-165567212 GAGGATTCAGAGAAAGAAGAAGG + Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916683166 1:167122318-167122340 AAGTAGAGAGAGAAAGAAGAGGG - Intronic
917846555 1:179025570-179025592 CAGGAAAGAAAAAGAGAAGACGG + Intergenic
918469976 1:184861772-184861794 GAGGAAAGAAGGAAAGAAGAAGG + Intronic
918485306 1:185022466-185022488 CAAGAGAGACAGAATGAAAAGGG + Intergenic
918485670 1:185026278-185026300 CAGGAGAGACAGAGAGCAGGGGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
918791479 1:188836193-188836215 CTGTATAGATAGGAAGAAGAAGG + Intergenic
919157985 1:193791414-193791436 GAGGAGAGACAAAGAGAAGAAGG - Intergenic
919232529 1:194792438-194792460 CAGGAGAGAAAGAAAGAAGGAGG + Intergenic
919367765 1:196686045-196686067 CAGGAGAGACAGAGAGCAAAGGG + Intronic
919424915 1:197417837-197417859 AAGGATAGAAAGAGGGAAGAAGG + Intronic
919846109 1:201643223-201643245 AAGGAAAGAAAGAAAGAAAAGGG - Intronic
920053980 1:203179714-203179736 CAGGACAAAGAGAAAGAAGGAGG - Intronic
920154549 1:203937746-203937768 GAGGAAAGAAAGAAAGAAAAAGG + Intergenic
920232099 1:204477556-204477578 AAGGATGGAAAGAAAGGAGAGGG + Intronic
920233090 1:204483088-204483110 CAGGAGAGAGAGAAAGCAGGAGG - Intronic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920486180 1:206373069-206373091 AAGGACAGAAAGAAAGAAGTGGG - Intronic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
920770727 1:208882416-208882438 AAAAAAAGACAGAAAGAAGAGGG + Intergenic
921954727 1:220970318-220970340 CAGAAGAGACTGAAAGAAAAAGG + Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
923232306 1:231998420-231998442 CAGGATAGAAAAAAAGGTGATGG + Intronic
923638860 1:235731031-235731053 AGGGATAGACAGAAATCAGAAGG - Exonic
923642210 1:235775667-235775689 AAGGCTACACAGAGAGAAGATGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923862713 1:237907657-237907679 CAGGGTGGAGAGAAAGGAGAGGG + Intergenic
923940319 1:238816363-238816385 AAGGACAGACAGAAAGTACAAGG + Intergenic
924683578 1:246263477-246263499 AAGGTTAGACAGTAAAAAGAAGG - Intronic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1063777891 10:9284811-9284833 CAGGGTAGAAAGAAAGGAGGTGG - Intergenic
1064336502 10:14448188-14448210 CAGGACAGACTGGCAGAAGAGGG - Intronic
1064680461 10:17806512-17806534 CAGCAGAGAAAGAGAGAAGAAGG - Intergenic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1065035277 10:21631657-21631679 CAGGAGAGAGAAAATGAAGAGGG + Intronic
1065262293 10:23936549-23936571 GAGGATACACACAGAGAAGAAGG + Intronic
1065360031 10:24880950-24880972 AAGGAAAGAAAGAAAGAAGAAGG - Intronic
1065413311 10:25455025-25455047 CAGGCTAGAAATAAAGAAGTGGG - Intronic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1068042637 10:51845242-51845264 CTGGAAAGACAGCAAGAAGAGGG - Intronic
1068118285 10:52758664-52758686 AAGGATAGAAAGATAGGAGAGGG - Intergenic
1068477208 10:57543109-57543131 AAGGAAAGAAAGAAAGAAAAAGG + Intergenic
1068842911 10:61636101-61636123 GAGGATAGTCAGAAAGTAAATGG + Intergenic
1069107145 10:64397191-64397213 AAGTAAAGAAAGAAAGAAGAGGG + Intergenic
1069138390 10:64794018-64794040 CAAGAAAGAGAGAAGGAAGAAGG - Intergenic
1069404108 10:68079687-68079709 CAGGATAGATAGAAACATGGGGG + Intergenic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070427719 10:76305415-76305437 CATGAAAGAAAGAAAGAGGAAGG - Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070661808 10:78312033-78312055 AAAGAAAGAAAGAAAGAAGAGGG - Intergenic
1070661820 10:78312169-78312191 CAGGACAGATTGAAAGAGGAGGG + Intergenic
1071027621 10:81134803-81134825 CAGGGAAGACAGACAGAATAAGG + Intergenic
1071840520 10:89465935-89465957 CAGAATCTACAGGAAGAAGAGGG - Intronic
1071849490 10:89554141-89554163 AAGGAAAGAAAGAAAGAAAATGG + Intronic
1071981947 10:91012351-91012373 CAGGACAGACAGATTGAAGGAGG - Intergenic
1072072352 10:91931426-91931448 AAGGATAGACAGACAGATGGAGG - Intronic
1072531033 10:96319542-96319564 CAGTCTCGATAGAAAGAAGAAGG - Intronic
1072548718 10:96460613-96460635 CAGGAGAGAGCGAAAGAAGGGGG - Intronic
1073196603 10:101696155-101696177 CAGGATAAACAGACAGAAATTGG - Intergenic
1073551025 10:104401457-104401479 CAAGATTTAAAGAAAGAAGAAGG - Intronic
1073662644 10:105493857-105493879 GAGGATGGAGGGAAAGAAGAAGG + Intergenic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1074485059 10:113868258-113868280 CAGGAAAGAGGGAGAGAAGAGGG - Intronic
1075182847 10:120227563-120227585 GGGGTTAGACACAAAGAAGAGGG - Intergenic
1075468988 10:122673671-122673693 GAGGATACAAAGAAAGAAGGTGG - Intergenic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1075847208 10:125554654-125554676 CAAGATTGACAGGAGGAAGATGG - Intergenic
1076120483 10:127933028-127933050 CAGGAGAGCCAGAGAGATGAGGG - Intronic
1076192713 10:128494172-128494194 TTAGATAGACAGAAAGAAGGAGG + Intergenic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076643494 10:131935167-131935189 GAGGCTCAACAGAAAGAAGAGGG - Intronic
1077136302 11:1000999-1001021 CAGGACAGACACAGACAAGACGG - Intronic
1077390319 11:2297935-2297957 AAGGAGAGAGAGAGAGAAGAGGG + Intronic
1077874866 11:6295461-6295483 GAGGACAGAAAGAAAAAAGAAGG - Intergenic
1077928160 11:6703302-6703324 CAGCATGGTCAGAAAGAAGAAGG + Intergenic
1077941436 11:6847811-6847833 CAAAAAAGACAGAAAGATGAGGG + Intergenic
1078712486 11:13807846-13807868 CAAGACACAGAGAAAGAAGACGG - Intergenic
1078922811 11:15846042-15846064 GATGATAGAGAGAAACAAGAGGG - Intergenic
1079062690 11:17263323-17263345 GAGGCTGGACAGAAAGATGAAGG + Intronic
1079199710 11:18365584-18365606 AAGGAAAGACAGAAAGTAGGGGG - Intronic
1079529426 11:21432155-21432177 TAGGATACACAGAAAAAAAAAGG - Intronic
1079572339 11:21959408-21959430 AAGGATAGAAAGAATGAACAAGG + Intergenic
1080740353 11:35058176-35058198 CAGGAGAGAGAGAAAGAATGAGG - Intergenic
1081417868 11:42837335-42837357 CAGGAGAGAGAGAGAGAAGGGGG + Intergenic
1081464813 11:43306665-43306687 AAGGAAAGAAAGAAAGAAAAGGG + Intergenic
1081649366 11:44813257-44813279 GAGGACAGACACAAAGGAGAGGG + Intronic
1081782110 11:45720364-45720386 GAGGAGAGACACAGAGAAGAAGG - Intergenic
1081878534 11:46428162-46428184 CAAGAAAGGAAGAAAGAAGAAGG + Intronic
1082014652 11:47475782-47475804 CAGAATAGCCAGATAGAAAATGG - Intronic
1082025847 11:47571426-47571448 CAGCAGAGAAAGAAAGAAGCAGG - Intronic
1082147664 11:48689817-48689839 CAGGATAGATAGAAACTAGAAGG + Intergenic
1082176982 11:49071902-49071924 TAGTACAGACAGAAAGAATAAGG - Intergenic
1082589788 11:54991827-54991849 CAGGATAGATAGAAACTAGAAGG + Intergenic
1083336074 11:61922637-61922659 GAGGCTAACCAGAAAGAAGAGGG - Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1084472283 11:69370007-69370029 CAGAATAGGCAGAGAGGAGAAGG + Intergenic
1084773443 11:71358958-71358980 GATGATAGATAGAAAGATGATGG - Intergenic
1085324000 11:75592840-75592862 CAGGAAAGGCAGGAAGGAGAGGG - Intronic
1085473180 11:76771227-76771249 TTGGACAGACAGAAAGCAGAGGG - Intergenic
1085750850 11:79160038-79160060 AAGGATAGAAAGAATGAAAATGG - Intronic
1086022370 11:82247094-82247116 GAGGATAGAAAGAAATAAAAAGG + Intergenic
1086670066 11:89535580-89535602 AAGGAGAGAGAGACAGAAGAGGG - Intergenic
1086688729 11:89763957-89763979 TAGTACAGACAGAAAGAATAAGG + Intergenic
1086717129 11:90076000-90076022 TAGTACAGACAGAAAGAATAAGG - Intergenic
1086925098 11:92631531-92631553 CAGGAGAGACAGAAAGCAAAGGG - Intronic
1088131183 11:106493059-106493081 AAGAATAGACACAAAGATGAAGG + Intergenic
1088783025 11:113154812-113154834 AAGGAATGACACAAAGAAGAAGG + Intronic
1088905309 11:114151069-114151091 CAGAATAGATAGGAAGCAGACGG - Intronic
1088938999 11:114434973-114434995 CAGAAAAGACAGGAAGATGAGGG - Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089763985 11:120749654-120749676 GAGGACAGACAGCAGGAAGATGG + Intronic
1089910314 11:122092404-122092426 AAGGAGAGAAATAAAGAAGAAGG + Intergenic
1090066211 11:123505841-123505863 AGGGAGAGAAAGAAAGAAGAAGG - Intergenic
1090549097 11:127799515-127799537 AAATATAGACAGATAGAAGATGG - Intergenic
1090590567 11:128262544-128262566 GAGGATGCACAGAGAGAAGACGG - Intergenic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1092017470 12:5171197-5171219 CAAGACAGAAAGAAAGAACAAGG + Intergenic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092588714 12:9928474-9928496 AAAGAAAGAAAGAAAGAAGAAGG + Intronic
1092736696 12:11589485-11589507 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1093689163 12:22090139-22090161 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1094005570 12:25746468-25746490 AAGGAGAGAGAGAGAGAAGAAGG - Intergenic
1094036832 12:26081123-26081145 CAGGAGAGACAGAGAGCAAAGGG + Intergenic
1094285301 12:28786029-28786051 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1094285302 12:28786048-28786070 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1094413739 12:30196024-30196046 CAGGAAAAAAAGAAAGAATAAGG - Intergenic
1094546506 12:31409302-31409324 CAGCATTGAGAGAAAGAAGGTGG + Exonic
1095125956 12:38477569-38477591 CAGCATGGAAGGAAAGAAGAGGG + Intergenic
1095158303 12:38885867-38885889 CAGGAGAGAGAGAGAGAAGGGGG - Intronic
1095328460 12:40927293-40927315 TAGGAAAGACACAAAGAAGATGG + Intronic
1095573224 12:43705767-43705789 CAAGAAAGAAAGAAAGAAGGGGG - Intergenic
1095772027 12:45970371-45970393 CTGGTTACACAGAAAGAAGAGGG + Intronic
1096280958 12:50253137-50253159 CAGTAAATATAGAAAGAAGAGGG + Intronic
1096751104 12:53759306-53759328 CAGCATAGGGAGAAAGGAGAAGG + Intergenic
1096765875 12:53888944-53888966 AAAGAAAGAAAGAAAGAAGACGG - Intergenic
1096922595 12:55103577-55103599 CAGGAGAGAGAGAGAGAAGGCGG - Intergenic
1097133904 12:56835695-56835717 CAGGATAGAAGGAAAGTAAAAGG - Intergenic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097653159 12:62328724-62328746 CAGTTTTGACAGAAAGAGGAAGG + Intronic
1098078049 12:66754764-66754786 GAGGATAGAAAGTAATAAGAGGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098499213 12:71171036-71171058 CAGGAAAGACAGAAAAATGCTGG - Intronic
1098922399 12:76314514-76314536 AAAGAAAGAAAGAAAGAAGAAGG + Intergenic
1099254914 12:80303693-80303715 CTGGAAAGACAGAAAGAATGAGG + Intronic
1099427657 12:82544572-82544594 AAGGAAAGAAAGAAAGAAAAAGG - Intergenic
1099516030 12:83597651-83597673 GTGGATATACATAAAGAAGATGG + Intergenic
1099536211 12:83848208-83848230 AAGGAAACACAGAGAGAAGAAGG - Intergenic
1099921828 12:88967698-88967720 CAGGAGAGACAGAAAGCTAAGGG + Intergenic
1100184939 12:92128858-92128880 CAGGATAGGCAGAAAGACTAGGG - Intronic
1100430115 12:94524323-94524345 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1100614451 12:96220241-96220263 AAGGAGAGAAAGAAAGAAAAAGG - Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101622736 12:106405162-106405184 CAGGATTGAAAGAAAAAAGTTGG - Intronic
1101799398 12:108007510-108007532 CAGGAAAGAGAGTGAGAAGAGGG + Intergenic
1102575787 12:113855386-113855408 CAGGATAGGCTGAAAGGAGGGGG - Intronic
1102864054 12:116360341-116360363 AGGGAAAGAAAGAAAGAAGAAGG - Intergenic
1102864750 12:116365423-116365445 GAGGAAAGACAGAATGAACATGG + Intergenic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1102992476 12:117324980-117325002 GAGGAAAGAAAGAAAGAAAATGG + Intronic
1103017346 12:117505782-117505804 CAGCATAGACAGAAGCAAGAAGG - Intronic
1103170396 12:118813638-118813660 CATGAAAGACAGACAAAAGAAGG - Intergenic
1103227664 12:119302104-119302126 AAAGAAAGAAAGAAAGAAGAAGG + Intergenic
1104020818 12:124991059-124991081 CATTCTAGACAGCAAGAAGAAGG + Intergenic
1104021987 12:124998564-124998586 CCGTAGAGACAGAAAGCAGATGG + Intronic
1104044050 12:125149239-125149261 AAGGAAAGAAAGAAAGAAGTAGG - Intergenic
1104052910 12:125208479-125208501 CTGGAGAGACACAAAGCAGATGG - Intronic
1104247907 12:127060864-127060886 CAGGAGAGTCAGAAAGGAGATGG - Intergenic
1104606566 12:130193737-130193759 CAGGGTAGAAAGGATGAAGACGG - Intergenic
1104693315 12:130842987-130843009 GAAGAAAGAAAGAAAGAAGAAGG + Intergenic
1104770401 12:131358147-131358169 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1105707591 13:22977694-22977716 AAGGAAAGAGAGAAAGAAGAAGG + Intergenic
1105801717 13:23909825-23909847 CAGGAAAGACAGCATGAATAGGG - Intergenic
1106118460 13:26837675-26837697 CAGGAGAGAAAGAGAGCAGAAGG + Intergenic
1106467311 13:30024410-30024432 AAGGAAAGAAAGAAAGAAAACGG + Intergenic
1106546188 13:30732851-30732873 CAGAAGAGAGAGAAAAAAGAGGG + Intronic
1106618309 13:31350702-31350724 AAGGAAGGACAGAGAGAAGATGG - Intergenic
1106681015 13:32007745-32007767 CAGGATAGTCAGAAAGCTCATGG + Intergenic
1106721937 13:32443856-32443878 CTGGATATAAAGAAAAAAGATGG - Exonic
1107247379 13:38311916-38311938 GAAGATAGATAGAAAGAAGGAGG - Intergenic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108346000 13:49547737-49547759 AAAGATAGAAAGAAAGAAGATGG + Intronic
1109305936 13:60641712-60641734 CAGTTTAGACAGTAAGAAAAAGG + Intergenic
1109532693 13:63672118-63672140 GATAATAGAGAGAAAGAAGATGG + Intergenic
1109786036 13:67176174-67176196 CAAGAAAGAAAGACAGAAGATGG + Intronic
1109917512 13:69010989-69011011 AAGGATAGAAAGAAGGCAGAGGG - Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110085708 13:71376714-71376736 CAGGAAAGATAGAAAATAGAAGG - Intergenic
1110305988 13:73987569-73987591 CAGGGAAGAGAAAAAGAAGAAGG + Intronic
1111295217 13:86268888-86268910 AAGGAAAGAAAGAAAGAAAAGGG - Intergenic
1111343248 13:86914934-86914956 CAGAAAAGACAGAAAGTACAGGG - Intergenic
1111653240 13:91120010-91120032 GGGGACAGACAGAAATAAGAAGG - Intergenic
1112164450 13:96903239-96903261 AAGGAAAGACAGAAAGCAGAGGG + Intergenic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1112752868 13:102599452-102599474 GAGGATGGATAGAAAGAAAAAGG + Intronic
1112837996 13:103539581-103539603 TAGGTTAGACAGAAAGGGGAGGG + Intergenic
1113102252 13:106733354-106733376 AAGAAAAGAAAGAAAGAAGAAGG - Intergenic
1113134870 13:107078188-107078210 CAGGAGAGAGAGAGAGAAGGAGG - Intergenic
1113217883 13:108063417-108063439 CAGGAAAGAAAGAATGAAGGAGG + Intergenic
1113392163 13:109908308-109908330 CAGAAAAGAGAGAGAGAAGAGGG + Intergenic
1113542309 13:111118363-111118385 AAGGTTAGACAGTGAGAAGATGG + Intronic
1113785308 13:112999310-112999332 CAGGAGAGACGCACAGAAGAGGG + Intronic
1114804056 14:25813508-25813530 CTGGTTAGAGAGAAAGTAGAGGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115199424 14:30836871-30836893 CCGAAAAGAAAGAAAGAAGAAGG + Intergenic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115475201 14:33806682-33806704 TAGGAGACACAGAAAGCAGAAGG - Intergenic
1115946811 14:38671268-38671290 CAGGAGAGAGAGAGAGAAAAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117472545 14:56060839-56060861 AAGGAAAGACACAAACAAGAAGG + Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118746885 14:68780757-68780779 CAGGATGCACAGAGAGAAGCAGG + Intergenic
1118964038 14:70562686-70562708 CAGGAGAGAGAGAAAAAAGGGGG - Intergenic
1119400759 14:74360608-74360630 CAGGAAACCCAGACAGAAGAAGG - Intergenic
1119489532 14:75018984-75019006 AATGAAAGACAGAAACAAGAAGG + Intronic
1119858739 14:77921597-77921619 CAGCATAGACAGAGACAGGAGGG - Intronic
1120122971 14:80704784-80704806 AAAGGTAGAAAGAAAGAAGAAGG - Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120641519 14:87019167-87019189 CAGGATATACAGAGCAAAGAGGG + Intergenic
1120877401 14:89387745-89387767 TGGGGTATACAGAAAGAAGAGGG + Intronic
1121237799 14:92405662-92405684 CAGGAGAGAGAGAGAGAAGGGGG + Intronic
1121552032 14:94810091-94810113 CAGGAAAGGCAGAAACAACATGG - Intergenic
1121774105 14:96578847-96578869 GAGCATAGCCAGGAAGAAGAGGG - Intergenic
1121800274 14:96768929-96768951 AAGGAAAGAAAGAAAGAAGGAGG - Intergenic
1122443695 14:101753628-101753650 CAGGAGAGAGAGAGAGAAGGGGG - Intergenic
1122671729 14:103378015-103378037 AAGGATAGAGAGAAAGAATAAGG - Intergenic
1123189252 14:106552049-106552071 CAGGAGAGAGAGAAAGAGCAAGG - Intergenic
1123878694 15:24652922-24652944 CAGGGGAGAGAAAAAGAAGAGGG + Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124523043 15:30422019-30422041 TAAGTTAGACAGAAAGTAGAAGG - Intergenic
1124535623 15:30544197-30544219 TAAGTTAGACAGAAAGTAGAAGG + Intergenic
1124685340 15:31777510-31777532 CAGGATGGACAGAAAATGGAGGG + Intronic
1124763031 15:32463399-32463421 TAAGTTAGACAGAAAGTAGAAGG - Intergenic
1124775597 15:32585656-32585678 TAAGTTAGACAGAAAGTAGAAGG + Intergenic
1125004631 15:34803389-34803411 CAGGGAACACAGAAAGTAGATGG - Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125428530 15:39573719-39573741 GAAGGAAGACAGAAAGAAGAGGG + Intergenic
1126335809 15:47585027-47585049 TAAGATAGGCAGAAAGACGATGG - Intronic
1126519422 15:49574472-49574494 CAGGAAAGACAGAAAGGGAAGGG - Intronic
1126560728 15:50040853-50040875 CAGGAAAGAAAGGAAGTAGAGGG + Intronic
1126595691 15:50382565-50382587 CAGGATACAAAGAGAGAAGGGGG - Intergenic
1126863535 15:52912441-52912463 GAGGATAAACAGAAAGCACAGGG - Intergenic
1126932490 15:53670508-53670530 CTGGACAGATAGAAAGAACATGG - Intronic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1129773436 15:78217467-78217489 CAGGATAGGGACAAAGAATAGGG + Intronic
1129792644 15:78351720-78351742 CAGGTAAAACAGAAAGAACAAGG + Intergenic
1129849774 15:78786622-78786644 AAGGAAAGACTGAAAGGAGAAGG - Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131336909 15:91557966-91557988 CAGGAGAGAGAGAAAGCAAAGGG + Intergenic
1131352602 15:91715168-91715190 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1131426908 15:92353226-92353248 CAGGAGAGACAGAAAACAAAGGG - Intergenic
1131865313 15:96702572-96702594 CAGGATACACAGAAAAATGTAGG - Intergenic
1132477302 16:147050-147072 CATGAGAGAGTGAAAGAAGATGG + Intergenic
1133047377 16:3096310-3096332 CAGGAAGGGCAGAAAGCAGAGGG - Intronic
1134033084 16:11008222-11008244 AAGGACAGACTGAAAAAAGATGG - Intronic
1134289208 16:12890130-12890152 CAGGAAAGACAGAAACAAAAAGG + Intergenic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135123533 16:19786854-19786876 AAGGAAAGAAAGAAAGAAAAGGG + Intronic
1135155706 16:20051073-20051095 AAAGAAAGAAAGAAAGAAGAAGG + Intronic
1135891777 16:26363797-26363819 GAGGAGAAAGAGAAAGAAGAAGG - Intergenic
1136589082 16:31206360-31206382 GAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1137842519 16:51653440-51653462 AAGGAAGGAAAGAAAGAAGAAGG - Intergenic
1138524136 16:57592165-57592187 TTGGATAGACAGAGAGTAGATGG - Intergenic
1138557699 16:57782170-57782192 AAGAATGGACAGAAAAAAGATGG - Intronic
1139092899 16:63670793-63670815 TAGGAAAGAAAGAAAGAAGAGGG + Intergenic
1139722399 16:68867061-68867083 CAGGACTGAGAAAAAGAAGAAGG - Exonic
1140119123 16:72068163-72068185 GAGGATATAGAGAAAGAAGCTGG + Intronic
1140280009 16:73545268-73545290 AAGGAAAGAGAGAAAGAAAATGG - Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1141000215 16:80300730-80300752 CAGGAAACACAGAAAAAAAAAGG + Intergenic
1141029915 16:80578731-80578753 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1142928344 17:3260422-3260444 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
1142943199 17:3400684-3400706 TGGGACAAACAGAAAGAAGAAGG + Intergenic
1143366490 17:6412124-6412146 AAAGAAAGAAAGAAAGAAGAAGG + Intronic
1143375557 17:6464772-6464794 CTGGAAGGACAGAAAGAAGCTGG + Intronic
1143737740 17:8925085-8925107 GTGGATAGATAGAAAGTAGATGG + Intronic
1143737745 17:8925181-8925203 ATAGATAGACAGAAAGTAGATGG + Intronic
1144048598 17:11477337-11477359 CACAAAAGACAGAAAGAAAATGG - Intronic
1144767225 17:17739427-17739449 CAGGAGGGAGAGAAAGAAGAGGG + Intronic
1145855603 17:28153964-28153986 CATGAGAGACAGAAAAAAAAAGG - Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146498714 17:33345923-33345945 CAGCAGAGACAGAAACAAGGAGG + Intronic
1146663115 17:34678340-34678362 AAGGGTAGACAGGAAAAAGAAGG - Intergenic
1147117785 17:38314955-38314977 CAGGAGAGACATAATGAAGTGGG - Intronic
1147238485 17:39074945-39074967 AAGGAAAGAAAGAAAGAAAAAGG - Intronic
1147399963 17:40174780-40174802 CTGGGTGGGCAGAAAGAAGAGGG + Intergenic
1147445543 17:40473152-40473174 CAGCATTCACAGAAAGCAGATGG - Intergenic
1147527106 17:41236041-41236063 AAAGAAAGAAAGAAAGAAGAAGG + Intronic
1147995075 17:44355771-44355793 CAGGATGGTGAGCAAGAAGATGG + Exonic
1148197932 17:45728223-45728245 CAGGATAGACAGACACAGGGAGG - Intergenic
1148259108 17:46163909-46163931 CAGTATAGGCAGAAAGCACAGGG - Intronic
1148356764 17:46980351-46980373 AAGAAGAGAAAGAAAGAAGAAGG - Intronic
1148653308 17:49265213-49265235 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1149398087 17:56265337-56265359 CAGGCGAGAAAGAGAGAAGAAGG + Intronic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1150324690 17:64247290-64247312 AAGAAAAGAAAGAAAGAAGAAGG + Intronic
1150541356 17:66103376-66103398 GAGGATAGAAAGAAAGAAGAGGG + Intronic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150653832 17:67026894-67026916 CAGGAGAGAGAGAAAGGAGGTGG - Intronic
1150882666 17:69048038-69048060 CAGGAGAGACAGGAAGCAAAGGG + Intronic
1150960623 17:69908370-69908392 CAGGAAAGAGAGAGAGAAAAAGG + Intergenic
1151999859 17:77638462-77638484 TAGGAGAGACGGAAAGAAGTGGG + Intergenic
1152135014 17:78498648-78498670 CAGGAAAGAAAGAAAGGAGGGGG - Intronic
1152430295 17:80245130-80245152 CAGGATGGAGGGAAAGGAGATGG - Intronic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153957437 18:10109957-10109979 CAGGCTAGAAAGAAAGATGTCGG - Intergenic
1154485776 18:14870649-14870671 GAGCACAGACAGATAGAAGAGGG - Intergenic
1154928978 18:20972783-20972805 CAAGAGAGAATGAAAGAAGACGG + Intronic
1155022468 18:21909281-21909303 TAGGGTAGATAGAAAGAAGCTGG - Intergenic
1155393316 18:25360291-25360313 AAAGAGAGAGAGAAAGAAGACGG - Intergenic
1155829217 18:30491997-30492019 AAGGAAAGAAAGAAAGAAAAAGG + Intergenic
1156017137 18:32559593-32559615 AAGGGTTGAAAGAAAGAAGAAGG + Intergenic
1156165937 18:34421184-34421206 AAGGAAGGAGAGAAAGAAGAAGG + Intergenic
1156542547 18:37929310-37929332 CAGGAGAGAGAAAGAGAAGAGGG + Intergenic
1157077403 18:44480404-44480426 CAGGAGAGAGAGAAAGCACAGGG - Intergenic
1157235453 18:45961114-45961136 CAGGATTGTCAGAGAGAAGGTGG - Intronic
1157353754 18:46914939-46914961 CGGAATAGAAAGAAAGAAAAGGG - Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157548971 18:48567653-48567675 CATGCTAGTCAGAAAGAAGTGGG + Intronic
1157678619 18:49586496-49586518 TTGGATAGACAGAAGGAAGCAGG + Intronic
1158455757 18:57605879-57605901 CATGATGTAAAGAAAGAAGATGG - Exonic
1158589249 18:58765853-58765875 TAGGAAAGACAAAAAGGAGATGG - Intergenic
1159306291 18:66647184-66647206 CAGGCTAGACAGCAATTAGAGGG - Intergenic
1159400209 18:67921932-67921954 CAGGATGTACAGGAAGAAGAAGG - Intergenic
1159508531 18:69365667-69365689 CAGGATAGTGATAAAGAAGAAGG - Intergenic
1159644661 18:70903287-70903309 CAGGGTAGTCAGATAGAAGGAGG + Intergenic
1159892605 18:73966656-73966678 CAGGAGAGACAGAAAGCTAAGGG - Intergenic
1160000802 18:75019825-75019847 CAGGAGAGAGAGAGAGAAGGGGG + Intronic
1160616136 18:80130683-80130705 CAGGAGAGAGAGAAACAACAAGG - Intronic
1161324935 19:3659027-3659049 CAGGACAGCCAGGAAGGAGAAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161625942 19:5326829-5326851 CAAGAGAGAAAGAAAGAAAAAGG + Intronic
1161664494 19:5567311-5567333 GACAAGAGACAGAAAGAAGAGGG + Intergenic
1161999793 19:7736480-7736502 GAGGAAAGAAAGAAAGAAAAAGG - Intergenic
1162104710 19:8363444-8363466 AAGGAAAGAGAGAAAGAGGAAGG - Intronic
1162144008 19:8602197-8602219 CAGTACAGACAGAAAAAAGGTGG - Intronic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162334096 19:10049652-10049674 AAAGAAAGAAAGAAAGAAGAAGG + Intergenic
1162991854 19:14308106-14308128 CTGGACAGACAGAAAGAACCTGG + Intergenic
1163389309 19:17020698-17020720 AAGGGTGGAGAGAAAGAAGAGGG + Intronic
1163819572 19:19488253-19488275 CAGGATGGACAGACACAACAGGG - Intronic
1164077623 19:21834786-21834808 AAGGAAGGAAAGAAAGAAGAAGG + Intronic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1164611812 19:29637440-29637462 CAGCAGAGACACAAACAAGAAGG + Intergenic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1165159716 19:33808802-33808824 CAGGATGGAGATAGAGAAGATGG + Intronic
1165163745 19:33835226-33835248 CAAGATTGACAGAGAGAAAAAGG + Intergenic
1165370192 19:35400569-35400591 AGAGAGAGACAGAAAGAAGAAGG + Intergenic
1165375255 19:35437360-35437382 CTGGATACACAGGAAGTAGAGGG - Intergenic
1165729157 19:38133331-38133353 AAGGAATGACAGAATGAAGATGG - Intronic
1165881527 19:39047422-39047444 AAAGATACACAGAAAGAAGGGGG - Intergenic
1165992156 19:39822570-39822592 CAGGAGAGACCTAAAGAGGAAGG + Intergenic
1166136033 19:40777911-40777933 CAGGATTGACAGAAAGAGGCTGG - Intronic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1166951377 19:46430385-46430407 AAGGAAAGAAAGAAAAAAGAAGG - Intergenic
1166976597 19:46608516-46608538 CATGATGGCCAGAAAGATGAAGG + Exonic
1167133522 19:47602970-47602992 GAGGAAAGAGAGAAAGAAAAAGG + Intergenic
1167286678 19:48602324-48602346 GAGGAGGGACAGAAAGGAGAGGG + Intronic
1167609078 19:50497642-50497664 GAGGAGAGACAGAGAGAAGTGGG + Intergenic
1168331481 19:55572416-55572438 CAGAATTGACAAAGAGAAGACGG - Intergenic
1168356953 19:55706615-55706637 CAGGAAAGAGAGAAAAAGGAGGG + Intronic
1168516121 19:57011563-57011585 GAAGAGAGAGAGAAAGAAGAGGG - Intergenic
925109261 2:1319639-1319661 CAGCTTACACAGGAAGAAGAGGG + Intronic
925132081 2:1501418-1501440 CAGGATGGACAGGAAGGAGGGGG - Intronic
925552110 2:5087578-5087600 CAGGAGAGAGAGAAAGAATGAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
925861167 2:8176859-8176881 AAGGAAAGAAAGAAAAAAGAAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926461239 2:13131521-13131543 CAGGAGAGAGAGAGAGAAGAGGG - Intergenic
926756446 2:16240183-16240205 CAGGTTATTCAGAAAGAAGCGGG - Intergenic
926837211 2:17036279-17036301 AATGATAGGCAGATAGAAGAAGG + Intergenic
927060682 2:19416452-19416474 AAAGAAAGAGAGAAAGAAGAAGG - Intergenic
927157505 2:20229665-20229687 AAGGAAAGAAAGAAAAAAGAAGG + Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927302735 2:21535167-21535189 GAAGACAGACAGAAAGATGAGGG + Intergenic
927560366 2:24067821-24067843 GAAGATGGACACAAAGAAGAAGG - Exonic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928138620 2:28708208-28708230 CAGGGAAGACAGAAAGAATGAGG + Intergenic
928898863 2:36296361-36296383 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
929373388 2:41254238-41254260 CAAGGGAGACACAAAGAAGAAGG + Intergenic
929384965 2:41395662-41395684 CAGGAGAGAAAGAAAGAGCAAGG + Intergenic
929684893 2:44025060-44025082 CAAGAGAGGCAGAAAGAAGAGGG - Intergenic
929726480 2:44434152-44434174 CAGCATACACATAATGAAGACGG - Intronic
929853910 2:45619562-45619584 AAAGATAGAAAAAAAGAAGAAGG + Intergenic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930016398 2:46973767-46973789 CAGAAGAGACAGAAAAAAGTCGG + Intronic
930804461 2:55476460-55476482 CAGGATTTACATAGAGAAGAGGG + Intergenic
930946221 2:57079236-57079258 CAGGAGAGAGAGAGAGAAAAGGG - Intergenic
931314685 2:61117519-61117541 CAGGATGCACAAAGAGAAGACGG + Exonic
931589942 2:63871780-63871802 CAGGATGGCCAGAGAAAAGAGGG - Intronic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
931735179 2:65187139-65187161 CAGGATGGAGAGAAAGCAGCAGG + Intergenic
931940455 2:67246287-67246309 AAGGATAGGGAGAAAGAAGGAGG + Intergenic
932747265 2:74344302-74344324 CAGAAGAGACTGGAAGAAGAGGG - Intronic
932819770 2:74889533-74889555 AAGGAAAGAGAGAAAGAAAAGGG - Intronic
932969902 2:76528031-76528053 GAGGAAAGAAAGAAAGAAGAAGG - Intergenic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
933391432 2:81673829-81673851 CAGGAGAGACAGTCTGAAGAGGG - Intergenic
933484416 2:82899874-82899896 CAGCATAGTCAGACACAAGAAGG - Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
933761489 2:85675318-85675340 AAGGAAAGACAGAAAGAAACAGG + Intergenic
934303433 2:91798765-91798787 AAGGAAGGAAAGAAAGAAGAAGG + Intergenic
934329826 2:92053995-92054017 AAGGAAGGAAAGAAAGAAGAAGG - Intergenic
934475975 2:94593785-94593807 GAGGATAAAGAGGAAGAAGAGGG - Intronic
934583097 2:95462847-95462869 TAGTACAGACAGAAAGAATAAGG + Intergenic
934596353 2:95613867-95613889 TAGTACAGACAGAAAGAATAAGG - Intergenic
934772989 2:96919838-96919860 CAGGAAAGACAGAAAGAGATGGG + Intronic
934786414 2:97011681-97011703 TAGTACAGACAGAAAGAATAAGG + Intronic
935513314 2:104002883-104002905 AAGAAAAGAAAGAAAGAAGAAGG + Intergenic
935597495 2:104890598-104890620 CAGGATAGCCACAGAGAAGGAGG - Intergenic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936260267 2:110953818-110953840 CAGGAGAGAGAGAGAGAAGTCGG + Intronic
936437852 2:112523381-112523403 CAGGGTAGAAATAAAGAAGAAGG - Intronic
936704803 2:115059178-115059200 AAAGATAAAAAGAAAGAAGAGGG + Intronic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
936924304 2:117721032-117721054 CAGGAAATACAGAAAACAGAGGG + Intergenic
936940556 2:117879701-117879723 CAGCACAGAAAGAAAGATGAAGG - Intergenic
936984912 2:118300010-118300032 CAGGAAAAACTGAAAGGAGAGGG + Intergenic
937380889 2:121375200-121375222 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
937512714 2:122614249-122614271 CAGGAAAGAAGGAAAAAAGAAGG + Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
938179490 2:129167313-129167335 CAGGTGAGAGAGAAAGAAGCAGG - Intergenic
938294511 2:130169228-130169250 CAGGAAAGACAGAAAGGCAAGGG + Intronic
938462139 2:131504668-131504690 CAGGAAAGACAGAAAGGCAAGGG - Intergenic
939854236 2:147338331-147338353 CAAGATAGAAAGAAGGTAGAAGG - Intergenic
940126716 2:150334152-150334174 GAGGAAAGAGAGAAAGAAGTAGG - Intergenic
940402130 2:153259875-153259897 CAGGAAGGAAAGAAAGAAGAAGG - Intergenic
940882021 2:158956261-158956283 AAAGATAGAAAGAAAGAAGCTGG - Intergenic
941256187 2:163234252-163234274 CAAGAGAGACAGAAAGAGAAGGG + Intergenic
941297954 2:163764007-163764029 CAGGAGAGAAAGGAAGAAAAAGG - Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941419558 2:165265802-165265824 GAAGAAAGAAAGAAAGAAGAAGG - Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942365620 2:175223187-175223209 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
942844990 2:180413302-180413324 AAAGAAAGAAAGAAAGAAGAAGG + Intergenic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943128603 2:183827988-183828010 CAGGAAAGAGAGAGTGAAGAGGG + Intergenic
943183484 2:184575016-184575038 CAGGAAAGAAAGAAAGAAGGAGG + Intergenic
943546270 2:189283213-189283235 AAGGAAAGAAGGAAAGAAGAGGG + Intergenic
943546353 2:189284469-189284491 CAAGAGAGACAGAGAGAAGGGGG + Intergenic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
943935703 2:193913469-193913491 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
945254864 2:207795118-207795140 AAAGAAAGAAAGAAAGAAGAGGG - Intergenic
945726406 2:213476061-213476083 AAGAATAGACAGAAACAACATGG + Intronic
945752308 2:213803468-213803490 CAGAAGAGACAGAAAGACAATGG - Intronic
945983836 2:216339033-216339055 CAGGTTGGACAGAAAGGAGCGGG + Intronic
946063416 2:216965765-216965787 AAGGAGAGAGAGAGAGAAGAGGG + Intergenic
946190142 2:218003635-218003657 CAGGAAAGAAAGAAAGAAGGGGG - Intergenic
946373476 2:219294655-219294677 GAGGGGAGACAGAAAGCAGAGGG + Intronic
946587055 2:221201494-221201516 CAGGAGAGACAGAAAGGCAAAGG + Intergenic
946644257 2:221816319-221816341 CAGGAGAGAGAAAAAGAGGAGGG - Intergenic
946859781 2:223989907-223989929 CAGGATACAGAGAAACATGATGG + Intronic
946879060 2:224159517-224159539 CAGGATAGAGAGAGAGAAAAAGG + Intergenic
946906972 2:224426841-224426863 CAGGAAAGAGAGAAAGAGAAGGG - Intergenic
946937566 2:224737457-224737479 CAGGAGAGAGAGAGTGAAGAGGG - Intergenic
947628174 2:231634447-231634469 AAGGAAAGAAAGAAAGAAGGGGG + Intergenic
947753579 2:232545331-232545353 AAGGAAAGAAAGAAAGAAAAAGG + Intronic
947820474 2:233065560-233065582 AAGGAAAGAAAGAAAGAAAAAGG - Intronic
947955222 2:234183983-234184005 AAGGAAAGAAAGAAAGAAAAAGG + Intergenic
948558769 2:238836350-238836372 AAGCATAGAGAGAAAGGAGAGGG + Intergenic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
1168956028 20:1834951-1834973 CAGGACAGAGAGCAAGGAGAAGG + Intergenic
1169697620 20:8408444-8408466 AAGGAAAGAAAGAAAGAAAAAGG + Intronic
1169709786 20:8548469-8548491 AAGGATAGAAAGATAGATGATGG - Intronic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1170044451 20:12070903-12070925 CAGAATAGACACCAGGAAGAAGG + Intergenic
1170104515 20:12738916-12738938 CAGGTGAGAGAGAAAAAAGAGGG + Intergenic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1170280323 20:14639220-14639242 CAGGAAAAAAAGAAAGGAGAGGG - Intronic
1170330347 20:15202811-15202833 CAGTGTAGACAGAAAGAAAAAGG + Intronic
1170951410 20:20939663-20939685 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1171039187 20:21743976-21743998 CAGGGTAGAAAGAAAAAAGATGG - Intergenic
1171190493 20:23155815-23155837 AAGGAAAGAAAGAAAAAAGAAGG + Intergenic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172289808 20:33767973-33767995 CAAGATAAACAGAAAGCAGAGGG + Intronic
1172393346 20:34581642-34581664 CTGGATAAACATGAAGAAGATGG + Exonic
1173208780 20:41015694-41015716 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1173304586 20:41836131-41836153 CAGGACACAGAGAAAGATGAAGG - Intergenic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1175153139 20:56951006-56951028 AAGGGGAGAAAGAAAGAAGAAGG + Intergenic
1175663463 20:60837642-60837664 CAGGATAGAAAGAAGTAAGGAGG + Intergenic
1175951039 20:62583289-62583311 AAAGAAAGAAAGAAAGAAGATGG - Intergenic
1176795552 21:13368820-13368842 GAGCACAGACAGATAGAAGAGGG + Intergenic
1176893640 21:14349893-14349915 CGGGACAGACAGAAAGAACAGGG - Intergenic
1176960411 21:15153044-15153066 GAGAAAAGACAGAAAGGAGATGG - Intergenic
1176974355 21:15302087-15302109 GAGGTTAAACAAAAAGAAGATGG - Intergenic
1177085379 21:16696142-16696164 CAGGAGAGAGAGAGTGAAGAGGG + Intergenic
1177148618 21:17432430-17432452 AAGGAAGGAAAGAAAGAAGAAGG + Intergenic
1177347796 21:19896005-19896027 CAGGAGAGAGAGAAAGAACGAGG - Intergenic
1177372022 21:20216910-20216932 GAGGAGAGAGAAAAAGAAGAGGG + Intergenic
1178311949 21:31536869-31536891 CAGGAGAGAGGGCAAGAAGAGGG + Intronic
1178974733 21:37210945-37210967 GAGGAGAGAAGGAAAGAAGAAGG + Intergenic
1179087830 21:38236130-38236152 CAGGTAAGACAGAAAACAGAGGG - Intronic
1179192149 21:39132856-39132878 TAGACTAGACAGAAAAAAGATGG + Intergenic
1179272555 21:39862655-39862677 CAGGAGAGAAAGGAAGAATATGG - Intergenic
1179276489 21:39896478-39896500 AAGGACAGACAAAAAGAAGCAGG + Intronic
1179293767 21:40042680-40042702 CAGGAAAGAGAAAAACAAGACGG + Intronic
1179462331 21:41545669-41545691 GAGGAAAGAAAGAAAGAAAAGGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180058994 21:45375129-45375151 AAGGACAGACAGAAAGAGGTCGG + Intergenic
1180538211 22:16415688-16415710 CAGGAGAGACAGAGAGCAAAGGG + Intergenic
1180636149 22:17264536-17264558 CGGGAGAGACAGAGAGAAGGAGG - Intergenic
1181479771 22:23191262-23191284 CAAGATAAACAGAAAAGAGATGG - Intronic
1181671197 22:24426327-24426349 GAGGAAGGACAGACAGAAGATGG + Intronic
1181792641 22:25280025-25280047 CAAGAAAAAGAGAAAGAAGAGGG + Intergenic
1181813176 22:25417610-25417632 CAAGAAAAAGAGAAAGAAGAGGG + Intergenic
1181921091 22:26320994-26321016 CCTGAAAGACAGAGAGAAGATGG + Intronic
1182973911 22:34604435-34604457 CAGGAAATGAAGAAAGAAGATGG + Intergenic
1182983937 22:34698819-34698841 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1183025462 22:35062826-35062848 CAGGAGAGAGAGAGAGAAGGGGG + Intergenic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183106468 22:35618658-35618680 CTGGATAGACAAAGAGATGATGG - Intronic
1183294781 22:37023047-37023069 CAGGAAAGATAGAGAGGAGAGGG + Exonic
1183390682 22:37544190-37544212 GAGGAAAGAAGGAAAGAAGAAGG + Intergenic
1183539667 22:38422857-38422879 CAGGATGGAGAGAATGAAGAGGG - Intergenic
1183889600 22:40915698-40915720 CAGAATAGCCAGAAAGATGAAGG + Intronic
1184033297 22:41907078-41907100 CAGGAGAGAAAGAAAGCAGGTGG - Exonic
949372433 3:3349871-3349893 TAGGCGAGACAGAGAGAAGAGGG - Intergenic
949977549 3:9474848-9474870 AAGGATGAAGAGAAAGAAGACGG + Intronic
950153299 3:10704834-10704856 CAGGGGAGATACAAAGAAGATGG + Intronic
950860423 3:16142918-16142940 CAGGAAAAACAGAAAGGAAATGG + Intergenic
951035160 3:17925042-17925064 AAGGAAGGAAAGAAAGAAGAAGG + Intronic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
951277404 3:20705218-20705240 AAGGATAGACAGGGAGAAAAAGG - Intergenic
951629292 3:24701185-24701207 CAAGATAGATAGAAAGTAAATGG - Intergenic
952079796 3:29744221-29744243 CTGGACAGATATAAAGAAGAAGG - Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952363517 3:32654186-32654208 CAGGAGAGAGAGAGAGAAAAGGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953032505 3:39187722-39187744 CAGGAACGACAGAAAGAAGAAGG - Exonic
953076064 3:39571495-39571517 AAGGAAAGAGAGAAAGAAAAAGG - Intergenic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953377921 3:42444472-42444494 CAGGAGAGAGAGAGAGAAGGGGG - Intergenic
954852256 3:53613345-53613367 CAGGAAGTACAGGAAGAAGAGGG - Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955465889 3:59236926-59236948 CAGGAGAGACAGAAACAAATTGG + Intergenic
955527381 3:59835448-59835470 CTGCAAAGACACAAAGAAGAAGG + Intronic
956277634 3:67520329-67520351 CTGGATACCCAGAAAGAAAAAGG + Intronic
956321230 3:67998928-67998950 TAGCATAGAAAGAAAGAAGTAGG - Intergenic
956643374 3:71435217-71435239 CAGGAAAGAAGGAAGGAAGAAGG + Intronic
956763071 3:72460743-72460765 CAGCATCGAAAGGAAGAAGAGGG + Intergenic
957269360 3:78009342-78009364 CAGTAGATACAGAAAGAAGTAGG + Intergenic
957504427 3:81101270-81101292 CAGGAGAGAGAGAAAGAAGGGGG - Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
957971601 3:87389868-87389890 AAGGTTAGACAGAAAAAAGTAGG - Intergenic
958014367 3:87920937-87920959 AAGGATAGTCAGAAAGAAAGAGG - Intergenic
958100935 3:89009258-89009280 CAGGAAGGAAAGAAAGGAGAGGG - Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958595899 3:96222334-96222356 TAGGATATACAGAATTAAGAGGG - Intergenic
958740098 3:98058704-98058726 CAGGAGAGAGAGAAAGCAAAGGG + Intergenic
959098220 3:101980528-101980550 AAGGACAGAAAGAATGAAGAAGG - Intergenic
959416229 3:106078950-106078972 AAGGAAGGAAAGAAAGAAGAAGG - Intergenic
959962898 3:112320749-112320771 CAGGAAAGAAAGAAAGAAGAAGG + Intergenic
960176751 3:114526383-114526405 CAGGACAGAATGAAAGCAGATGG - Intronic
960216950 3:115051905-115051927 CAGGAGAGAGAAAATGAAGAGGG + Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960740956 3:120832833-120832855 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
961429479 3:126871231-126871253 TAGGAGTGACAGAAACAAGAAGG - Intronic
961943371 3:130659879-130659901 GAGGGAAGACAGAAAGAAGAGGG - Intronic
961976543 3:131030913-131030935 CAGGAGGAACAGAAAGCAGAAGG + Intronic
962379093 3:134882684-134882706 AAGGAAAGAAGGAAAGAAGAAGG - Intronic
962379098 3:134882719-134882741 AAGGAAAGAAGGAAAGAAGAAGG - Intronic
963564295 3:146907974-146907996 AAAGAAAGAAAGAAAGAAGAAGG + Intergenic
963931080 3:151004877-151004899 AAGAAAAGACAGAAAGAAGAGGG - Intergenic
964506114 3:157401529-157401551 CAGGTTAGACAGAAAGATTTGGG + Intronic
964899644 3:161642793-161642815 CAAGATAGAAAGAAAAAAGATGG - Intergenic
964995975 3:162881754-162881776 CAGGAGAGACAGCAAGCAAAGGG - Intergenic
965441443 3:168720184-168720206 TAAGATAGAGATAAAGAAGATGG - Intergenic
965594871 3:170400665-170400687 AAGAAAAGAAAGAAAGAAGAAGG - Intergenic
965647441 3:170898501-170898523 CAGGAGAGACAGCAAGCAGGGGG - Intronic
965726424 3:171721303-171721325 AAGGATAGAAAGAAAGAGCAAGG + Intronic
965865209 3:173197330-173197352 CAGGAGAGAGAGAATGAAGGAGG + Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966941295 3:184749318-184749340 AGGGAGAGAAAGAAAGAAGAAGG + Intergenic
967413520 3:189191918-189191940 CACTAGAGACAGACAGAAGAAGG - Intronic
967942943 3:194780233-194780255 CAGGATAGAGAGAAAGGTTATGG - Intergenic
968006695 3:195247845-195247867 CAGGACAGAGAGAGAGAAGGGGG + Intronic
968550613 4:1221885-1221907 GAGGAAAGAAAGAAACAAGAAGG + Intronic
969333182 4:6491754-6491776 CAGGAGAGAGAGAGAGAAGGGGG - Intronic
969723161 4:8904464-8904486 CAGGAGAGACAGAGAGAAAAGGG + Intergenic
970087096 4:12362034-12362056 CAGGAGAGACAGAGAGCACAGGG + Intergenic
970570641 4:17378351-17378373 CAAGAAAGAAAGAAAGAAGGAGG + Intergenic
970852970 4:20623806-20623828 CAGAATAGAGAGAAAGAAAGGGG + Intergenic
970876876 4:20881653-20881675 CAAAATAGAGAAAAAGAAGATGG + Intronic
970984016 4:22134478-22134500 CAGGAGAGAGAGAGAGAAGGAGG - Intergenic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971145615 4:23973164-23973186 CAGGAAGGGCAGGAAGAAGAAGG + Intergenic
971219779 4:24694221-24694243 CAGGAGAGAGAGAGAGATGAAGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971474953 4:27064176-27064198 AAGGACAGACAGAAAGGAAAAGG + Intergenic
971795191 4:31217801-31217823 CAGGAAAGACAGAAAGAAAGAGG + Intergenic
971868774 4:32208483-32208505 GAGGACTGAAAGAAAGAAGAAGG - Intergenic
971913143 4:32822773-32822795 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
972208476 4:36807029-36807051 CAGGAGAGAGAGAGAGAAGAAGG + Intergenic
972266444 4:37464576-37464598 CAGGATGGAAAGAAAGAATGAGG + Intronic
972848478 4:43019033-43019055 CAAGATAGACTGAAATAAAATGG + Intronic
973161253 4:47019687-47019709 AAGGAAAGAAGGAAAGAAGAAGG - Intronic
973169103 4:47116904-47116926 CAGGAGAGAGAGAAAGAAGGGGG + Intronic
973667413 4:53177029-53177051 CAGGAAACAGATAAAGAAGAAGG - Intronic
973816053 4:54620080-54620102 AAGGAAAGACAGAAAGGAAAAGG - Intergenic
973835587 4:54806233-54806255 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
973835612 4:54806375-54806397 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
974110025 4:57514514-57514536 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
974515469 4:62902545-62902567 AAAGAGAGAGAGAAAGAAGAAGG + Intergenic
974608620 4:64185366-64185388 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
974652199 4:64768507-64768529 CAGGAGAGAGAGAAAGCACAGGG + Intergenic
975126982 4:70793952-70793974 TAGGGTAGACAGCAAGAAAAGGG + Intronic
975402039 4:73949757-73949779 CTGGAGAGACAGAAAGTATAAGG + Intergenic
975419277 4:74143374-74143396 CAGCCTAGACAAAAAGAATAAGG - Intronic
975650195 4:76585386-76585408 CAGCACACACAGAAAGAAAATGG - Intronic
975788751 4:77924064-77924086 CATGAAGGACAGAAAGAATAGGG - Intronic
976025101 4:80677965-80677987 TAGAAAAGACAGAAAGAAAAAGG - Intronic
976117671 4:81745261-81745283 CAGGAGAGAGAGAGAAAAGAGGG + Intronic
976298760 4:83498382-83498404 AAGGAAAGAAAGAAAGAAAAAGG + Intronic
976502660 4:85809777-85809799 CAGGACAGACTGCAAGAAGCAGG + Intronic
976572751 4:86632627-86632649 GAGGAGAAAGAGAAAGAAGAAGG - Intronic
977166703 4:93708765-93708787 CAGGAAAGAAGGAAGGAAGAAGG - Intronic
977401139 4:96534130-96534152 GAGGAGAGAGAGAAAGAAGTGGG - Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
977698521 4:99994088-99994110 CAAATTAGAGAGAAAGAAGAGGG - Intergenic
977700911 4:100021749-100021771 GAGGAAAGAAAGAAGGAAGAGGG - Intergenic
977705368 4:100064819-100064841 AAGGAAAGAAAGAAAGAAAATGG - Intergenic
977728243 4:100322232-100322254 CAGGAGAGAGAGCAAGAAGGGGG + Intergenic
978048464 4:104164912-104164934 AAGGATGTAGAGAAAGAAGACGG + Intergenic
978178730 4:105767099-105767121 ATGGATGGACAGAAAAAAGAAGG + Intronic
978742457 4:112152605-112152627 CAACAGAGACAGAAAGGAGATGG - Intronic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980271816 4:130593781-130593803 CAGGAGAGACAGACAGTAAAGGG - Intergenic
981018890 4:140004562-140004584 GAGGAGAGAAAGAAAGAAAATGG + Intronic
981036781 4:140177872-140177894 AAAGATAGAAAGAAAGAAGAAGG - Intergenic
981154730 4:141421203-141421225 CAGGAAGGAAAGAAAGAAGAAGG - Intergenic
981170208 4:141614864-141614886 CATGATAGGCAGTAAGAATATGG - Intergenic
981412112 4:144443755-144443777 CAGGAGAGAAAGAGAGAAGGGGG + Intergenic
981552684 4:145957899-145957921 AAGAAAAGAAAGAAAGAAGAAGG - Intergenic
981829104 4:148979755-148979777 CAAGACAGATGGAAAGAAGAGGG + Intergenic
981831896 4:149011359-149011381 CAGAACAGACAGAAAGAAGAAGG + Intergenic
981902336 4:149881109-149881131 AAAGAAAGAAAGAAAGAAGAAGG + Intergenic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
982400868 4:154966425-154966447 CAGGAGCAAGAGAAAGAAGAAGG - Intergenic
982457537 4:155628260-155628282 CAGGACAGATTGCAAGAAGAGGG + Intergenic
982628412 4:157798545-157798567 CAGGAAAGAGAGAGAGTAGAGGG - Intergenic
982751221 4:159164340-159164362 CGGGAGAGACAGGAAGGAGAAGG + Intronic
982762266 4:159299551-159299573 CAGGACGGAAAGGAAGAAGAAGG + Intronic
984610148 4:181828364-181828386 TAGTATTGAAAGAAAGAAGAAGG - Intergenic
984621828 4:181961983-181962005 CAGGTTAGAAAGAGAGAAAAAGG + Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985073089 4:186187647-186187669 AACGAGAGACAGCAAGAAGAAGG - Intergenic
985150471 4:186942117-186942139 CAATATAGCCAGAAAGAAAAAGG + Intergenic
985267797 4:188166218-188166240 AAGGAAAGAAGGAAAGAAGAAGG - Intergenic
985988915 5:3539068-3539090 CAAGGAAGACAGGAAGAAGATGG + Intergenic
986129726 5:4917724-4917746 CAAGAAACAGAGAAAGAAGAGGG + Intergenic
986143450 5:5053132-5053154 GAGGAAGGAAAGAAAGAAGAAGG + Intergenic
986537148 5:8801523-8801545 AAAGAAAGAAAGAAAGAAGAGGG + Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987432255 5:17849217-17849239 AAGGAAAGACAGAAAGAAAAAGG - Intergenic
987517048 5:18924083-18924105 AATGAGAGAGAGAAAGAAGAAGG + Intergenic
987687393 5:21223047-21223069 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
988025001 5:25674140-25674162 CAGGAGAGAGAGAATGAACAGGG + Intergenic
988084987 5:26463584-26463606 CAGGAGAGAGAAAAAGAAGGAGG - Intergenic
988236198 5:28548500-28548522 TCTGACAGACAGAAAGAAGATGG + Intergenic
988580012 5:32460632-32460654 CAGGACAGAGAGAAAGAGCAGGG + Intergenic
989042311 5:37241487-37241509 GTAGATAGACAGAAAGAAGAGGG + Intronic
989123496 5:38028203-38028225 GAGGAAAAACAGAAAGAAGTTGG + Intergenic
989164741 5:38423272-38423294 CAGGATGGCCACAAAGAAAATGG - Intronic
989268074 5:39500486-39500508 AAGGAGAGAGGGAAAGAAGAAGG - Intergenic
989351596 5:40493254-40493276 CAGGACACACAGAAAGGAAAGGG + Intergenic
989497359 5:42124726-42124748 CAGGAGAGAGAGAACCAAGAGGG + Intergenic
989576022 5:42989418-42989440 GAGGCTAGACAGAAAGCAAAAGG - Intergenic
990012220 5:51013179-51013201 CAGGTTTGACAGAGAGAAAAAGG + Intergenic
990112398 5:52343684-52343706 CAGGATAGACAGAAACAATGAGG + Intergenic
990213892 5:53509466-53509488 CAGGAGAGAGAGAGAGAAGAGGG + Intergenic
990730635 5:58805285-58805307 CAGTATAGATACCAAGAAGATGG + Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991505671 5:67321506-67321528 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
991565909 5:68004207-68004229 AAAGAAAGAAAGAAAGAAGAAGG + Intergenic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
991970953 5:72141187-72141209 GAGGAAAGAAAGAAAGAAGCTGG - Intronic
992136636 5:73752702-73752724 CAGGAGTAACTGAAAGAAGATGG + Intronic
992628876 5:78661450-78661472 AAAGAGAGAAAGAAAGAAGAAGG + Intronic
993012662 5:82501094-82501116 AAGGAAAGAAAGAAAGAAAAAGG - Intergenic
993140547 5:84027702-84027724 CAGGATAGACAGCAGGGAGTGGG + Intronic
993253234 5:85554778-85554800 CAGGAGAGAGAGAGAGTAGAGGG + Intergenic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
993430193 5:87823355-87823377 CAAGAGAGAGAGAAAGAGGAAGG + Intergenic
993569177 5:89514999-89515021 AAAGAGAGAAAGAAAGAAGAAGG + Intergenic
993775720 5:91993256-91993278 AAAGATAGAAAGAAAGAAAAGGG + Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994425321 5:99577471-99577493 CAGGAGAGAGAGAAAGTAAAGGG - Intergenic
994436019 5:99734764-99734786 CAGGAGAGAGAGAAAGTAAAGGG + Intergenic
994493835 5:100484566-100484588 ATGGATAGTCAGATAGAAGATGG - Intergenic
994565376 5:101439433-101439455 CAGGAGAGACAGAGTGAAGGAGG - Intergenic
994633664 5:102318041-102318063 CAGGAAGGAAAGAAAGAAGAAGG - Intergenic
995608317 5:113881878-113881900 CAGGAGAGAGAGATAGAAGGAGG - Intergenic
996793222 5:127315800-127315822 AAATATAGACAGAAAGAAAAAGG - Intronic
996949804 5:129111769-129111791 AAAGAGAGACAGAAAGGAGAAGG - Intronic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
997141840 5:131389878-131389900 CAGGCTAGACTGCTAGAAGAAGG - Intronic
997669616 5:135659793-135659815 CAGGAGAGAGAGAAAGTAAAGGG + Intergenic
997901225 5:137766750-137766772 GAGGAAAGAAAGGAAGAAGAAGG + Intergenic
997998721 5:138607112-138607134 CAGGAATGAGAGAAAGAAGCAGG - Intergenic
998278484 5:140782042-140782064 CAGAAAAGACAGGAAGATGAGGG + Intergenic
998393616 5:141804100-141804122 GAGGAGAGAGAGAGAGAAGAAGG - Intergenic
998537732 5:142950216-142950238 CAGGACAGGCAGAAAGCTGAAGG + Intronic
998577234 5:143329212-143329234 CAGGAGAGAGAGAAAGCACAGGG + Intronic
998856179 5:146397438-146397460 CTGGAAAGACACAAAGATGACGG - Intergenic
999094553 5:148966407-148966429 CAGGACAGACACAAAGCAGAAGG + Intronic
999715944 5:154359973-154359995 CAGGATAGACACTGAGAAGTAGG - Intronic
1000397901 5:160795491-160795513 CAGGATAGTCACAATGAATAGGG + Intronic
1000593750 5:163189970-163189992 AAGGATAAAGAGAAAGGAGAAGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001801293 5:174546466-174546488 AAGGCTAGACAGAAACAAGAAGG + Intergenic
1001905297 5:175467109-175467131 GAGGAAAGACTGAAAGCAGAAGG - Intergenic
1001932557 5:175683676-175683698 GTGGATAGACAGAAAGGACAGGG - Exonic
1002542192 5:179913686-179913708 CAGGATACCCACAAAAAAGAGGG + Intronic
1002547932 5:179963943-179963965 CAGAAATGACAGAATGAAGAAGG - Intronic
1002641622 5:180633222-180633244 CAGGAGAGAGGGATAGAAGAAGG - Intronic
1002902973 6:1425280-1425302 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1003012049 6:2435465-2435487 GAGGAAAGAAATAAAGAAGAAGG - Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003150481 6:3543846-3543868 CAGGATAGATAGATATAAGTAGG - Intergenic
1003219288 6:4143420-4143442 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
1003630952 6:7786716-7786738 GAGAATACACAGAAAGAAGAAGG + Intronic
1003851376 6:10226232-10226254 AAAGAAAGAGAGAAAGAAGAAGG + Intergenic
1004011574 6:11693259-11693281 CAGGAGAGACATAGAGAAGGGGG - Intergenic
1004144476 6:13052152-13052174 CAGGACTGAAAGAAAGTAGATGG - Intronic
1004581500 6:16958623-16958645 TAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004748367 6:18535836-18535858 CATGACATACAGACAGAAGAAGG + Intergenic
1005111377 6:22285530-22285552 CAGGAAAGGAAGAAAGAAAAGGG + Intergenic
1005350707 6:24932428-24932450 AAAGAGAGACAGAAAGAAAAGGG - Intronic
1005450070 6:25963494-25963516 TAGGGAAGGCAGAAAGAAGATGG - Intronic
1005457049 6:26030826-26030848 CAAGATCAACAGAAAGAAAATGG + Intergenic
1005560226 6:27032627-27032649 CAGGTTAGACACAAAGGATAAGG - Intergenic
1006023215 6:31130182-31130204 AAGGATAGAAAGGAAGAAGGAGG - Intronic
1006049859 6:31333790-31333812 GAGGATAGACAAAAAGTAGAAGG - Intronic
1006093904 6:31644205-31644227 CAGAAGAGACAGACCGAAGAGGG + Intronic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006597804 6:35206275-35206297 GAGGATAGCCATAAAGAATAGGG + Intergenic
1006744129 6:36329862-36329884 GAGAAAAGAGAGAAAGAAGAAGG + Intronic
1007039379 6:38707603-38707625 GAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1007590920 6:43020631-43020653 AATAAGAGACAGAAAGAAGAGGG - Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008234492 6:49027290-49027312 AAGGAAAGAGAGAGAGAAGAGGG + Intergenic
1008475212 6:51928858-51928880 CAGGATGGAGAGAAAGACAATGG - Intronic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008505347 6:52224682-52224704 AAAGAGAGACAGAAAGAAGAGGG - Intergenic
1008809103 6:55470821-55470843 CAGGAGAGAGAGCATGAAGAGGG + Intronic
1008872347 6:56287520-56287542 CAGGAGAGAAAGAGAGAAGGGGG - Intronic
1008914776 6:56775143-56775165 CAGGAAGAACAGAAAGAACAAGG + Intronic
1008938288 6:57016664-57016686 CAGGAAAAAGAGACAGAAGAGGG - Intronic
1009044120 6:58216929-58216951 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009219944 6:60971197-60971219 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009345759 6:62611656-62611678 GAGGAGAGAAGGAAAGAAGATGG + Intergenic
1009527569 6:64765697-64765719 CAGGAGAGAAAGAAAGAGCAAGG + Intronic
1009812077 6:68681072-68681094 GGGAATAGGCAGAAAGAAGAGGG + Intronic
1010159222 6:72832085-72832107 CAGGAAAGACAGACAGAATTGGG + Intronic
1010181126 6:73087590-73087612 CTGGAAAGAGAGAAAAAAGAGGG + Intronic
1010875652 6:81101956-81101978 CAGGAGAGACAGAGTGAAGGGGG - Intergenic
1010933048 6:81826664-81826686 CAAGATAAAAAGAAAGCAGAAGG + Intergenic
1010974406 6:82296238-82296260 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1011017798 6:82777758-82777780 AAGGAAAGAAGGAAAGAAGAAGG + Intergenic
1011097557 6:83683067-83683089 CAGGATTGACACACAGAATAGGG - Intronic
1011391748 6:86861484-86861506 CAGGAAAGAGAGAGAGATGAGGG + Intergenic
1011551456 6:88534575-88534597 CAGGAAAGAGAGAATGAAGGGGG + Intergenic
1011765351 6:90613829-90613851 CAGGAGACAAAGAAAGCAGAAGG - Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011917158 6:92521416-92521438 TAGGATACACAGCAAGAAGAAGG + Intergenic
1011936537 6:92785601-92785623 AAGGAAAGACAGAGAGAAAAAGG + Intergenic
1012180204 6:96143518-96143540 AAGGAGAGAGAGAAAGAAGGAGG - Intronic
1012200623 6:96402007-96402029 CAGGAGAGAGAGAGAGAAGGGGG - Intergenic
1012350213 6:98240892-98240914 AAAGAAAGAAAGAAAGAAGAGGG + Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1012956803 6:105579810-105579832 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
1013236825 6:108204221-108204243 CAGGAGAGACAGAAAGAGATTGG - Intergenic
1013273064 6:108560422-108560444 AAGGAAAGACAGAAAGAAGGGGG - Intronic
1013702956 6:112796077-112796099 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1014505546 6:122249649-122249671 TAGGAAAGAAAGAAGGAAGATGG + Intergenic
1014748058 6:125223142-125223164 CAGCATAGCCAGAAAGCAGTAGG - Intronic
1014913149 6:127117819-127117841 AAAGAAAGAAAGAAAGAAGAAGG + Intergenic
1015189167 6:130454639-130454661 GAGGATACACTGTAAGAAGATGG + Intergenic
1015364192 6:132378437-132378459 TAGGATAGAAAGAATGAAAATGG - Intronic
1015618589 6:135105718-135105740 CAAGATAGATAGAAAGAAAGTGG + Intergenic
1015672367 6:135705005-135705027 AAGGAGAGAGAGAGAGAAGAGGG + Intergenic
1015787657 6:136934287-136934309 GAGCATAGACAGAAAGAAACTGG + Intergenic
1015971781 6:138749663-138749685 CAGGAAAGGCTGAAAGAAAAAGG + Intergenic
1016482598 6:144497897-144497919 CAGGATATAGTGAAAGAAGAGGG + Intronic
1016890386 6:149000481-149000503 CAGCAGAGAGAGGAAGAAGACGG + Intronic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017633734 6:156423562-156423584 TAGGATAGCCAAAAAGAAGCAGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017768650 6:157627635-157627657 CGGCATGGACAGTAAGAAGATGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018238888 6:161753420-161753442 CAGGTTGGAAAGAGAGAAGAAGG + Intronic
1018629844 6:165812225-165812247 GTGGATAGACAGTAAGAAGATGG - Intronic
1019181471 6:170189679-170189701 CAAGTTAGATGGAAAGAAGATGG - Intergenic
1019551898 7:1607193-1607215 GAGGAGAGAGAGAAAGGAGAGGG - Intergenic
1020814024 7:12882243-12882265 CAGGTATTACAGAAAGAAGAGGG + Intergenic
1020917555 7:14215189-14215211 CAGAATAAACAGGAAGAATATGG + Intronic
1020993746 7:15235066-15235088 CAGAATCTATAGAAAGAAGAGGG - Intronic
1021626545 7:22599082-22599104 CAGGCCAGACAGGAAGATGAGGG + Intronic
1021790251 7:24197441-24197463 CAGGATAAACGGAAACAAGGAGG - Intergenic
1021816494 7:24452220-24452242 CAGCACAGACAAAAAGAAGTGGG + Intergenic
1022059880 7:26782998-26783020 CAGGAGAGGCAGAAAGAATCTGG - Intronic
1022438281 7:30410870-30410892 TTGGATAGATAGAAAGTAGATGG + Intronic
1022558124 7:31320896-31320918 CATGATTGACAGAGAGATGAAGG + Intergenic
1022636670 7:32142648-32142670 CAGGAGAGAAAAAGAGAAGATGG - Intronic
1022958846 7:35405915-35405937 CAGGAGAGAAAGAGAGAAGGGGG - Intergenic
1023227896 7:37990950-37990972 AAGGAAAGAAAGAAAGAAAAAGG - Intronic
1023311767 7:38894800-38894822 GAGGCTAGACAGCAAGAAAATGG + Intronic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023807470 7:43883812-43883834 CAGGAAAGAGAAAAAGAAAATGG + Intronic
1024283190 7:47736237-47736259 AAGGAAAGAAAGAAAGAAGGAGG - Intronic
1025278181 7:57602914-57602936 AAAGAAAGAAAGAAAGAAGAGGG - Intergenic
1025957450 7:66193666-66193688 AAGGAAAGAAAGAAAGAAAAAGG - Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026144461 7:67734499-67734521 CAAAAAAGAAAGAAAGAAGAGGG - Intergenic
1026252172 7:68680384-68680406 AAGGAGAGAGAGAAACAAGAAGG + Intergenic
1026595728 7:71732932-71732954 AAGGATAAAAAGAAAGAAAAGGG + Intergenic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1026967453 7:74449263-74449285 AAGGAAAGAAAGAAAGAAGAGGG - Intergenic
1027157164 7:75776597-75776619 CAAGAAAGAAAGAAAGAAGAAGG + Intronic
1027608903 7:80334867-80334889 CAGGAAAGAGAAAAAGAAGGAGG - Intergenic
1027928448 7:84498813-84498835 CAGGGCAGAAAGTAAGAAGATGG - Intergenic
1028295508 7:89124897-89124919 CCTGATAGACAAAAAGAGGATGG - Intronic
1028604048 7:92635649-92635671 CAGGACAGAGAAAAAGGAGAAGG - Intronic
1028621964 7:92835603-92835625 GAGCAGAGACAGAAAGCAGAAGG - Intronic
1028963384 7:96774851-96774873 CATGATAGGGAGAGAGAAGAAGG + Intergenic
1029431815 7:100536108-100536130 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1030060998 7:105621223-105621245 TGGGATTGACAAAAAGAAGAAGG - Intronic
1030210423 7:106990461-106990483 AAGGAAAGAAAGAAAGAAAAAGG - Intergenic
1030562483 7:111107194-111107216 GAGGAAAGAGAGAAGGAAGAAGG - Intronic
1030829236 7:114200462-114200484 CAGGAAACACTGAAAGAAGAAGG + Intronic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031779972 7:125948450-125948472 CAAGAAAGAAAGAAAGAAAAAGG + Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1031972355 7:128073976-128073998 CAGGAGAGGCAGAAAGACGCGGG - Intronic
1032089559 7:128904423-128904445 CAGGAGAGAGAGAAAGAGGGAGG - Intronic
1032494297 7:132349311-132349333 CAGCATTGAGGGAAAGAAGAGGG + Intronic
1032634366 7:133690445-133690467 CAGGAAGGAGAGAAAGAAGAAGG - Intronic
1032916076 7:136491726-136491748 CAAAATAGAAATAAAGAAGATGG - Intergenic
1032974512 7:137206987-137207009 AAAGAAAGACAGAAAAAAGAAGG - Intergenic
1033868420 7:145720204-145720226 CAGTAGAGACAGAGAGAATAGGG + Intergenic
1034366045 7:150548992-150549014 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034602976 7:152280537-152280559 CAAGAAAGAAAGAAAGAAAATGG + Intronic
1034732767 7:153402197-153402219 CATGATAGAAAGAAAGAGAAAGG - Intergenic
1035293258 7:157853471-157853493 AAGGTTACACACAAAGAAGACGG - Intronic
1036074240 8:5476882-5476904 CAGGTGTGACAGAGAGAAGAAGG + Intergenic
1037595029 8:20347841-20347863 CAGGAGAGACAGCAAGAAGGGGG + Intergenic
1037750538 8:21679257-21679279 AAGAATAGACAGAAAGAATGAGG - Intergenic
1038188675 8:25298930-25298952 CAGGATTGACTGAACAAAGAGGG - Exonic
1038767752 8:30444701-30444723 CAAGAAAGACAGAACAAAGAAGG + Intronic
1039003572 8:33008728-33008750 AAGGACAGACAGAAAAGAGATGG - Intergenic
1039407853 8:37328243-37328265 GAGGAGAGAGAGAGAGAAGAAGG - Intergenic
1039768377 8:40656264-40656286 TAGGATAGGCAGAATAAAGAAGG + Intronic
1041671948 8:60500411-60500433 CAGGATAGACAAAGTGAAGGGGG - Intergenic
1042259388 8:66842082-66842104 AGGGTTAGACAGAAAAAAGAAGG - Intronic
1042457085 8:69018417-69018439 CAATGTAGACAGGAAGAAGATGG - Intergenic
1042662308 8:71168359-71168381 CGGGATATACAGACTGAAGAAGG - Intergenic
1042786530 8:72552891-72552913 AAGGAGAGAAACAAAGAAGAGGG - Intronic
1043111297 8:76186399-76186421 CATGGCAGACAGAAAGGAGAAGG + Intergenic
1043862667 8:85338607-85338629 AAGGAAAGAAAGAAAGAAAAGGG - Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044043077 8:87394462-87394484 GAAGACAGACAGAAAGAATAAGG - Intronic
1044071043 8:87759999-87760021 AAGAAAAGACAGAAATAAGAGGG - Intergenic
1044622725 8:94206263-94206285 AAGAACAGACAGGAAGAAGAAGG - Intronic
1044778885 8:95723080-95723102 CAGCTTAGACAGAAAGCAGGAGG - Intergenic
1044962936 8:97548662-97548684 AAGTATATACAGAAAAAAGAGGG + Intergenic
1045703535 8:104894513-104894535 TAGGAAGGACAGAAAGAAAAAGG - Intronic
1045784414 8:105903743-105903765 AAGGACAGACAGAGAGAAGCAGG + Intergenic
1046021082 8:108665690-108665712 CAAGATGGAAAGAGAGAAGAGGG + Intronic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046095627 8:109556690-109556712 TAGGATAGAAAGAAAGAAAATGG + Intronic
1046253143 8:111660420-111660442 CCAGAAAGACAGAAAGGAGAAGG + Intergenic
1046510831 8:115200354-115200376 TAGGAGAGAGAGAAAAAAGAAGG + Intergenic
1046552587 8:115735012-115735034 AAAGAAAGAAAGAAAGAAGAAGG - Intronic
1046695639 8:117336249-117336271 CAGGGAAGGCAGCAAGAAGAAGG - Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1047071342 8:121347382-121347404 TAGGGGAGACTGAAAGAAGAGGG - Intergenic
1047753142 8:127897667-127897689 AAGGAAAGAAAGAAAGAAAAAGG + Intergenic
1047753165 8:127897925-127897947 AAGGAAAGAAAGAAAGAAAAGGG + Intergenic
1048053873 8:130845849-130845871 AAGGAAGGATAGAAAGAAGAAGG + Intronic
1048488574 8:134870936-134870958 CATTCCAGACAGAAAGAAGAAGG + Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1048551700 8:135439126-135439148 AAGGAAAGAAGGAAAGAAGAAGG + Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1050356199 9:4785114-4785136 CAGGAAAGAAGGAAAGAAGGAGG + Intergenic
1050412426 9:5380986-5381008 CAGGAAAGACAGAGAGAAAGGGG - Intronic
1051500214 9:17768558-17768580 TAGGAGAGACAGAAAGCACAGGG - Intronic
1051862264 9:21639424-21639446 CATGGAGGACAGAAAGAAGAAGG + Intergenic
1051910417 9:22148726-22148748 CAGGAGTGAGAGACAGAAGAGGG - Intergenic
1051986245 9:23091097-23091119 TAGAAGAGAAAGAAAGAAGAAGG + Intergenic
1052205689 9:25837160-25837182 CAGGATTGAAGGAAAGAGGAAGG + Intergenic
1052687905 9:31777560-31777582 CAGGTGAGACAGAAAGTATAAGG - Intergenic
1052854071 9:33396134-33396156 GAGGATAAAGAGGAAGAAGAGGG + Intronic
1053164393 9:35834430-35834452 CAGGAGAGAGAGAAAGGAGCAGG - Intronic
1053332996 9:37233796-37233818 AAGGAAAGAAAGAAAAAAGAAGG + Intronic
1053546903 9:39032671-39032693 CAGGAGAGAGAGAGAGAACAGGG - Intergenic
1053682085 9:40492298-40492320 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1053811222 9:41854324-41854346 CAGGAGAGAGAGAGAGAACAGGG - Intergenic
1053886704 9:42649525-42649547 GAGCACAGACAGATAGAAGAGGG - Intergenic
1053932072 9:43120624-43120646 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054225723 9:62456975-62456997 GAGCACAGACAGATAGAAGAGGG - Intergenic
1054281628 9:63132634-63132656 GAGGATAAAGAGGAAGAAGAGGG - Intergenic
1054295182 9:63327795-63327817 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054393202 9:64632301-64632323 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054427851 9:65137511-65137533 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054502525 9:65884027-65884049 GAGGATAAAGAGGAAGAAGAGGG - Intronic
1054619372 9:67333115-67333137 CAGGAGAGAGAGAGAGAACAGGG + Intergenic
1055259463 9:74415901-74415923 CAGGAGAGAGAGAAAGCAAAGGG - Intergenic
1055360122 9:75480722-75480744 CAGGATAGGCAAACAGAGGAGGG + Intergenic
1055363148 9:75516824-75516846 CAAGATAGACAAAAGCAAGAAGG + Intergenic
1055371181 9:75601352-75601374 AAGGAGAGAGAGAAGGAAGAAGG - Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1056115539 9:83437936-83437958 CAGGATAAAAAGAGAGAAGGGGG + Intronic
1056619340 9:88197815-88197837 CCTGAAAGCCAGAAAGAAGAAGG - Intergenic
1057006291 9:91563645-91563667 AAAGAAAGAGAGAAAGAAGAAGG + Intronic
1057198758 9:93129478-93129500 CAGGTTGGACAGGAAGCAGATGG - Intronic
1057991842 9:99778575-99778597 AAGGATGAACAGAAAGAAAATGG - Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058299877 9:103358731-103358753 CAGGAGAGAAAGAGAGAAGGGGG + Intergenic
1058459654 9:105171117-105171139 CAGCATAGAGAGAAAGAAGATGG + Intergenic
1058802531 9:108558519-108558541 CAGGAGAGACAGAGAGAATGGGG - Intergenic
1058909690 9:109509353-109509375 CAGGATTGAGAGAAATATGAAGG - Intergenic
1058924410 9:109648115-109648137 CAGGACAGAGAGAAAGAGCAGGG - Intronic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1058971053 9:110083215-110083237 CCGTAGAGACAGAAAGTAGAAGG - Intronic
1059082312 9:111263299-111263321 AAGGAGAGACAGAAAACAGAGGG + Intergenic
1059137506 9:111821263-111821285 CAGGGTAGAGACAAAGAAGCTGG - Intergenic
1059137799 9:111823701-111823723 AAGGAAAGAAAGAAAGAAAACGG + Intergenic
1059170803 9:112122913-112122935 CACAAGAGACAGAAAGTAGAAGG + Intronic
1059355317 9:113694726-113694748 CAGGAAAGACAGACAAAGGAAGG + Intergenic
1059444026 9:114327229-114327251 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1059445233 9:114334008-114334030 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1059476098 9:114548916-114548938 AAGGAAGGAAAGAAAGAAGAAGG + Intergenic
1059592262 9:115674447-115674469 AAGGAAAGAAAGAAAGAAGGAGG - Intergenic
1059911486 9:119049367-119049389 CAGGATTGACATAAAGATAAGGG - Intergenic
1060252162 9:121995188-121995210 CAGGATAGAGAGGAAGAAGAGGG + Intronic
1061224826 9:129275281-129275303 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1061964830 9:134007310-134007332 GAGGAGAGACAGACGGAAGAGGG + Intergenic
1062057995 9:134478660-134478682 GGGGAGAGAGAGAAAGAAGAGGG - Intergenic
1062257521 9:135635069-135635091 AAGGATAGAAGGAAGGAAGAAGG - Intronic
1185525220 X:773168-773190 AAAGAAAGAAAGAAAGAAGAAGG + Intergenic
1185768855 X:2749291-2749313 GAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1185850731 X:3483998-3484020 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1186130934 X:6464661-6464683 CAGGTAAGACAGAAAGGGGAGGG - Intergenic
1186173930 X:6905497-6905519 CAGGAGAGAGAGAGAGAAGAGGG + Intergenic
1187039497 X:15578826-15578848 CAGGATAGAGAAATAGTAGAAGG + Intronic
1187866970 X:23731745-23731767 CAGGAAAGAGAGACAGAGGAGGG + Intronic
1188430152 X:30097291-30097313 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
1188430154 X:30097310-30097332 AAGGAAAGAAGGAAAGAAGAAGG + Intergenic
1188983195 X:36746821-36746843 CAGAAGAGACAGGAAGAAGAGGG - Intergenic
1189201542 X:39200243-39200265 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1189422797 X:40871570-40871592 CAGCAGTGACAGAAAGACGAAGG - Intergenic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190043396 X:47090894-47090916 AAAGAAAGAAAGAAAGAAGAAGG + Intronic
1190047515 X:47124604-47124626 AAGAAAAGAAAGAAAGAAGAAGG + Intergenic
1190799570 X:53775049-53775071 CAGGATTGACCTAGAGAAGATGG + Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191589237 X:62862537-62862559 CGAGATAGATAGAGAGAAGAAGG - Intergenic
1191711127 X:64150991-64151013 CAGGAGAGAGAGAGAGAAGTGGG + Intergenic
1192491538 X:71580009-71580031 GAGGTTGGACAGAAGGAAGAAGG + Intronic
1192499625 X:71641438-71641460 TAGTTTAGAGAGAAAGAAGAAGG - Intergenic
1192829586 X:74737325-74737347 CAGAATAGAGAAATAGAAGAAGG + Exonic
1193375134 X:80751084-80751106 CAGGATACAAGGAAAGGAGAGGG + Intronic
1193478945 X:82002935-82002957 GAGGATAAGCAGGAAGAAGAAGG - Intergenic
1193601539 X:83512576-83512598 CAGAATGGAGAGGAAGAAGAAGG - Intergenic
1193656307 X:84201878-84201900 GAGGATAGACTAAAAGTAGAAGG - Intergenic
1193968300 X:88017715-88017737 TAAGATAGAAGGAAAGAAGAAGG + Intergenic
1193997078 X:88379410-88379432 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194894318 X:99420746-99420768 AAGGAGAGACAGAAAGAATTGGG - Intergenic
1194975595 X:100393437-100393459 AAGGAGAGAGAGAAAGAAGCAGG - Intronic
1196188148 X:112766333-112766355 CAGGAGAGAAAGAAAGAAAATGG + Intergenic
1196223418 X:113138476-113138498 CAAGAGAGAGAGAAAGAAGGGGG + Intergenic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1197372786 X:125645785-125645807 CAGGAGAGAGAGAAAAAAGGGGG + Intergenic
1198010251 X:132545259-132545281 CAAGAAAGAAAGAAAGAAAAAGG + Intergenic
1198116527 X:133549885-133549907 AAGGATAGAAAGAGAGAAGGAGG - Intronic
1198423857 X:136496277-136496299 CAGGGGAGACAGAATTAAGATGG - Intergenic
1198843843 X:140888176-140888198 CCTGATAGGCAGAAAGAAAATGG + Intergenic
1198856508 X:141022770-141022792 AAGGACATAAAGAAAGAAGAAGG + Intergenic
1198906184 X:141564597-141564619 AAGGACATAAAGAAAGAAGAAGG - Intergenic
1199062712 X:143377484-143377506 CAGGAGAGAGAGAGAGCAGAAGG + Intergenic
1199076008 X:143527451-143527473 CAGGAAGGAAAGAAAGAAGAAGG - Intergenic
1199273953 X:145920963-145920985 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1199312772 X:146340937-146340959 AAAGAAAGAAAGAAAGAAGAAGG - Intergenic
1199387874 X:147243984-147244006 GAGGATGGAGAAAAAGAAGAAGG - Intergenic
1199692791 X:150321329-150321351 CAGGATAGACAGCAGGCATAGGG - Intergenic
1200088591 X:153623957-153623979 CAGGAGAGACAGAGAGGAGAAGG + Intergenic
1201613395 Y:15868354-15868376 CAGGTAAGACAGAAAGGGGAAGG - Intergenic
1201687096 Y:16717312-16717334 AAGAATAGACAGAAAGAATTAGG - Intergenic
1202013638 Y:20375986-20376008 CTGCATAGATAAAAAGAAGATGG + Intergenic
1202349918 Y:23978401-23978423 AAGAAAAGAAAGAAAGAAGAGGG + Intergenic
1202520861 Y:25691720-25691742 AAGAAAAGAAAGAAAGAAGAGGG - Intergenic