ID: 971352654

View in Genome Browser
Species Human (GRCh38)
Location 4:25866898-25866920
Sequence ACCCACCTCCTGTAATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971352654_971352658 -5 Left 971352654 4:25866898-25866920 CCTCCAGATTACAGGAGGTGGGT 0: 1
1: 0
2: 2
3: 8
4: 85
Right 971352658 4:25866916-25866938 TGGGTAGGAAGGCATTCTGCAGG 0: 1
1: 0
2: 4
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971352654 Original CRISPR ACCCACCTCCTGTAATCTGG AGG (reversed) Intronic
904536176 1:31201152-31201174 ACCCAGCTCCTGTCCTCTTGGGG + Intronic
906590582 1:47021399-47021421 ACCCACCTCTTGCAGCCTGGTGG + Intergenic
907894142 1:58668319-58668341 GCACAACTCCTGTAATTTGGAGG - Intronic
912469235 1:109895242-109895264 AGCCACCTTCTGTGATCTCGAGG + Intergenic
921977129 1:221215391-221215413 CCCCACATCCTGTATTCTGGTGG + Intergenic
1062829674 10:597277-597299 ACCCACTGCCTGCAACCTGGAGG - Intronic
1062878877 10:962538-962560 ACCCTCCTCCTGTCATGTGTGGG + Intergenic
1064240110 10:13619440-13619462 ACCCACCTCTTGATGTCTGGAGG + Intronic
1066239231 10:33517202-33517224 CCCCACCTTATGGAATCTGGGGG - Intergenic
1073944948 10:108739977-108739999 ACCCAGCTACTGTACTCAGGAGG - Intergenic
1076445100 10:130509068-130509090 ACCCACCTCCTGTGACCAGCAGG - Intergenic
1076667025 10:132099055-132099077 AGCCACCTCCTGTGATTCGGGGG - Intergenic
1076669161 10:132110165-132110187 ACCGGCCTCCTGTAGCCTGGAGG + Intronic
1079497452 11:21061758-21061780 TCCCACCTCCAGTTCTCTGGAGG - Intronic
1084096581 11:66915416-66915438 AGCCATCTCCTGTCATCAGGGGG - Intronic
1086336963 11:85810349-85810371 ACCCACTTCCTATATGCTGGTGG + Intronic
1089096329 11:115922938-115922960 AACCAGCTCCTCTAATTTGGTGG + Intergenic
1089541859 11:119193962-119193984 GCCCACCTCTAGAAATCTGGTGG + Intronic
1091551133 12:1535656-1535678 ACAAGCCTCCTGTCATCTGGGGG - Intronic
1092145852 12:6214224-6214246 AACCACCTCCTGTAATGTGTCGG + Intronic
1095932057 12:47637026-47637048 ACCCAGCTCATGCAATCTGAAGG - Intergenic
1096188490 12:49599419-49599441 ACCCACCTGCTGCAATATGTTGG - Intronic
1096976073 12:55699837-55699859 TCCCACCTCCTGGACTCTAGGGG - Intronic
1097836158 12:64274439-64274461 TCCCTCAGCCTGTAATCTGGTGG + Intronic
1103020292 12:117528484-117528506 AGCCACTTCCTGCAATCTGAGGG - Intronic
1106413481 13:29526848-29526870 ACCCCCATTCTGTAACCTGGAGG - Intronic
1106820920 13:33463666-33463688 CCCCACTTCATGTAACCTGGTGG + Intergenic
1117319390 14:54606771-54606793 ACCCCCCTCCTTTAGTTTGGTGG + Intronic
1119757242 14:77127777-77127799 CCCCACATCCTGTAACCTGGTGG - Intronic
1122902333 14:104787010-104787032 ACCCATACCCTGTAACCTGGCGG - Intronic
1122943464 14:104993997-104994019 ACCCACCCCATGTCAGCTGGGGG - Intronic
1124922884 15:34043588-34043610 ATCCACAGCCTGTACTCTGGTGG + Intronic
1129164937 15:73771577-73771599 ACCCACCGCCTGTGACCTGCAGG + Intergenic
1131853923 15:96571794-96571816 AGCCTCCTCCTGAAATCTGTGGG - Intergenic
1132405311 15:101538416-101538438 ACCCACCTCGTGAAAACTGTTGG - Intergenic
1133760140 16:8791997-8792019 ACACATTTCCTGTTATCTGGTGG + Intronic
1135916277 16:26608200-26608222 ACCCACCTGCTATAAATTGGGGG - Intergenic
1137821046 16:51446267-51446289 ACCCTGGTCCTGTAATCTAGAGG - Intergenic
1140666118 16:77229143-77229165 ACCCACCTCCTTTAGTCTTTAGG - Intergenic
1141058175 16:80838243-80838265 ACCCACCTCCATGATTCTGGAGG - Intergenic
1141667884 16:85475222-85475244 CCCCACCTCCTGTAAACCAGGGG + Intergenic
1160739495 19:679467-679489 ACCCCCTTTCTGTTATCTGGGGG - Intronic
1164572220 19:29382700-29382722 CCCCACCTCCTGGAATCTTTGGG + Intergenic
1167719598 19:51169287-51169309 GCCCACCTGCAGTTATCTGGAGG - Intergenic
1202666496 1_KI270708v1_random:125475-125497 GCCCACCTGCAGTTATCTGGAGG + Intergenic
926304849 2:11630437-11630459 ACCCAGCTCCTGTTATCTTCCGG - Intronic
926621339 2:15049396-15049418 GCCCACCTCCTGCAGCCTGGAGG + Intergenic
928027339 2:27751179-27751201 ACCCAACTCCTGAAACCTGGCGG + Intergenic
928982202 2:37147682-37147704 ACCTACCTCCTATCATGTGGAGG + Exonic
929055608 2:37873852-37873874 CCCTACCTCATGGAATCTGGTGG + Intergenic
932671188 2:73739175-73739197 ACCAACCTCCTAGTATCTGGAGG + Intergenic
936403461 2:112183265-112183287 ACCCATGTCATGTAATCTGGAGG + Intronic
946403071 2:219478963-219478985 CCCCACCTCCTGTCCTCTGAGGG - Intronic
1170759689 20:19238794-19238816 ACACACCTCCTGCCCTCTGGAGG + Intronic
1175583728 20:60120934-60120956 ACCCTCCTGCTGAAATCTTGGGG + Intergenic
1180747961 22:18104594-18104616 ACTCACCTCCTGTAAACAGGAGG - Exonic
1181040244 22:20188591-20188613 ACCCTCTTCCTGCCATCTGGGGG + Intergenic
1184542057 22:45132662-45132684 ACCCACCACCTGGAATCTTCCGG + Intergenic
1185187846 22:49413556-49413578 TCCATTCTCCTGTAATCTGGTGG - Intergenic
958591891 3:96169601-96169623 ACCCACCTCCTGTCACCCTGGGG + Intergenic
963719648 3:148846970-148846992 CCCCACCTCCTCTTTTCTGGTGG - Intronic
969686033 4:8674770-8674792 ACCCACTTCATCTTATCTGGGGG - Intergenic
971352654 4:25866898-25866920 ACCCACCTCCTGTAATCTGGAGG - Intronic
977985064 4:103373342-103373364 ACCCACATCCAGTCGTCTGGGGG + Intergenic
985091100 4:186363407-186363429 GCCCACCTGCAGTTATCTGGAGG + Intergenic
989267811 5:39497861-39497883 ACCCACCCCCTGTAAACTGGTGG + Intergenic
992034813 5:72762638-72762660 ATCCACCATCTGCAATCTGGAGG + Intergenic
997696103 5:135862320-135862342 TCCAACCTCCTGTTATGTGGAGG - Intronic
1000992780 5:167928014-167928036 ACCCACCTCCTGGACACTGTTGG - Intronic
1005421809 6:25659052-25659074 ACCCACCTCCTGCAATGAGTTGG + Intronic
1006980807 6:38146247-38146269 AGACACCCCCTGTGATCTGGGGG - Intronic
1011971704 6:93233088-93233110 ACCCACCTCCTGTAACCTAGAGG + Intergenic
1018459044 6:163980162-163980184 AGCCACCCCCTGTAATCCCGGGG + Intergenic
1022248563 7:28584546-28584568 GCCCAGCTCCTGGATTCTGGTGG - Intronic
1022520615 7:31004624-31004646 ACCCACCTCCAGGAAGCTGATGG + Intergenic
1026000882 7:66558306-66558328 AGCCTCCTCTTGTACTCTGGGGG - Intergenic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1032476952 7:132218043-132218065 ACCCACCGACTGGACTCTGGAGG - Intronic
1034201906 7:149287909-149287931 ACCCAGCTCCTGTACCTTGGGGG - Intronic
1035881507 8:3247953-3247975 AACCACCTCCCGAAATCTGCAGG + Intronic
1044006381 8:86942032-86942054 ACTCTCCTACTGTAATTTGGTGG - Intronic
1048726664 8:137393474-137393496 AACCACCTCCTGTAAGGAGGTGG - Intergenic
1057025688 9:91732664-91732686 CCCAACCTCCTGAAACCTGGAGG - Intronic
1057882811 9:98806211-98806233 ACCCCCCTCCTGCAACCTGAGGG + Intergenic
1061403151 9:130379252-130379274 ACCCACCTTCTGGAACATGGGGG - Intronic
1062331322 9:136046131-136046153 GCCCACCTCCTGCTCTCTGGAGG + Intronic
1062545919 9:137063723-137063745 AGCCTCCTCCTGTACCCTGGGGG + Exonic
1062568432 9:137173450-137173472 ACCCCTCTCCTGAATTCTGGTGG - Intergenic
1203488195 Un_GL000224v1:77852-77874 TCCCACCTGCAGTTATCTGGAGG + Intergenic
1203500816 Un_KI270741v1:19748-19770 TCCCACCTGCAGTTATCTGGAGG + Intergenic
1186716494 X:12257579-12257601 AAGAAACTCCTGTAATCTGGTGG + Intronic
1192407311 X:70899657-70899679 CAGCACCTCCTGTAATCTGGAGG + Intronic
1193082322 X:77417907-77417929 AACCACCTCCTGCAACCTGGTGG - Intergenic
1195112277 X:101659752-101659774 ACCCACCTGCCCGAATCTGGGGG + Exonic
1197321871 X:125042643-125042665 TCCCACCTACTGCACTCTGGTGG - Intergenic
1198393623 X:136201524-136201546 ACCCACCTCCTGAGATCTCATGG + Intronic