ID: 971355719

View in Genome Browser
Species Human (GRCh38)
Location 4:25893674-25893696
Sequence GAGGGTCAGCAATTTATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971355719_971355723 27 Left 971355719 4:25893674-25893696 CCCAATATAAATTGCTGACCCTC 0: 1
1: 0
2: 1
3: 8
4: 139
Right 971355723 4:25893724-25893746 AATTTTAAGCCACTGAATTTTGG 0: 1
1: 8
2: 63
3: 459
4: 1525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971355719 Original CRISPR GAGGGTCAGCAATTTATATT GGG (reversed) Intronic
904015223 1:27414625-27414647 GAGATTCAGCAATTTAAATGAGG - Intronic
906118470 1:43371101-43371123 GAGGTTCAGCAACTTACATAAGG - Intergenic
907667177 1:56443617-56443639 GAGTGACAGCAATTTAAATCTGG + Intergenic
908634739 1:66150477-66150499 GAGGTAAAACAATTTATATTTGG - Intronic
908922908 1:69217710-69217732 GAGGTTAAGCAATATATACTAGG - Intergenic
910789123 1:91032785-91032807 GAGGGTAAGGGTTTTATATTAGG + Intergenic
912507714 1:110167471-110167493 GAGGTTAAGCAATTTGTAGTAGG - Intronic
912886317 1:113478629-113478651 GAGGGTCAGCTGTCTATATGAGG + Intronic
913722251 1:121609053-121609075 TAGGGTCAGTAACTGATATTTGG + Intergenic
916349413 1:163831996-163832018 GATGGTCAGCAATTAGTAGTAGG + Intergenic
916650117 1:166827459-166827481 GGGGGTCAGCAATTCAGATTGGG + Intergenic
918281681 1:183012094-183012116 GAGGGTGATCATTTTATTTTTGG + Intergenic
919677753 1:200402475-200402497 GGGGGCCATCAATTTATATCGGG + Intergenic
921968796 1:221122035-221122057 GTGGGTCAGCAATTTAGGCTGGG + Intergenic
1062908686 10:1198247-1198269 GAGGCCCAGCAATTTAGATATGG - Intronic
1065519321 10:26555998-26556020 GAGGGTGAGCAATTTATCCAAGG - Intronic
1069472940 10:68709071-68709093 GAGGGGAAGCAATTTATATTTGG + Intergenic
1073396258 10:103220249-103220271 GAGGCTTAGAAATTTATTTTTGG + Intergenic
1078512174 11:11993561-11993583 GTGGGTGAGCAATTTTTATGGGG - Intronic
1078620746 11:12905511-12905533 GAGGGAAGGCAATTTAAATTCGG + Intronic
1078675419 11:13408096-13408118 GTGGGTCAGGAATTTATACAGGG - Intronic
1081066158 11:38542464-38542486 GAGGTTGATCAATTTATTTTTGG - Intergenic
1081084237 11:38779379-38779401 GAGGGTCTGCAGTCAATATTTGG - Intergenic
1081367813 11:42257899-42257921 GTGGGTCAGGAATTTATACAGGG - Intergenic
1094760028 12:33521476-33521498 GAGGGTCAGCCACCTATATGAGG - Intergenic
1101614367 12:106321800-106321822 TAGGGTCAGTAATTTATTTGGGG - Intronic
1102632464 12:114293273-114293295 GCAGGTCAGCAATTTGTACTGGG - Intergenic
1103821816 12:123704898-123704920 GAGAGTCTGCAAGTTATTTTAGG + Intronic
1104117895 12:125767210-125767232 GTGGGTCAGCAATTTTGGTTGGG + Intergenic
1104291879 12:127477123-127477145 TAGGGTCAGAAAATTCTATTAGG - Intergenic
1106220078 13:27739408-27739430 AAGGGTCAACTATATATATTAGG + Intergenic
1108822617 13:54372010-54372032 AAGGGTCAGCTAAATATATTTGG + Intergenic
1110546417 13:76760835-76760857 GAGGGTCTGTAATTTAGATCAGG - Intergenic
1111391148 13:87596537-87596559 GAGAAACAGCAATTTATATGGGG - Intergenic
1113018841 13:105859254-105859276 GAGGGTCAGGAAAATGTATTTGG + Intergenic
1116349115 14:43836464-43836486 GAGAATCAGCTATTTATTTTGGG - Intergenic
1118463341 14:66007461-66007483 GTGGATCAGCAATATAGATTGGG + Intergenic
1119886764 14:78150039-78150061 GAGGGTCAGGAATGCAGATTTGG - Intergenic
1124635908 15:31365193-31365215 GAGGGCAAGCAATTTCTCTTTGG + Intronic
1126639411 15:50809932-50809954 GAGGGTAAGCAATTTACCTGAGG + Intergenic
1127322254 15:57858160-57858182 GTGGGGTAGCAATTTCTATTTGG - Intergenic
1127435571 15:58954464-58954486 GAGGTTAAGCTATTTCTATTTGG + Intronic
1131329871 15:91486985-91487007 GGGGGTCAGGAAATTGTATTTGG + Intergenic
1133516808 16:6517370-6517392 GAGGGTCGTCAATTAATCTTAGG + Intronic
1134388315 16:13794900-13794922 AGGGGTCAGCAATTTGGATTGGG + Intergenic
1137039179 16:35593957-35593979 GACGGTCAGCAATTTAGGCTGGG + Intergenic
1137805295 16:51299017-51299039 GTGGGTCAGCAATTTGGGTTGGG - Intergenic
1138956747 16:61980121-61980143 CAGGGGCAGAAATATATATTTGG + Intronic
1140828836 16:78732501-78732523 GTGGGTCAGCAATTTGAATATGG - Intronic
1150038780 17:61834903-61834925 GGGGGTCAGCAATTTAGGGTGGG - Intronic
1155039464 18:22052737-22052759 GTGGGTCAGCAATTTGGGTTGGG + Intergenic
1156612305 18:38739230-38739252 GTGGGTAAGCAATTCATATCAGG - Intergenic
1157056980 18:44241409-44241431 GTAGGTCAGCAATTTGGATTGGG - Intergenic
1163993162 19:21018272-21018294 GATGGTCAGCCATTTAGGTTGGG - Intergenic
1164152947 19:22570309-22570331 GAGGGTCAGAATTTAATTTTTGG - Intergenic
925779399 2:7367478-7367500 GAGGTTTATCAATTTTTATTAGG - Intergenic
926604563 2:14884435-14884457 GTGGGTGAGCAATTTTGATTTGG - Intergenic
927829537 2:26337491-26337513 GTGGGTCAGCAATTTGGAATGGG - Intronic
928778280 2:34791776-34791798 GAGGGTCAGAATTTAATTTTTGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930958352 2:57230930-57230952 GAGGGTCAGAATTTAATTTTTGG - Intergenic
931861750 2:66362049-66362071 CAGGGTCAGCCACTTACATTTGG + Intergenic
934944069 2:98523863-98523885 GAGGGTCAAACATATATATTTGG - Intronic
937170019 2:119856383-119856405 GAGGGTGTGAAATTTATCTTTGG + Intronic
937668278 2:124511997-124512019 GAGGGTTAACAAAATATATTAGG + Intronic
937876670 2:126831167-126831189 GAGGGTCAGGAATTTGGATAGGG - Intergenic
938661792 2:133494506-133494528 GAGGCTTAGAAATTTATTTTTGG - Intronic
939330545 2:140753831-140753853 TAGGCTCAGCAATTTAGAGTTGG - Intronic
942390820 2:175491345-175491367 GAGGGTCATTAATTGATTTTAGG + Intergenic
945605340 2:211922994-211923016 GAGGTTCAGGAATTTAGCTTTGG + Intronic
945712475 2:213316045-213316067 CAGGGTTGGCAATTTAAATTTGG - Intronic
948350715 2:237338430-237338452 GTGGGTTAGCAATTTTTGTTTGG - Intronic
1168990297 20:2089489-2089511 GAGGGCCAGCAATCTAAATTAGG + Intergenic
1169012888 20:2265177-2265199 GAGGGGCAGCCACTTATATGAGG - Intergenic
1175979494 20:62730112-62730134 GAAAGTCTGCAGTTTATATTAGG + Intronic
1176968656 21:15240174-15240196 AAGAGTCAGGAATTTATTTTAGG + Intergenic
1177499693 21:21937390-21937412 GAGTTTTAGCAAGTTATATTGGG + Intergenic
1179475117 21:41638129-41638151 GAGGGTCAGAATTTTAAATTGGG + Intergenic
1179823219 21:43949282-43949304 GTGGGTCAGCAATTTGGGTTGGG + Intronic
1183220690 22:36510766-36510788 GAGATTCAGCAATTTCTATGTGG - Intergenic
1184379685 22:44137567-44137589 GTGGGTCAGCAATTTAGGCTGGG + Intronic
952560075 3:34581904-34581926 GAGGTTAAGCAATTTGTCTTAGG + Intergenic
955746317 3:62143827-62143849 GAGGTTCAGTAATTTGTACTGGG - Intronic
956329426 3:68089179-68089201 CAGGGCTAGCAATTTAAATTTGG + Intronic
961535228 3:127566700-127566722 GAGGGTCAGCATTTGGAATTGGG + Intergenic
962180028 3:133196936-133196958 GAGGCTGAGAAATTAATATTTGG + Intronic
964255241 3:154767824-154767846 AAGGATCAGTAATATATATTTGG - Intergenic
965770295 3:172174944-172174966 GATGGACAGCAAATTGTATTGGG - Intronic
971355719 4:25893674-25893696 GAGGGTCAGCAATTTATATTGGG - Intronic
972068030 4:34976908-34976930 GAAAGTCCGCAGTTTATATTAGG + Intergenic
972526017 4:39912269-39912291 GAGTGTCAGAAACTTATATTGGG + Intronic
972876635 4:43370030-43370052 GAGGTTCAGGAATTTAGAGTTGG + Intergenic
974237709 4:59203747-59203769 GATGTTCAGCAATTGATAGTTGG - Intergenic
980210111 4:129776258-129776280 GAGAGCCAGCTGTTTATATTTGG - Intergenic
981092287 4:140744283-140744305 GGGGGTCAGAATTTTATTTTTGG - Intronic
982102600 4:151982783-151982805 GAGAAAGAGCAATTTATATTGGG - Intergenic
982141238 4:152320889-152320911 GAGGGTAAGCACTTAATATGTGG + Intergenic
982637356 4:157913755-157913777 GAGAGTCATCAAATTAAATTTGG - Intergenic
982942708 4:161578672-161578694 GGGTATCAGCAATTTATATATGG - Intronic
984279499 4:177652220-177652242 CAGGTTTATCAATTTATATTTGG + Intergenic
984904406 4:184613388-184613410 GAGGCTCAGAATTTTATTTTTGG + Intergenic
987883904 5:23787980-23788002 GAGGATCAGCAAACTATATATGG - Intergenic
990521444 5:56585359-56585381 GAAGGTCAGCAATTTGTCTGGGG + Intronic
990717849 5:58658635-58658657 GTGGGTCAGCAATTTGGACTGGG + Intronic
992536870 5:77715060-77715082 GAGGGTTTGCAATTTAAAATAGG + Intronic
992665708 5:79006922-79006944 GTAGGTCAGCAATTTAAAGTTGG - Intronic
995296651 5:110531906-110531928 GAGGGTCAGAATTTAATTTTTGG - Intronic
1000130545 5:158293416-158293438 GTGGTTCAGCAATTTGGATTGGG + Intergenic
1000299112 5:159939362-159939384 GCAGGTCAGCAATTTACCTTGGG - Intronic
1002854621 6:1026155-1026177 GAGGATCAGCAATTTGACTTGGG + Intergenic
1004638844 6:17494560-17494582 GAGGATCAGAAATATATATGGGG - Intronic
1007196538 6:40066415-40066437 GAGGGTCAGTAACTCATATATGG - Intergenic
1008578582 6:52884587-52884609 GAGGCTTAGAATTTTATATTTGG + Intronic
1011794774 6:90940372-90940394 GAGAGTCATCAATTAATATTAGG + Intergenic
1015967648 6:138711306-138711328 GAGGGGCAGCCACTTATATGAGG + Intergenic
1021308813 7:19066052-19066074 TAAGGTCAACAATTGATATTTGG + Intronic
1022372844 7:29786911-29786933 GAGGGTCAGAATTTAATTTTTGG - Intergenic
1022678555 7:32523086-32523108 GAGGGACAGCAAATTTGATTAGG - Intronic
1022836372 7:34119761-34119783 GAGGGTCTCCAATTTTTAATAGG - Intronic
1023516949 7:41010641-41010663 AATGGTCAGAAGTTTATATTTGG + Intergenic
1023726218 7:43145092-43145114 GAGAGTTAGTAATTTATTTTGGG - Intronic
1028690149 7:93641925-93641947 GAGGGTCAGAATTTAATTTTTGG - Intronic
1031089288 7:117334475-117334497 GTGGGTCAGAAATTTAAACTGGG + Intergenic
1032601145 7:133296782-133296804 GAGGTTCAGCAATTTCCATTTGG + Intronic
1034872245 7:154695067-154695089 GTGGGTCAGCAAGTGATATTAGG + Intronic
1035556881 8:573699-573721 GAGGCTTAGAATTTTATATTTGG + Intergenic
1036010387 8:4715476-4715498 GAGGATTATCAATTTATATGTGG - Intronic
1037844909 8:22274670-22274692 GAGGGTCAGAAATCTTTCTTTGG + Intergenic
1041819985 8:62020240-62020262 GATGTTCAGCAATGTATATCAGG - Intergenic
1042351241 8:67779850-67779872 GAGGATCAGCATTTCATATAGGG + Intergenic
1042481982 8:69314452-69314474 GAGGGTCAAAAATTTAGATTTGG - Intergenic
1044180152 8:89182490-89182512 GAGAGTCATCAATTTATCTAAGG + Intergenic
1044535369 8:93351579-93351601 ATGGGTCAACAATTTGTATTGGG + Intergenic
1047225242 8:122951045-122951067 GAGGGTCACCATTTCATGTTTGG - Intronic
1049084326 8:140466186-140466208 GAGCGGCATCAATTTATTTTTGG - Intergenic
1049958546 9:715480-715502 GAGGGTCAGCAAATTACTTCAGG - Intronic
1052067897 9:24045306-24045328 GTGGGTCAGCAATTTGTGCTGGG + Intergenic
1056618216 9:88187042-88187064 GTGGGTCAGCAATTTAGGATAGG - Intergenic
1057424558 9:94937730-94937752 GAGGGACAGCAGCTTACATTAGG - Intronic
1060001148 9:119959628-119959650 GAGGCTCAGCAATTTATCCAAGG - Intergenic
1188340219 X:28990930-28990952 TAGGGACAACAATTTAAATTTGG + Intronic
1189470050 X:41306914-41306936 GAGTGGCAGCAATAAATATTTGG + Intergenic
1191068659 X:56377750-56377772 GAGGGACAGCAAATTTTATAAGG + Intergenic
1192194110 X:69017218-69017240 GAGGGACAGCAATTGGGATTGGG + Intergenic
1192709238 X:73562961-73562983 GAGCGTCAGCTACTTGTATTCGG - Intergenic
1194186765 X:90780441-90780463 GAGGCTTAGCATTTTATTTTTGG - Intergenic
1196165518 X:112532682-112532704 GAGGGCCAGAAATTAATTTTTGG - Intergenic
1197045735 X:121995939-121995961 AAGGGTCAGCATTTTTTAATGGG + Intergenic
1200533361 Y:4362515-4362537 GAGGCTTAGCATTTTATTTTTGG - Intergenic