ID: 971347834

View in Genome Browser
Species Human (GRCh38)
Location 4:25827597-25827619
Sequence GGGATTGCATTAGTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971347834_971347845 27 Left 971347834 4:25827597-25827619 CCCCAACAAACTAATGCAATCCC 0: 1
1: 0
2: 2
3: 18
4: 337
Right 971347845 4:25827647-25827669 TAGGCTCACTTGCCTCACCCCGG 0: 1
1: 0
2: 0
3: 18
4: 137
971347834_971347840 8 Left 971347834 4:25827597-25827619 CCCCAACAAACTAATGCAATCCC 0: 1
1: 0
2: 2
3: 18
4: 337
Right 971347840 4:25827628-25827650 CTGGCACCCCCTTAAGTTTTAGG 0: 1
1: 0
2: 1
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971347834 Original CRISPR GGGATTGCATTAGTTTGTTG GGG (reversed) Intronic
902257679 1:15200646-15200668 GAGCTTGTATTAGTTTGCTGGGG - Intronic
904568791 1:31445209-31445231 GGGATTGCACAAGTTTGGGGAGG + Intergenic
907912600 1:58840087-58840109 GGGATGGCATTTGCTTCTTGCGG - Intergenic
908032358 1:60015067-60015089 GGGACTATATTAGTTTGCTGGGG + Intronic
908455608 1:64301878-64301900 GGGATTTCCTTAGTTTGATATGG + Intergenic
908526324 1:64991216-64991238 GGGTTTGTATTAGTTTGCTAGGG + Intergenic
908536485 1:65083224-65083246 AGGATTGCAAGAGGTTGTTGGGG + Intergenic
909413508 1:75380048-75380070 GGGAATGCCCCAGTTTGTTGTGG - Intronic
909624417 1:77699921-77699943 GTTCTTGCATTAGTTTGCTGAGG - Intronic
909749421 1:79140400-79140422 TGGTTTGCAATATTTTGTTGAGG + Intergenic
910050751 1:82971307-82971329 GGCATTACATTAGTTTGCTATGG - Intergenic
910167541 1:84343583-84343605 GTTCTTGCATTAGTTTGCTGAGG - Intronic
911327205 1:96482347-96482369 GGGTTTGCATTAGCTGGTTCTGG - Intergenic
911476180 1:98375772-98375794 GAGGCTGCATTAGTTTGTTATGG - Intergenic
912032656 1:105268781-105268803 GTTATTGCATTAGTTTGCTTAGG - Intergenic
915402379 1:155632861-155632883 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
915632379 1:157162547-157162569 GGGAATCCATCAGTTGGTTGGGG + Intergenic
915864265 1:159481598-159481620 AGCATTGCATTAGTTTCCTGTGG - Intergenic
916475132 1:165162097-165162119 GGTGTTGTATTAGTTTCTTGGGG - Intergenic
917289332 1:173455963-173455985 TGGATGGAATGAGTTTGTTGTGG + Intergenic
917351982 1:174087872-174087894 GTTCCTGCATTAGTTTGTTGAGG + Intergenic
917438754 1:175046826-175046848 GGTATGGTAGTAGTTTGTTGAGG + Intergenic
918999063 1:191804364-191804386 AGGATTGCAGTAGTCTGTGGTGG + Intergenic
920406810 1:205720988-205721010 GTGCCTGCATTAGTTTGCTGAGG - Intronic
920524628 1:206657783-206657805 GGGATAGAATCAGTTTGATGAGG - Intronic
920629643 1:207639035-207639057 GGGAATGCCCCAGTTTGTTGCGG + Intronic
924862898 1:247944570-247944592 GTTCTTGCATTAGTTTGCTGAGG + Intronic
1063222270 10:3980052-3980074 GTCATTGCATTATTTTGTTCAGG + Intergenic
1063530933 10:6830657-6830679 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1063860501 10:10302393-10302415 GGAATTGAATCAGTTTTTTGTGG - Intergenic
1064339826 10:14475832-14475854 GTCATTGCATTAGTTTGCTCAGG - Intergenic
1064824747 10:19385156-19385178 GGTTTTCCATTATTTTGTTGAGG + Intronic
1065549022 10:26851934-26851956 GGGATTGCCTAACTATGTTGAGG + Intronic
1065888974 10:30104454-30104476 GTTCTTGCATTAGTTTGTTTAGG - Intronic
1068402813 10:56552389-56552411 GTCATTGCAGTAGTTTGCTGAGG + Intergenic
1069015240 10:63421976-63421998 GGGACTGTATTAGTTTGCTAGGG - Intronic
1069549611 10:69353865-69353887 TGGGTTGCATTAGTTTGCTACGG - Intronic
1069840404 10:71336014-71336036 GACATTGCATTAGTTTCTTGTGG + Intronic
1071135280 10:82446514-82446536 GTTTTTGCATTAGTTTGCTGAGG - Intronic
1071668466 10:87584242-87584264 GTTACTGCATTAGTTTGCTGAGG + Intergenic
1071959144 10:90792338-90792360 GGGTTTTCATTGTTTTGTTGGGG + Intronic
1072359961 10:94649816-94649838 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1072947774 10:99825942-99825964 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1074022723 10:109600863-109600885 GTGCCTGCATTAGTTTGCTGAGG - Intergenic
1076654480 10:132014445-132014467 GGGTTTGGTTTGGTTTGTTGGGG - Intergenic
1077795394 11:5486181-5486203 GGCATTGTATTAGTTTGCTAGGG - Intronic
1078644080 11:13122721-13122743 TGGTTTGCAGTATTTTGTTGAGG + Intergenic
1080140740 11:28916909-28916931 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1081052406 11:38360768-38360790 TTGATTGCATTAGTTTGCTTGGG - Intergenic
1081314093 11:41610552-41610574 GTGATTATATTAGTTTGGTGAGG + Intergenic
1081321123 11:41693038-41693060 GGGATTGTATTAGTTTTCTAGGG + Intergenic
1081445419 11:43127057-43127079 GTTCCTGCATTAGTTTGTTGAGG - Intergenic
1083893201 11:65607167-65607189 GGGATTGGTTTAGGGTGTTGTGG - Intronic
1084927674 11:72526735-72526757 TGGTTTGCTTTGGTTTGTTGGGG - Intergenic
1085561619 11:77477059-77477081 GAGATTGTATTAGTTTCTTATGG - Intergenic
1086049117 11:82568136-82568158 AGCTTTGCATTAGTTTCTTGTGG + Intergenic
1086681513 11:89679320-89679342 CAGATTGCTTCAGTTTGTTGTGG + Intergenic
1087024717 11:93638331-93638353 GAGAATGCATTAGTATTTTGAGG - Intergenic
1087414732 11:97839762-97839784 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1087724050 11:101698025-101698047 GGGAATGCCCCAGTTTGTTGTGG - Intronic
1088018354 11:105087754-105087776 GTTCCTGCATTAGTTTGTTGAGG - Intronic
1088708014 11:112481111-112481133 GGGAGTGCATGAGTTTATTTAGG + Intergenic
1089471789 11:118727195-118727217 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1092325060 12:7522160-7522182 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1094299316 12:28943930-28943952 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1095268082 12:40183476-40183498 GGGGTTCCATCAGTTGGTTGTGG - Intergenic
1095476779 12:42593669-42593691 GGTATTGTACTAGTTTGCTGGGG - Intergenic
1096011886 12:48224791-48224813 GTTCCTGCATTAGTTTGTTGAGG - Intergenic
1097331132 12:58333931-58333953 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1097844223 12:64350362-64350384 GTCATTGCATTAGTTTGATAGGG + Intronic
1098036534 12:66308485-66308507 AGTATTGTATTAGTTTGCTGGGG + Intronic
1098084648 12:66829500-66829522 GGGCTTGTATTAGTTTCCTGTGG - Intergenic
1099084756 12:78231924-78231946 AGGATTCCATTGGTTAGTTGGGG - Intergenic
1099593050 12:84621040-84621062 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1100626357 12:96337228-96337250 GAGCTTTCAATAGTTTGTTGTGG - Intronic
1104579607 12:130001089-130001111 GTGCCTGCATTAGTTTGCTGAGG - Intergenic
1104809975 12:131614322-131614344 GGGGGTCCATTAGTTGGTTGGGG - Intergenic
1105766635 13:23566529-23566551 GGCTTTGTATTAGTTTCTTGAGG + Intergenic
1106797899 13:33226220-33226242 GAGCTTGCATTAGTTTGCTCAGG - Intronic
1107111399 13:36701763-36701785 GTGTTTGCTTTAGTCTGTTGGGG + Intergenic
1107836446 13:44415890-44415912 TGGAGTGCATTAGGTTGGTGAGG - Intergenic
1110025292 13:70530188-70530210 GAAATTGCATTAGTTTGCTATGG + Intergenic
1110798119 13:79664123-79664145 GTTCCTGCATTAGTTTGTTGAGG - Intergenic
1111306965 13:86427152-86427174 GTTCCTGCATTAGTTTGTTGAGG + Intergenic
1112667908 13:101597869-101597891 GTGATTGTATTGGTTTGCTGGGG - Intronic
1112943156 13:104891472-104891494 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1113072725 13:106437084-106437106 GAGTTTGCATTAGTTTGCTAAGG - Intergenic
1114181808 14:20374045-20374067 GGGATTGGATTATGGTGTTGAGG - Intronic
1114912084 14:27213271-27213293 GGGATTCCATTGGTTACTTGCGG + Intergenic
1115695956 14:35898642-35898664 GGGGTTACAGTAGTTTGTTGTGG + Intronic
1116052193 14:39818356-39818378 CCAATTGCATTAGTTTGTTAGGG + Intergenic
1116485994 14:45449174-45449196 GGGTTACCATTATTTTGTTGAGG + Intergenic
1117284622 14:54275102-54275124 GGGATTATATTAGTTTCTTAGGG + Intergenic
1117310481 14:54517886-54517908 GTTCTTGCATTAGTTTGCTGAGG + Intronic
1117467592 14:56008763-56008785 GTTACTGCATTAGTTTGCTGAGG + Intergenic
1117868924 14:60177227-60177249 GGGGTTTTATTTGTTTGTTGGGG - Intergenic
1118644809 14:67827751-67827773 GTTCTTGCATTAGTTTGCTGAGG + Intronic
1118696446 14:68390882-68390904 GGGACTGCATTAGTGTAATGAGG - Intronic
1119149505 14:72345332-72345354 GAGATTGGATTTTTTTGTTGTGG + Intronic
1120560807 14:85990202-85990224 TGTATTGCATTAGTTTTTGGGGG + Intergenic
1202843961 14_GL000009v2_random:149533-149555 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1202913353 14_GL000194v1_random:139776-139798 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1202879298 14_KI270722v1_random:42913-42935 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
1123503230 15:20911226-20911248 GTGTTTGCATTATTTTGTGGAGG - Intergenic
1123560477 15:21484891-21484913 GTGTTTGCATTATTTTGTGGAGG - Intergenic
1123596716 15:21922187-21922209 GTGTTTGCATTATTTTGTGGAGG - Intergenic
1124428373 15:29583368-29583390 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1124572551 15:30878405-30878427 GGCACTGTATTAGTTTGCTGGGG - Intergenic
1126488017 15:49204313-49204335 AGGATTGCTTTGGTTTTTTGGGG + Intronic
1126499896 15:49334396-49334418 GGGAATGAATTGGTTTGTAGAGG - Intronic
1126648733 15:50900631-50900653 GGGTTTGTATTAGTTTCCTGTGG + Intergenic
1128223553 15:65985441-65985463 GGAATTTCCTTCGTTTGTTGGGG + Intronic
1129555787 15:76507424-76507446 GGGGTTGTATTAGTTTGCTTGGG - Intronic
1129971944 15:79786508-79786530 CTTATTGCATTAGTTTGTTAAGG - Intergenic
1202968825 15_KI270727v1_random:212055-212077 GTGTTTGCATTATTTTGTGGAGG - Intergenic
1133689791 16:8202339-8202361 GTGAGTGCATTACTTTCTTGTGG + Intergenic
1134349977 16:13428183-13428205 GGGATTGTTTTTATTTGTTGTGG + Intergenic
1137418921 16:48313590-48313612 GATCCTGCATTAGTTTGTTGAGG + Intronic
1138565048 16:57827139-57827161 GGGATCGCTTTAGTCTGATGCGG - Intronic
1140579770 16:76216021-76216043 GGCATTGTATTAGTTTCCTGTGG - Intergenic
1140959892 16:79901651-79901673 TGTTTTGCATTAGTTTGCTGAGG + Intergenic
1141706494 16:85668103-85668125 GGGCTTGCATCAGTGTGTTGGGG - Intronic
1141889009 16:86914147-86914169 GGGAATGCCTTATTTTGGTGAGG - Intergenic
1143345691 17:6247181-6247203 AGGTTTGCATTAGTTTGCTGGGG + Intergenic
1144357540 17:14460419-14460441 GGGATTTCATTTGTCTGATGTGG + Intergenic
1146486633 17:33248471-33248493 GGGAGTGCATTAGTTTCCTGTGG + Intronic
1148753952 17:49962860-49962882 GGGTTTGCACTAGTTTCATGGGG - Intergenic
1150898405 17:69240330-69240352 GGGCTTGTATTAGTTTGCTAAGG + Intronic
1152374470 17:79912041-79912063 GAAATTGCATTAGTTTCCTGCGG + Intergenic
1154056508 18:11017794-11017816 GGCATTGTATTAGTTTCTTACGG + Intronic
1155775671 18:29757390-29757412 GTTACTGCATTAATTTGTTGAGG - Intergenic
1156550927 18:38015770-38015792 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1156750333 18:40445652-40445674 GGGTTTCCATTAGTTTGATTGGG - Intergenic
1157011983 18:43660391-43660413 TGGAATGTATTAGATTGTTGAGG + Intergenic
1157139704 18:45093570-45093592 GTCACTGCATTAGTTTGCTGAGG - Intergenic
1158284329 18:55862708-55862730 GGGATTGCATTGAATTGTTTTGG + Intergenic
1158858588 18:61569719-61569741 GGGATTGCATCAGGTTCCTGGGG - Intergenic
1158989862 18:62857139-62857161 AGGGTTGCATTAGTTTCCTGTGG + Intronic
1159051168 18:63422444-63422466 GGGATTGCGGAAGTTTGGTGGGG - Exonic
1159183278 18:64938742-64938764 TGGATTGCATTTGGTTGTCGTGG - Intergenic
1159753314 18:72329929-72329951 GGTATTGTTTTAGTTTGTTAGGG + Intergenic
1160115316 18:76073876-76073898 GACATTGTATTAGTTTCTTGTGG + Intergenic
1162206921 19:9063181-9063203 GAGGTTGCATTAGTTTTCTGAGG - Intergenic
1164153996 19:22577886-22577908 GGGAATGCCCCAGTTTGTTGTGG - Intergenic
1164371024 19:27644437-27644459 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1164900449 19:31916867-31916889 GGGATTGCATCAGGGTGTTTTGG + Intergenic
1165440244 19:35822123-35822145 TGTATTGCATTAGTTACTTGGGG - Intergenic
1165606845 19:37113082-37113104 GGGAATGCCCCAGTTTGTTGCGG + Intronic
1202654915 1_KI270708v1_random:11921-11943 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
925529521 2:4843850-4843872 GGTAATGCATGAGTATGTTGAGG + Intergenic
925840462 2:7987137-7987159 GTGATTGTATTAGTTTGTTCTGG - Intergenic
926515031 2:13832856-13832878 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
927320193 2:21734920-21734942 GTGCTTGCGTTAGTTTGCTGAGG - Intergenic
928507175 2:31965699-31965721 GTTCTTGCATTAGTTTGCTGAGG - Intronic
929625282 2:43400319-43400341 GTAATTGCATTACTTTTTTGAGG - Intronic
929843725 2:45499957-45499979 AGGATTGCATTAGCTATTTGGGG + Intronic
932908355 2:75779092-75779114 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
933256267 2:80084372-80084394 GGCACTGCATTCTTTTGTTGTGG + Intronic
933571375 2:84017235-84017257 GGGATTGAATTAGTTAGCTATGG - Intergenic
933615073 2:84475315-84475337 GGGTATGCCTGAGTTTGTTGAGG + Intergenic
933641747 2:84769595-84769617 GGGATTGTAGTTGTTTGTTTTGG + Intronic
933652481 2:84860573-84860595 GGGTTTGTATTAGTTTGCTAGGG - Intronic
936273487 2:111070383-111070405 GTATTTGCATTAGTTTGTTAAGG - Intronic
936488810 2:112951951-112951973 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
938982233 2:136537810-136537832 GGGTCTGCATTAGTTTGCTAAGG - Intergenic
939325116 2:140678619-140678641 AATATTGCATTAGTTTGTTAGGG + Intronic
939649119 2:144740283-144740305 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
940078673 2:149774118-149774140 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
941007305 2:160261247-160261269 GGGATTATATTAGTTTGTTCAGG + Intronic
942419226 2:175790993-175791015 GTGAATGTATTAGTTTGTTAGGG + Intergenic
944246248 2:197533238-197533260 GGGAGTGCTTGAGTGTGTTGGGG + Intronic
945015842 2:205515102-205515124 GTTCCTGCATTAGTTTGTTGAGG + Intronic
945681937 2:212924821-212924843 GGAATTGGATTAGTTTCCTGTGG + Intergenic
945714346 2:213338741-213338763 GTTACTGCATTAGTTTGCTGAGG - Intronic
946958906 2:224961961-224961983 GGAATTGCAGGAGTTTATTGAGG + Intronic
946972330 2:225108398-225108420 GGGATTGTCTTGGTTTGTTTAGG + Intergenic
947910048 2:233794756-233794778 GCCTTTGCATTAGTTTGTTAGGG + Intronic
1169604135 20:7296247-7296269 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1169891554 20:10458624-10458646 GTTCTTGCATTAGTTTGTTGAGG + Intronic
1170766608 20:19294544-19294566 GTGCTTGCATTAGTTTTCTGAGG + Intronic
1173019449 20:39254894-39254916 GGATTTGCATTAGTTTGCTCAGG + Intergenic
1174919481 20:54686375-54686397 GGGTTTGCTTTAGCTTGTGGGGG + Intergenic
1175780072 20:61676653-61676675 GGGATTGAGTTTGTTTGTTGAGG - Intronic
1176632714 21:9154453-9154475 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1176640599 21:9300376-9300398 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
1177054047 21:16277341-16277363 GTGATAACATTAGTTTGTTTGGG + Intergenic
1177248846 21:18566821-18566843 GGGAATGCCTTAGTTTGTTGTGG + Intergenic
1177813181 21:25946786-25946808 GCGATTGCAATGGTTTGTTATGG - Intronic
1179063078 21:37997728-37997750 GGGATTGCATTAGTCTCATTGGG + Intronic
1180055286 21:45355589-45355611 GGGATTTTATTAGTTTGTTTGGG - Intergenic
1180349622 22:11789759-11789781 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
1180388581 22:12202481-12202503 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1180838059 22:18941636-18941658 GGGAATGCCCCAGTTTGTTGTGG - Intergenic
1181535513 22:23540870-23540892 GGGAATGCCCCAGTTTGTTGGGG - Intergenic
1182372244 22:29819460-29819482 GGGATTACATTGGGTTGTTGAGG - Intronic
1182416664 22:30225685-30225707 GGGGTTGTATTAGTTTCCTGTGG + Intergenic
1182491854 22:30677853-30677875 GGGTATGCCTTGGTTTGTTGAGG + Intergenic
1183011770 22:34952573-34952595 GGGACTGTATTAGTTTGCTAGGG - Intergenic
949449497 3:4169641-4169663 GTGATTGCATTAGTTTGTTAGGG - Intronic
950030765 3:9851614-9851636 GGGAATGCCCCAGTTTGTTGTGG + Intronic
952490297 3:33864651-33864673 GGAATAGCATTAGTTTTTTAAGG + Intronic
952999315 3:38917542-38917564 GTTCTTGCATTAGTTTGTTAAGG - Intronic
953727377 3:45411952-45411974 TGGCCTGCATTAGTTTGCTGAGG + Intronic
953816829 3:46164626-46164648 GCGCCTGCATTAGTTTGCTGAGG + Intronic
956093763 3:65694814-65694836 GTGATTGCAGTATTTTGTTATGG - Intronic
956095499 3:65711886-65711908 GGGATTGTATTAATTTGCCGAGG - Intronic
956451762 3:69381930-69381952 TGGATTGCATTGATTTGCTGAGG - Intronic
959070194 3:101694856-101694878 GGGAATGCCCCAGTTTGTTGGGG - Intergenic
960028019 3:113030459-113030481 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
960274424 3:115711705-115711727 GGCATTGCTTCAGTTTGTTTGGG - Intronic
960306808 3:116071861-116071883 GTTACTGCATTAGTTTGCTGAGG + Intronic
961130279 3:124459873-124459895 GGGAGTGGATTTGTTTGTTGGGG + Intronic
961297032 3:125893256-125893278 GGGAATGCCCCAGTTTGTTGTGG - Intergenic
962221997 3:133572300-133572322 GGGGTTTCATTATTTTGGTGAGG + Intergenic
963695884 3:148565593-148565615 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
965186429 3:165471279-165471301 GTGATTGGTTTTGTTTGTTGTGG - Intergenic
965806614 3:172548662-172548684 GGTATTGTATTAGTTTGCTAGGG - Intergenic
966315209 3:178636964-178636986 GTTCTTGCATTAGTTTGTTAAGG + Intronic
966455083 3:180105713-180105735 GTCCTTGCATTAGTTTGCTGAGG - Intergenic
967026452 3:185568744-185568766 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
967767460 3:193296843-193296865 GTTCTTGCATTAGTTTGCTGAGG - Intronic
968163820 3:196448373-196448395 GGAATTGCATTAGTTTGCTAGGG - Intergenic
968243511 3:197116523-197116545 GGGATTGCAATAACTTGTTTAGG - Intronic
1202746294 3_GL000221v1_random:104648-104670 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
968856981 4:3132832-3132854 CGGATTGCATTCCTTTGCTGCGG + Exonic
969141904 4:5082488-5082510 GGAATTGCAGTCCTTTGTTGAGG + Intronic
970146089 4:13037615-13037637 GTTCTTGCATGAGTTTGTTGAGG - Intergenic
970282177 4:14469385-14469407 GAGATTGGATTAGTTTTCTGAGG - Intergenic
970284299 4:14492909-14492931 GTTCTTGCATTAGTTTGATGAGG + Intergenic
971347834 4:25827597-25827619 GGGATTGCATTAGTTTGTTGGGG - Intronic
971418350 4:26453778-26453800 GGAAGTGCATTAGTTGGGTGTGG - Intergenic
971511731 4:27434823-27434845 AGGATTTCATTATTTTGTTATGG - Intergenic
971995849 4:33962996-33963018 GGTTTTGCATTAGTTTGCTGAGG + Intergenic
972121765 4:35712525-35712547 GGGATTGCATAAGTTCTTGGTGG - Intergenic
972930712 4:44068652-44068674 GGGAATGAATTAGTTTGCTAGGG - Intergenic
973728873 4:53804094-53804116 GGGATTGCTTTGGTTTGCTTGGG + Intronic
976074663 4:81284246-81284268 GAGATTGCCTTAGTCTGTTCAGG + Intergenic
976223828 4:82779639-82779661 GGGTTTGCATGAGGTTGTTCTGG - Intronic
976281138 4:83328114-83328136 GAGACTGTATTAGTTTGTTAGGG + Intronic
977979436 4:103305735-103305757 GGGCTTTCATTTGTTTCTTGGGG + Intergenic
978205925 4:106081398-106081420 GTGCCTGCATTAGTTTGCTGAGG - Intronic
978760310 4:112350328-112350350 AGCATTGCATTATTTTGATGAGG - Intronic
980273959 4:130623684-130623706 GTTACTGCATTAGTTTGCTGAGG - Intergenic
980524406 4:133970981-133971003 GGGATTGTCTTAGTCTGTTTGGG - Intergenic
980858519 4:138470216-138470238 GTTCCTGCATTAGTTTGTTGAGG + Intergenic
980868427 4:138581660-138581682 GGGATTGCTTTATTTTTTTAAGG + Intergenic
980971537 4:139571966-139571988 GTGATTGCATCAGTTTCTTAGGG + Intronic
981581313 4:146251197-146251219 GGAATAGCAGTATTTTGTTGAGG - Intergenic
982247306 4:153365896-153365918 GGAATTGTATTAGTTTTTTATGG + Intronic
982499607 4:156136736-156136758 GTTCTTGCATTAGTTTGTTTAGG - Intergenic
982788904 4:159567576-159567598 GTTCCTGCATTAGTTTGTTGAGG + Intergenic
983166758 4:164487263-164487285 GTTCCTGCATTAGTTTGTTGAGG - Intergenic
983394449 4:167175834-167175856 AGTATTGTATTAGTTTGCTGGGG - Intronic
1202755495 4_GL000008v2_random:58644-58666 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
987883883 5:23787610-23787632 TGTCTTGCATTATTTTGTTGAGG - Intergenic
988380591 5:30493128-30493150 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
988635733 5:32981921-32981943 GGAATTCCATGTGTTTGTTGGGG - Intergenic
990218535 5:53561381-53561403 GGGATTGAATTGAGTTGTTGAGG + Intronic
991654187 5:68886485-68886507 GTTATTGAATTAGTTTGCTGAGG + Intergenic
993699895 5:91106426-91106448 AGGATTGCTTTAGTTATTTGAGG + Intronic
995900699 5:117062920-117062942 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
996312723 5:122125023-122125045 GATATTGCATTTGTTTGTGGCGG + Intergenic
998046906 5:138994973-138994995 GTTTTTGCATTAGTTTGCTGAGG + Intronic
998491927 5:142554579-142554601 GGGACTGTATTAGTTTGCTAGGG + Intergenic
998547279 5:143040661-143040683 TGGATTGCATTAGATTGAAGCGG + Intronic
999766417 5:154744375-154744397 GGTATGGCATTAGTTTGTGCAGG + Intronic
999952284 5:156663901-156663923 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1000282550 5:159794575-159794597 GTTATTGCATTAGTTTGCTAGGG - Intergenic
1000589428 5:163140812-163140834 GTTATTGCATTAGTTTGCTAAGG - Intergenic
1001174940 5:169459437-169459459 GGGATTTTATTAGTTTTCTGAGG + Intergenic
1001895681 5:175377962-175377984 GGGTTTTGATTAATTTGTTGAGG - Intergenic
1003688557 6:8328736-8328758 GTTCCTGCATTAGTTTGTTGAGG - Intergenic
1003902076 6:10663638-10663660 GTTCTTGCATTAGTTTGCTGTGG + Intergenic
1004476877 6:15981532-15981554 AGGATTGTATTAGTTTTCTGGGG + Intergenic
1005092672 6:22074680-22074702 GTTCTTGCATTAGTTTGCTGAGG - Intergenic
1005729757 6:28685467-28685489 GGGAATGCCTCAGTTTGTTGTGG - Intergenic
1005845740 6:29776920-29776942 GTTTCTGCATTAGTTTGTTGAGG - Intergenic
1006179568 6:32146622-32146644 GGCATTTCATCAGTTTGTTTTGG + Intergenic
1008486197 6:52038685-52038707 GGGTCTGTATTAGTTTGTTAGGG - Intronic
1008852208 6:56036005-56036027 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1010269014 6:73900551-73900573 AGGAATGCAGGAGTTTGTTGAGG - Intergenic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1010330146 6:74614086-74614108 GTTATTGCATTAGTTTGATAAGG + Intergenic
1010477939 6:76312384-76312406 GTTCCTGCATTAGTTTGTTGAGG + Intergenic
1010592071 6:77723390-77723412 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1011383674 6:86770100-86770122 TGGTTTGCAGTATTTTGTTGAGG - Intergenic
1011783196 6:90813554-90813576 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1014023040 6:116613159-116613181 GTTACTGCATTAGTTTGCTGAGG - Intergenic
1015000210 6:128205141-128205163 GTTCTTGCATTAGTTTGCTGAGG - Intronic
1015657768 6:135539431-135539453 GGGATTGAATCAGTTTTTAGGGG + Intergenic
1016178023 6:141104796-141104818 GGTCCTGCATTAGTTTGCTGAGG - Intergenic
1016748696 6:147609469-147609491 GGGAGTGCAGTAGTTTTCTGGGG - Intronic
1017459328 6:154634528-154634550 TAGCTTGTATTAGTTTGTTGGGG + Intergenic
1018179262 6:161206345-161206367 GGGAGTGCTTTATTGTGTTGAGG - Intronic
1019976746 7:4588913-4588935 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1019977682 7:4597416-4597438 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1022456602 7:30563650-30563672 GGGAGTGTATTGGTTTCTTGGGG + Intergenic
1022556145 7:31298824-31298846 GGGAGTGTTTTAGATTGTTGGGG + Intergenic
1022772100 7:33485022-33485044 GTTCTTGCATTAGTTTGCTGAGG - Intronic
1026618533 7:71929399-71929421 GTTCTTGCATTAGTTTGCTGAGG + Intronic
1027497498 7:78906386-78906408 GGGTTTGCAATAGGTAGTTGAGG + Intronic
1028509368 7:91606341-91606363 GGAATACCAATAGTTTGTTGAGG + Intergenic
1028649588 7:93136811-93136833 GAGACTGCATTAGTTGGTTGAGG + Intronic
1029967033 7:104750804-104750826 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1030390756 7:108925305-108925327 GTGTTTGTGTTAGTTTGTTGAGG + Intergenic
1031097114 7:117433627-117433649 GTTTTTGCATTAGTTTGCTGAGG - Intergenic
1032396503 7:131593757-131593779 GGTTGTGCATTAGTTTGCTGAGG + Intergenic
1032532259 7:132631928-132631950 GGGATTGGATTAATTAGTGGAGG + Intronic
1033031338 7:137830260-137830282 GGGACTTCATTAGCTTGCTGTGG - Intronic
1033085859 7:138341252-138341274 GGGTATGCCTTGGTTTGTTGAGG - Intergenic
1033913383 7:146292285-146292307 GTTCCTGCATTAGTTTGTTGAGG + Intronic
1035070384 7:156140373-156140395 GGGCTTGCATTAGTTTTTTTGGG - Intergenic
1035843741 8:2841114-2841136 GTGCCTGCATTAGTTTGCTGAGG - Intergenic
1036292288 8:7504361-7504383 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1038369905 8:26978211-26978233 GGGTTTGCATTTGTTTGGTAGGG + Intergenic
1039223231 8:35358375-35358397 GTGTTTCCATTAGTTTGCTGAGG - Intronic
1040764320 8:50888609-50888631 GTTCCTGCATTAGTTTGTTGAGG + Intergenic
1040856045 8:51948918-51948940 GTGACTGCATTAGTTTGCTAGGG - Intergenic
1041484839 8:58363828-58363850 GTTCTTGCATTAGTTTGCTGAGG + Intergenic
1043979366 8:86620229-86620251 GGAAGTGTATTAGTTTGTTAGGG + Intronic
1046394213 8:113618832-113618854 TGGATTGTATTACATTGTTGAGG - Intergenic
1046524313 8:115364548-115364570 GTTCCTGCATTAGTTTGTTGGGG + Intergenic
1048811035 8:138286549-138286571 GGGATTGCCTTAGCTTTCTGAGG - Intronic
1050701794 9:8347962-8347984 GGTATTGCGTTAGTCTGCTGGGG - Intronic
1050986938 9:12094121-12094143 GAGATTGTATTAGTTTGCTTGGG - Intergenic
1052013789 9:23442211-23442233 GGGACTACATTAGTTTCCTGTGG - Intergenic
1052045714 9:23791876-23791898 GGGGTTGTATTAGTTTGCTTAGG - Intronic
1055684999 9:78763210-78763232 GTTATTGCATTAGTCTGTTCAGG - Intergenic
1057376644 9:94530596-94530618 GTTCCTGCATTAGTTTGTTGAGG - Intergenic
1058193599 9:101947735-101947757 AATATTGCATTAGATTGTTGAGG - Intergenic
1058208220 9:102134645-102134667 GTTACTGCATTAGTTTGCTGAGG - Intergenic
1059747930 9:117220805-117220827 GGCAGTGCCTTAGTTTCTTGGGG - Intronic
1060001833 9:119965817-119965839 GCTATTGCATTAGTTTCCTGGGG - Intergenic
1203755547 Un_GL000218v1:122076-122098 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1190395955 X:49983798-49983820 GGGAATGCAATAGATTTTTGTGG + Intronic
1194345822 X:92763845-92763867 AAGATTGCATTATTTTATTGTGG - Intergenic
1194346074 X:92767982-92768004 AAGATTGCATTATTTTATTGTGG - Intergenic
1195201373 X:102553285-102553307 GTTCCTGCATTAGTTTGTTGAGG - Intergenic
1196225355 X:113159175-113159197 GTTAATGCATTAGTTTGCTGAGG + Intergenic
1196248966 X:113435593-113435615 GGGATTTCATTCTTTTGTGGGGG - Intergenic
1196640992 X:118060783-118060805 GTCATTGTATTAGTTTGCTGGGG + Intronic
1196664144 X:118298654-118298676 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1196676825 X:118428931-118428953 GTTCCTGCATTAGTTTGTTGAGG - Intronic
1196896620 X:120343208-120343230 GTGACTGCATTAGTTTGCTAAGG + Intergenic
1197231207 X:124005737-124005759 GGGTTTGTATTAGTTTTTTAGGG + Intronic
1197407284 X:126067633-126067655 GGTATTGCATTAGCTTGCTAAGG - Intergenic
1197888397 X:131241511-131241533 GGAATTACGTTAGTTGGTTGTGG - Intergenic
1198256877 X:134931806-134931828 GGGAGTGTATTAGTTTGTCAGGG - Intergenic
1198818187 X:140615084-140615106 GGCATTGGCTTAGTTTGGTGTGG + Intergenic
1199000279 X:142628280-142628302 GATCCTGCATTAGTTTGTTGAGG + Intergenic
1199080048 X:143567065-143567087 TGGTTTGCATTAGTTTGCTGAGG - Intergenic
1199563484 X:149188822-149188844 GGGATTGCATTAAGTGGTTTAGG + Intergenic
1200654169 Y:5880495-5880517 AAGATTGCATTATTTTATTGTGG - Intergenic
1200654417 Y:5884631-5884653 AAGATTGCATTATTTTATTGTGG - Intergenic
1201054626 Y:9976227-9976249 GGGAACTCATGAGTTTGTTGAGG + Intergenic
1201169157 Y:11239681-11239703 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1201580931 Y:15511578-15511600 AGAATTGCATTAGTTTGTCTGGG - Intergenic