ID: 971355513

View in Genome Browser
Species Human (GRCh38)
Location 4:25891329-25891351
Sequence GGTCTTAATCCCCCGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971355508_971355513 1 Left 971355508 4:25891305-25891327 CCATTGTCCAAACTCCGAAGCTT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 971355513 4:25891329-25891351 GGTCTTAATCCCCCGAGACCTGG No data
971355506_971355513 14 Left 971355506 4:25891292-25891314 CCTTCAATGCCTTCCATTGTCCA 0: 1
1: 0
2: 6
3: 17
4: 280
Right 971355513 4:25891329-25891351 GGTCTTAATCCCCCGAGACCTGG No data
971355505_971355513 25 Left 971355505 4:25891281-25891303 CCTTTCTTAAGCCTTCAATGCCT 0: 1
1: 0
2: 1
3: 19
4: 219
Right 971355513 4:25891329-25891351 GGTCTTAATCCCCCGAGACCTGG No data
971355507_971355513 5 Left 971355507 4:25891301-25891323 CCTTCCATTGTCCAAACTCCGAA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 971355513 4:25891329-25891351 GGTCTTAATCCCCCGAGACCTGG No data
971355511_971355513 -6 Left 971355511 4:25891312-25891334 CCAAACTCCGAAGCTTGGGTCTT 0: 1
1: 0
2: 1
3: 4
4: 103
Right 971355513 4:25891329-25891351 GGTCTTAATCCCCCGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971355513 Original CRISPR GGTCTTAATCCCCCGAGACC TGG Intronic
No off target data available for this crispr