ID: 971359118

View in Genome Browser
Species Human (GRCh38)
Location 4:25920710-25920732
Sequence TTACCTTGAATGAATCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 524}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971359118_971359121 3 Left 971359118 4:25920710-25920732 CCTGCAGGATTCATTCAAGGTAA 0: 1
1: 0
2: 4
3: 63
4: 524
Right 971359121 4:25920736-25920758 TCCTATTTGGGTACACCATTTGG 0: 1
1: 0
2: 0
3: 2
4: 79
971359118_971359119 -10 Left 971359118 4:25920710-25920732 CCTGCAGGATTCATTCAAGGTAA 0: 1
1: 0
2: 4
3: 63
4: 524
Right 971359119 4:25920723-25920745 TTCAAGGTAAATATCCTATTTGG 0: 1
1: 0
2: 1
3: 32
4: 281
971359118_971359120 -9 Left 971359118 4:25920710-25920732 CCTGCAGGATTCATTCAAGGTAA 0: 1
1: 0
2: 4
3: 63
4: 524
Right 971359120 4:25920724-25920746 TCAAGGTAAATATCCTATTTGGG 0: 1
1: 0
2: 1
3: 24
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971359118 Original CRISPR TTACCTTGAATGAATCCTGC AGG (reversed) Intronic
901865004 1:12100222-12100244 TTACCGTGAATGGAGCTTGCAGG + Intronic
903089333 1:20896725-20896747 TTACCATGAATGGAGACTGCAGG - Intronic
904435648 1:30493214-30493236 TTACCATGAATGGAGCTTGCAGG + Intergenic
905838023 1:41146477-41146499 TTACCTTGAATGGAGCTTGGAGG - Intronic
906547470 1:46630402-46630424 TTACAATGAATGGAGCCTGCAGG + Intergenic
907081827 1:51630550-51630572 TTACCATGAATGAAGCTTGCAGG + Intronic
907560698 1:55384986-55385008 TGACCTTGAGAGAAACCTGCTGG - Intergenic
907970828 1:59379492-59379514 TTACAATGAATGAAACTTGCAGG + Intronic
908309228 1:62859508-62859530 TTACCATGAATGGCACCTGCAGG + Intronic
908806086 1:67934519-67934541 TTACCATGAATGGATCTTGCGGG - Intergenic
909299415 1:73992950-73992972 TTAGCTTGAATGAGTTCTGATGG - Intergenic
909400595 1:75225097-75225119 TTACCATGAATGGAGCTTGCAGG - Intronic
909462971 1:75940356-75940378 TTACCATGAATGGAGCTTGCAGG + Intergenic
909596585 1:77413060-77413082 AAACCTTCAATGACTCCTGCAGG + Intronic
910237796 1:85052950-85052972 TTACCATGAATGAAGCTTGCAGG - Intronic
911061830 1:93755397-93755419 TTACCATGAATGGAGCTTGCAGG - Intronic
911135426 1:94434031-94434053 TTACCATGAATGGAGCTTGCAGG + Intronic
911450019 1:98050337-98050359 CAACCTTGAATCAATCCTGGTGG - Intergenic
911544200 1:99196785-99196807 TTACCATGAATGAAACTTACGGG - Intergenic
912764677 1:112397293-112397315 TAACCTTGAAGGTATACTGCAGG + Intronic
913145435 1:115985143-115985165 TTACCATGAACGGAGCCTGCGGG - Intronic
913194880 1:116447769-116447791 TTACCATGAATGGAGCTTGCAGG - Intergenic
914938027 1:151997408-151997430 TTACCATGAATGGAACTTGCAGG - Intergenic
915029394 1:152863873-152863895 TTACCATGAATGGAGCTTGCAGG - Intergenic
915286319 1:154855419-154855441 TTACCATGAATGGAGCTTGCAGG - Intronic
915376221 1:155398542-155398564 TTACCATGAATGGACCTTGCAGG + Intronic
916404095 1:164480492-164480514 TTACCTTAAATGGAGACTGCAGG - Intergenic
916529664 1:165644468-165644490 TTACCATGAATGGAGCCTGCAGG + Intronic
916813790 1:168330503-168330525 TTACCTTGAATAGAGCTTGCAGG - Intergenic
917005840 1:170416333-170416355 TTAGGTTAAGTGAATCCTGCAGG - Intergenic
917021966 1:170598997-170599019 TTACCATAAATGAAGCTTGCAGG - Intergenic
917113954 1:171582735-171582757 TTACCATGAATGGAGCTTGCAGG + Intronic
917957625 1:180116591-180116613 TTACCATGAATGGAGCTTGCAGG - Intergenic
918134198 1:181656718-181656740 TTACCATGAATGGAGCTTGCAGG - Intronic
918217566 1:182405928-182405950 TTACCATGAATGGAGCTTGCAGG - Intergenic
918254113 1:182732776-182732798 TTATCTTCAAAGAATCCTCCAGG - Intergenic
918278381 1:182977610-182977632 TTACCGTGAATGGAGCTTGCAGG + Intergenic
918941061 1:190997613-190997635 TAACCCTGAATGAAGCTTGCAGG + Intergenic
919040859 1:192386414-192386436 TTACCATGAATGAAGTTTGCAGG + Intergenic
919060961 1:192632165-192632187 TTAGCTTGGATAAATCCTGTTGG + Intergenic
919071407 1:192760312-192760334 ATACCTTGAATAAATCCCACTGG + Intergenic
920680323 1:208067529-208067551 TTACCATGAATGGAGCTTGCAGG - Intronic
920717198 1:208351377-208351399 TTACCATGAATGGAGCTTGCAGG - Intergenic
921108890 1:212013637-212013659 TTACCATGAATGGAGCTTGCAGG - Intronic
921619059 1:217306591-217306613 TTACCATGAATGAAACCTTAAGG + Intergenic
921762226 1:218929533-218929555 CTACACTGACTGAATCCTGCAGG + Intergenic
921955261 1:220976545-220976567 TTACTATGAATGAAGCTTGCAGG + Intergenic
922399870 1:225241789-225241811 TTACCATGAATGGAACTTGCAGG + Intronic
922630196 1:227099397-227099419 TTACCATGAATGAAGCTTACAGG - Intronic
922863655 1:228840429-228840451 TTACCGTGAATGGAGCCTGTGGG + Intergenic
922884876 1:229011292-229011314 TTACCATGAATGGAGCTTGCAGG - Intergenic
923286008 1:232496136-232496158 TTACCATGAATGGAGCTTGCAGG - Intronic
923434012 1:233951403-233951425 TTACCATGAATGGAGCTTGCAGG - Intronic
923743112 1:236674233-236674255 TTAGCTTGAGTGGATCCTGAAGG + Intergenic
923925593 1:238623727-238623749 TTACCATGAATGGAGCTTGCAGG - Intergenic
924755702 1:246938824-246938846 TTACCATGAATGGAGCTTGCAGG + Intergenic
924857175 1:247885162-247885184 TTACCATGAATGGAGCTTGCAGG + Intergenic
1064704577 10:18058639-18058661 TTACCATGAATGGAGCTTGCGGG - Intergenic
1065030529 10:21581427-21581449 TTACCATGAATGAAGCTTACAGG + Intronic
1065878937 10:30022951-30022973 TTACCATGAATGGAGCTTGCAGG - Intronic
1066637967 10:37525593-37525615 TTACCATGAATGGAACTTGCAGG + Intergenic
1067124154 10:43501242-43501264 TTACCATGCATGGATCTTGCAGG + Intergenic
1067124371 10:43503552-43503574 TTACCATGAATGGAGCTTGCAGG - Intergenic
1067457358 10:46428991-46429013 CTACCATGAATGAAGCTTGCAGG - Intergenic
1067629844 10:47955646-47955668 CTACCATGAATGAAGCTTGCAGG + Intergenic
1068065415 10:52124475-52124497 TTACCATGAATGAATCTTGCAGG + Intronic
1068152709 10:53154738-53154760 TTACCATGAATGGAACTTGCAGG - Intergenic
1068912263 10:62390929-62390951 TTACCATGAATGGAGCTTGCCGG + Intronic
1069118761 10:64541275-64541297 TTACCATGAATGGAGCTTGCAGG - Intergenic
1069153262 10:64992653-64992675 TTACCATGAATGGAGCTTGCAGG - Intergenic
1069418680 10:68226074-68226096 TTACCATGAATGGAGCTTGCAGG - Intergenic
1070470201 10:76771495-76771517 TTACCATGAATGGAGCTTGCAGG - Intergenic
1071332938 10:84578718-84578740 TTACCATGAATGGAGCTTGCAGG - Intergenic
1071339639 10:84632801-84632823 TTACCATGAATGGAGCCTGCAGG - Intergenic
1071350510 10:84737280-84737302 TTACCATGTATGAAGCTTGCAGG + Intergenic
1071693319 10:87845394-87845416 TTACCATGAATGGAGCTTGCAGG + Intergenic
1071926849 10:90419100-90419122 TTACCATGAATGGAGCCTGTAGG - Intergenic
1072061369 10:91814577-91814599 TTACCATGAATGGAGCTTGCAGG - Intronic
1072644117 10:97238876-97238898 TTACCATGAATGGAGCTTGCAGG - Intronic
1072821452 10:98562019-98562041 TTACCATGAATGGAGCTTGCAGG - Intronic
1073813706 10:107181060-107181082 TTACCATGAATGAAGCTTGCAGG + Intergenic
1074243236 10:111660654-111660676 TTACCATGAATGAGGCTTGCAGG - Intergenic
1074355188 10:112776585-112776607 TTACATTAAATGCATCCTGGGGG - Intronic
1074437246 10:113444661-113444683 TTTCCTTGTAAGAACCCTGCGGG + Intergenic
1074626206 10:115189878-115189900 TTACCATGAATGAAGCTTGCAGG - Intronic
1074733245 10:116399674-116399696 TTACCAGGAATGAAGCTTGCAGG + Intergenic
1074747817 10:116553056-116553078 TTACCATGAATGGAGCTTGCAGG - Intronic
1076182030 10:128417213-128417235 TTACCATGAACGGAGCCTGCAGG - Intergenic
1077907238 11:6544131-6544153 TTTCCTGGATGGAATCCTGCAGG - Exonic
1078281987 11:9911694-9911716 TTACCGTGAATGGAGCTTGCAGG - Intronic
1078803876 11:14676499-14676521 TTACCATGAATGGAGCTTGCAGG + Intronic
1078884441 11:15486008-15486030 TCACCTTCATTGATTCCTGCAGG + Intergenic
1079061678 11:17254141-17254163 TTACCATGAATGGAGCTTGCAGG + Intronic
1079581602 11:22071368-22071390 ATACCTAGAAAGAATCCCGCTGG - Intergenic
1079680957 11:23297870-23297892 TTACCATGAATGGAGCTTGCAGG - Intergenic
1081408716 11:42729085-42729107 TTACAATGAATGAAGCTTGCAGG + Intergenic
1081508748 11:43746060-43746082 TTACTGTGAATGGAACCTGCAGG + Intronic
1085166144 11:74401318-74401340 TTACCATGAATGGAGCTTGCAGG + Intergenic
1085540725 11:77267033-77267055 TTACCATGAATGGAGCTTGCAGG - Intronic
1085555407 11:77415648-77415670 TTACCATGAATGGAACTTGCAGG + Intronic
1085910487 11:80819191-80819213 TTACCATGAATGGAGCTTGCAGG + Intergenic
1086799853 11:91159312-91159334 TTACCATGAATGCAGCTTGCAGG + Intergenic
1086968575 11:93055827-93055849 TTACTTTTACCGAATCCTGCTGG + Intergenic
1087258519 11:95984026-95984048 TTACCGTGAATGGAGCTTGCAGG - Intronic
1087727181 11:101734050-101734072 TTACCATAAATGAAGCTTGCAGG - Intronic
1087734648 11:101818341-101818363 TTACCATGAATGAAACTTGAAGG + Intronic
1087819624 11:102697314-102697336 TTACCATGAATGGAGCTTGCAGG + Intronic
1087842155 11:102931644-102931666 GGACCTTGAATGAATCTAGCAGG - Intergenic
1088056255 11:105583442-105583464 TTACCATGAATGAAGCTTGCAGG - Intergenic
1088269673 11:108020915-108020937 TCACCATGAATGGAGCCTGCAGG - Intronic
1090093307 11:123718917-123718939 TTACCATGAATGGAGCTTGCAGG + Intergenic
1090220459 11:125018162-125018184 TTACCATGAATGGAGCATGCAGG - Intronic
1090537044 11:127654209-127654231 TTACCATGAATGGAGCTTGCAGG - Intergenic
1090652333 11:128818136-128818158 TTACCATGAATGGAGCTTGCAGG + Intergenic
1090841375 11:130490659-130490681 TTACCATGAATGAAGCTTGCAGG - Intergenic
1091655049 12:2339316-2339338 TTACCATGAATGGAGCTTGCAGG + Intronic
1091984555 12:4897993-4898015 TTACCATGAATGGAGCTTGCAGG + Intergenic
1092665612 12:10792980-10793002 TTACCATGAATGAAGCTTGCAGG + Intergenic
1092990109 12:13888819-13888841 TTACCACGAATGGAGCCTGCAGG + Intronic
1093412496 12:18883343-18883365 TTTTCTTGAGTGAATCCTGATGG + Intergenic
1094442696 12:30496795-30496817 TTACCATGAATGGAGCTTGCAGG - Intergenic
1094459418 12:30678317-30678339 TTACCATGAATGGAACTTGCAGG - Intronic
1095149658 12:38777592-38777614 TTACCATGAATGAAGCTTACAGG - Intronic
1095207580 12:39456182-39456204 TTACCATGAATGGAGCTTGCAGG - Intergenic
1095381737 12:41602878-41602900 TTACCATGAATGGAGCTTGCAGG + Intergenic
1096143159 12:49259133-49259155 TTACCATGAATGGAACTTGCAGG - Intronic
1096948546 12:55438582-55438604 TTACCATGAATGGAGCTTGCAGG - Intergenic
1097592935 12:61593249-61593271 TTACCATGAATGGAGCTTGCAGG + Intergenic
1098507412 12:71269809-71269831 CTACCATGAATGGAGCCTGCAGG + Intronic
1099121741 12:78698172-78698194 TTACCATGAATGAAATTTGCAGG + Intergenic
1099670240 12:85681928-85681950 TTACCATGAATGGAGCTTGCAGG + Intergenic
1099738242 12:86597987-86598009 TTACCATGAATGGAGCTTGCAGG - Intronic
1099922425 12:88975717-88975739 TTACCAAGAATGGAGCCTGCAGG + Intergenic
1100068765 12:90684287-90684309 TTACCATGAATGAAGCTTGCAGG + Intergenic
1100152403 12:91755425-91755447 TTACCATGAATGAAGCTTGCAGG - Intergenic
1100253481 12:92857427-92857449 TTACCTTAAGTGAAGCCTGTAGG + Exonic
1100705120 12:97192523-97192545 TTTCCATGAATGAAGCTTGCAGG - Intergenic
1100807853 12:98306131-98306153 TTACCATGAATGGAGCTTGCAGG + Intergenic
1101056340 12:100919341-100919363 TTACCATGAATGGAGCTTGCAGG - Intronic
1101454629 12:104817255-104817277 TTACCATGAATGAAGATTGCAGG + Intronic
1101555392 12:105804219-105804241 TTACCATGAATGAAGCTTGCAGG - Intergenic
1102092156 12:110200471-110200493 TTACCATGAATGGAGCTTGCAGG + Intronic
1102275426 12:111578337-111578359 TTACCATGAATGGAGCTTGCAGG - Intronic
1102594802 12:113984140-113984162 TGGCCTGGAATGGATCCTGCAGG - Intergenic
1102607856 12:114083549-114083571 TTACCATGAATGGTGCCTGCAGG - Intergenic
1102801208 12:115735907-115735929 TTACCATGAATGGAGCTTGCAGG + Intergenic
1103594411 12:122015286-122015308 TTACCGTGAATGGATCTTGCAGG + Intergenic
1104521338 12:129478178-129478200 TTACCATGAATAAATCTTGCAGG + Intronic
1104659959 12:130604535-130604557 TTACCATGAATGGAGCTTGCAGG - Intronic
1104709957 12:130978817-130978839 TTAACTTCCATGAATCCTACTGG + Intronic
1105245072 13:18642386-18642408 TTACCTTGAATGAAATGGGCTGG - Intergenic
1105851792 13:24341585-24341607 TTACCATGAATGGAGCTTGCAGG - Intergenic
1106406147 13:29475989-29476011 TTACCATGAATGAAGCCTGCAGG - Intronic
1106417366 13:29557601-29557623 TTACCATGAACGAAGCCTGCAGG + Intronic
1107444929 13:40461875-40461897 TTACCATGAATGGAGCTTGCAGG + Intergenic
1107667715 13:42709384-42709406 TTACCATGAATGGAACTTGCAGG + Intergenic
1108420440 13:50243871-50243893 TTACCATGAATGGAGCTTGCAGG - Intronic
1108453695 13:50591931-50591953 TTACCATGAATGGAACCTGCAGG + Intronic
1108583436 13:51847001-51847023 TTACCATGAATGGAGCTTGCAGG - Intergenic
1108774549 13:53749548-53749570 TTACCTTGATTGACTACAGCAGG - Intergenic
1108904896 13:55456560-55456582 TTACCATGAATGAAGTTTGCAGG - Intergenic
1109506012 13:63304410-63304432 GTACCATGAATGAATCTTGTAGG - Intergenic
1109513203 13:63405917-63405939 TTACTGTGAATAAATTCTGCAGG - Intergenic
1109591959 13:64496244-64496266 TTACCATGAATGGAACTTGCAGG - Intergenic
1109966399 13:69703633-69703655 TTAACCTGAATGAAGCTTGCAGG - Intronic
1110232488 13:73181471-73181493 TTACCATGAATGGAACTTGCAGG - Intergenic
1110717047 13:78717741-78717763 TTACCTTGAATGAAGCTTGCAGG + Intergenic
1112289108 13:98129271-98129293 TTACCATGAATGGAGCTTGCAGG - Intergenic
1112470321 13:99682541-99682563 TTACCATGAATGGAGCTTGCAGG + Intronic
1112591610 13:100768393-100768415 TTCCTTTGAATGTGTCCTGCTGG + Intergenic
1114879223 14:26762860-26762882 TTACCATGAATGGAGCTTGCAGG + Intergenic
1115916817 14:38324188-38324210 TTACCGTGAATGGAGCTTGCAGG + Intergenic
1116048228 14:39770781-39770803 TTACCATGAATGGAGCTTGCAGG + Intergenic
1116692178 14:48122399-48122421 TTACTGTGAATGGAGCCTGCAGG + Intergenic
1116843655 14:49844501-49844523 TTACCATGAATGGAGCATGCAGG + Intronic
1117558849 14:56914869-56914891 TTACCATGAATGGAGCTTGCAGG + Intergenic
1118524879 14:66628510-66628532 TTACCATGAATGGAGCTTGCAGG + Intronic
1118680316 14:68234687-68234709 TTACCATGAATGGAGCTTGCAGG + Intronic
1120293233 14:82604958-82604980 TTACCATGAATGGAGCTTGCAGG + Intergenic
1121750703 14:96352947-96352969 TTACCATGAATGGAGCTTGCAGG - Intronic
1122661138 14:103296149-103296171 TTACCATGAATGGAGCTTGCAGG + Intergenic
1123754882 15:23389514-23389536 TTACCGTGAATGGAGCTTGCAGG - Intergenic
1125324532 15:38523660-38523682 TTACCATGAATGGAGCTTGCAGG - Intronic
1125347765 15:38736170-38736192 TTACCATGAATGAAGCTTGTAGG - Intergenic
1125455092 15:39850078-39850100 TTACCCTGAATGGAGTCTGCAGG + Intronic
1125519915 15:40342638-40342660 TTACCATGAATGAAGCCTGCAGG - Intergenic
1126196836 15:45940811-45940833 TTACCATGAATGGAACTTGCAGG + Intergenic
1126207744 15:46064598-46064620 TTACCATGAATGGAGCTTGCAGG + Intergenic
1126453057 15:48831389-48831411 TTACTGTGAATGAAGCTTGCAGG - Intronic
1128297330 15:66534711-66534733 TTACCATGAATGGAGCTTGCAGG + Intronic
1129196520 15:73971146-73971168 TTACCATGAATGGAGCTTGCAGG + Intergenic
1129620363 15:77138278-77138300 TTACCATGAAAGGAGCCTGCAGG + Intronic
1131100858 15:89689051-89689073 GTACCTAGAATGTACCCTGCAGG - Intronic
1131392411 15:92060114-92060136 TTACCATGAATGGAGCTTGCAGG + Intronic
1131601962 15:93858605-93858627 TTACCATGAATGGAGCTTGCAGG + Intergenic
1131727027 15:95237761-95237783 TTTTCTTGATTGAATCCTGGGGG + Intergenic
1132000174 15:98170892-98170914 TTACCATGAATGGAGCTTGCAGG - Intergenic
1134461494 16:14433466-14433488 TTACCATGAATGGAGCTTGCAGG + Intergenic
1137865987 16:51896853-51896875 TTACCATGAATGAAGCTTGCAGG + Intergenic
1137956561 16:52836878-52836900 TTACCATGAATGAAGCTTGCAGG + Intergenic
1138984342 16:62309237-62309259 TTACCATGAATGGAGCTTGCAGG - Intergenic
1139289250 16:65842291-65842313 TTACCCTGAATGGAGCTTGCAGG - Intergenic
1139452270 16:67039353-67039375 TTACTTTGAATGGAGCTTGCAGG + Intronic
1144211863 17:13022494-13022516 TTACCATGAATGGAACTTGCAGG - Intergenic
1144500298 17:15780346-15780368 TTACCATGAATGGAGCTTGCAGG + Intergenic
1147062140 17:37888819-37888841 TTACCATGAATGAAGCTTGCAGG - Intergenic
1148252084 17:46091554-46091576 TTACCATGAATGGAGCTTGCAGG - Intronic
1148368781 17:47077822-47077844 TTACCATGAATGGAGCTTGCAGG - Intergenic
1150010939 17:61503113-61503135 TTACCATGAATGGATCTTGCAGG + Intergenic
1150508997 17:65728768-65728790 TTACCATGAATGGAGCTTGCGGG + Intronic
1150537071 17:66054012-66054034 TTACCTTGAATGTTTACTGGTGG - Intronic
1153198653 18:2627668-2627690 TTACCATGAATGGAGCTTGCAGG - Intergenic
1154443877 18:14417546-14417568 TTACCTTGAATGAAATGGGCTGG + Intergenic
1155439712 18:25849671-25849693 TTACCTTGAATGGAGCTTGCAGG - Intergenic
1156018800 18:32576525-32576547 TTAACTTGATAGAATTCTGCTGG - Intergenic
1156097888 18:33558416-33558438 TTACCATGAATGGAGCTTGCAGG - Intergenic
1156729051 18:40167877-40167899 TTACCATGAATGGAGCTTGCAGG - Intergenic
1156820366 18:41365073-41365095 CTACCTTGTATGAAGCATGCCGG + Intergenic
1156940670 18:42763497-42763519 TTACCATGAATGAAGCTTCCAGG + Intronic
1157782565 18:50452941-50452963 TTAACATGAATGAAGCTTGCAGG - Intergenic
1157957686 18:52116627-52116649 TTACCTTAAATGGAGCTTGCAGG + Intergenic
1157973909 18:52303428-52303450 TTGCCTTGAAGAAATCCTGAAGG + Intergenic
1158011914 18:52738518-52738540 TTACCATGAATGGAGCTTGCAGG + Intronic
1158111579 18:53945574-53945596 TTACCATGAATGGAGCTTGCAGG + Intergenic
1158131155 18:54153793-54153815 TTTCCTTGAAGCAGTCCTGCTGG - Exonic
1158297093 18:56010321-56010343 TTACCATGAATGGAGCCTGCAGG + Intergenic
1158665281 18:59427241-59427263 TTACTATGAATGGAGCCTGCAGG + Intergenic
1158911888 18:62072338-62072360 TTACCATGAATGGAGCTTGCAGG - Intronic
1159315090 18:66762476-66762498 TTACCATGAATGGAGCTTGCAGG - Intergenic
1159870349 18:73754292-73754314 TTACCATGAATGGAGCTTGCAGG - Intergenic
1160097236 18:75885760-75885782 TTACCGTGAATGGAGCTTGCAGG - Intergenic
1160248178 18:77177452-77177474 TTACCATGAATGAAGCTTGCAGG + Intergenic
1160290238 18:77586426-77586448 TGACCTTGAGAGAATCCTTCAGG + Intergenic
1162231788 19:9272857-9272879 TTACCATGAATGGAGCTTGCAGG - Intergenic
1164210479 19:23093639-23093661 TTACCTGGGATGGAGCCTGCTGG - Intronic
1165671475 19:37683143-37683165 TTACCATGAATGGAGCTTGCAGG - Intronic
1167399977 19:49258795-49258817 ATTCCTGGAATAAATCCTGCTGG - Intergenic
1168528167 19:57105380-57105402 TTACCATGAATGCAGCTTGCAGG - Intergenic
925915858 2:8605549-8605571 TTACCGTGAATGGAGCTTGCAGG - Intergenic
926757009 2:16244469-16244491 CTACCATGAATGAGACCTGCTGG + Intergenic
928355377 2:30608504-30608526 TTACCATGAATGGAGTCTGCAGG - Intronic
928933264 2:36647594-36647616 TTACCATGAATGGAGCTTGCAGG - Intergenic
929240054 2:39644769-39644791 TTACCATGAATGGAGCTTGCAGG + Intergenic
929632006 2:43472947-43472969 TTACCACGAATGGAGCCTGCAGG + Intronic
930068857 2:47349226-47349248 TTACCATGAATGGAACTTGCAGG + Intronic
930181488 2:48363575-48363597 TTACCATGAATGAAGCTTGAAGG - Intronic
930182794 2:48381372-48381394 TTACCATGAATGGAGCTTGCAGG + Intergenic
930404478 2:50938105-50938127 TTACCATGAATGGAGCTTGCAGG + Intronic
931121059 2:59220249-59220271 TGACCTTGAATGAAAGCTCCCGG - Intergenic
931260899 2:60618137-60618159 TTACCATGAATGGAGCTTGCAGG - Intergenic
931459512 2:62438227-62438249 TTACCATGAATGAATCTTGTAGG + Intergenic
931882638 2:66582790-66582812 TCACCTGAAATAAATCCTGCCGG - Intergenic
932587230 2:73038341-73038363 TTACCATGAATGGAGCTTGCAGG + Intronic
933374122 2:81457457-81457479 TTACCATGAATGGAGCATGCAGG - Intergenic
934962852 2:98692569-98692591 TTACCATGAATGGAGCTTGCAGG - Intronic
935716210 2:105941144-105941166 TTACCATGAATGGAGCTTGCAGG + Intergenic
936143512 2:109962247-109962269 TTCCCATGAATGGAGCCTGCGGG + Intergenic
936288851 2:111202369-111202391 TTACCATGAATGGAGCTTGCAGG + Intergenic
936468774 2:112778363-112778385 CTACGTTGAATGAATCCTTCGGG + Intronic
937704897 2:124909168-124909190 TTATCATGAATGGAGCCTGCAGG - Intronic
937889106 2:126922465-126922487 TTACCATGAATGGAGCTTGCAGG + Intergenic
938813524 2:134876103-134876125 TTACCATGAATGGAGCTTGCAGG + Intronic
938902026 2:135806530-135806552 TCACCATGAATGGAGCCTGCTGG - Intronic
939100254 2:137887463-137887485 TTACCTTGAATGAAATGGGCTGG - Intergenic
939144218 2:138393112-138393134 TTACCGTGAATGGAACTTGCAGG - Intergenic
939719949 2:145635962-145635984 TTACCATGAATGGAGCTTGCAGG - Intergenic
939808230 2:146801475-146801497 TTACCATGAATGGAGCTTGCAGG + Intergenic
940066042 2:149630853-149630875 TTACCATGAATGAAGCTTGCAGG + Intergenic
940597443 2:155813421-155813443 TTACCATAAATGGAGCCTGCAGG + Intergenic
941692023 2:168510305-168510327 TTACCATGAATGGAGCTTGCAGG - Intronic
941809379 2:169740011-169740033 TTACCATGAATGGAGCTTGCAGG + Intronic
942049264 2:172123626-172123648 TTACCATGAATGAAGCTTGCAGG - Intergenic
942493587 2:176515033-176515055 TTACCATGAATGGAGCTTGCAGG - Intergenic
943227378 2:185195446-185195468 TTACTGTGAATGAAGCTTGCAGG - Intergenic
944986134 2:205179433-205179455 TTACCATGAATGGAGCTTGCAGG - Intronic
945197273 2:207248887-207248909 ATACCATGAATGAAGCTTGCAGG - Intergenic
945292419 2:208139064-208139086 TTACCATGAATGGAGCTTGCAGG + Intergenic
945433154 2:209788892-209788914 TTACCATGAATGGAGCTTGCAGG - Intronic
945613093 2:212030632-212030654 TTACATTTGTTGAATCCTGCTGG + Intronic
946667748 2:222068531-222068553 TTACCAGAAACGAATCCTGCTGG - Intergenic
946987943 2:225294474-225294496 TTAGCATGAATGAAGCCTACAGG + Intergenic
947159311 2:227196269-227196291 TTTCCATGAATGAAGCTTGCAGG - Intronic
947162001 2:227224452-227224474 TTACTTAAAATGAATGCTGCTGG + Intronic
947527609 2:230888637-230888659 TTACCATGAATGGAGCTTGCAGG - Intergenic
947539561 2:230966485-230966507 TTACCATGAATGGAGCTTGCAGG + Intergenic
947835678 2:233173254-233173276 TTACCATGAATGAAGCTTGCAGG + Intronic
947974454 2:234353297-234353319 TTATCTTTAATGAATCTTCCTGG + Intergenic
948069359 2:235107121-235107143 TTAACTTGTTTAAATCCTGCTGG - Intergenic
1169846399 20:9997094-9997116 TTACCATGAATGCAGCTTGCAGG + Intronic
1169848069 20:10016938-10016960 TTACTATGAATGAAGCTTGCAGG + Intronic
1170041912 20:12048049-12048071 TCACCATGAATGAATCTTTCAGG - Intergenic
1170273302 20:14552833-14552855 TTACCATGAATGGAGCTTGCAGG + Intronic
1170381770 20:15768464-15768486 TTACCATGAATGGAGCTTGCAGG + Intronic
1170599843 20:17833208-17833230 TTACCATGAATGGAGCTTGCAGG - Intergenic
1171471195 20:25372899-25372921 TTACCATGATTGGAGCCTGCAGG - Intronic
1171985597 20:31658711-31658733 TTACCTGGAATAAACCCTACAGG + Intergenic
1174310119 20:49646369-49646391 TTACCATGAACGGAGCCTGCAGG - Intronic
1175549387 20:59806979-59807001 TTACCATGAATGGAGCTTGCAGG + Intronic
1175652996 20:60744648-60744670 TTACCATGAATGGAGCTTGCAGG - Intergenic
1177572335 21:22903393-22903415 TTACCATGAATGAAGCTTGCAGG - Intergenic
1177598748 21:23282493-23282515 TTACTTTTCATGAATCCTGAAGG - Intergenic
1178402231 21:32296806-32296828 TTACCATGAATGAAGCCTCCAGG + Intronic
1178786187 21:35655966-35655988 TTTCCTTGAATGAATCATGTGGG + Intronic
1179115290 21:38485861-38485883 TTACCATGAATGGAGCTTGCAGG - Intronic
1179357709 21:40676696-40676718 TGACCTTGAATAAATCCTTGTGG + Intronic
1179550015 21:42137871-42137893 TACCCTTGGCTGAATCCTGCTGG - Intronic
1182115589 22:27754597-27754619 CTAGCTGGAATGAATCCAGCGGG - Intronic
1183049451 22:35248906-35248928 TTTCCATGAATGGAGCCTGCAGG + Intergenic
1184312164 22:43653231-43653253 TTTCTTTATATGAATCCTGCTGG - Intronic
1184439614 22:44500999-44501021 TTCCCTTGAGTGAAAACTGCAGG - Intergenic
1184701771 22:46179264-46179286 TTTCCTGGGATGAATCCTACTGG - Intronic
949252146 3:1998165-1998187 TTACCAAGAATGAAGCTTGCAGG + Intergenic
949561008 3:5202678-5202700 TTACCATGAAGAAAACCTGCTGG + Intronic
949685001 3:6558991-6559013 TTATCATGAATGAAGCTTGCAGG - Intergenic
949831581 3:8220419-8220441 TTACCATGAATGGAGCTTGCAGG + Intergenic
950638289 3:14331427-14331449 TTACCATGAATGGAGCTTGCAGG + Intergenic
951213728 3:20004102-20004124 TTACCATGAATAAAGCTTGCAGG - Intronic
951244675 3:20326714-20326736 TTACTATGAATGAAGCTTGCAGG + Intergenic
951283945 3:20786535-20786557 TTACCATGAATGGAGCCTGCAGG - Intergenic
952114309 3:30160834-30160856 TTACCATGAATGGAGCTTGCAGG - Intergenic
953172176 3:40517112-40517134 TTCCCTTGAATCCATCCTGCTGG - Exonic
953223354 3:40994770-40994792 TTACCATGAATGAAGCTTACAGG + Intergenic
953517531 3:43609853-43609875 TTACCATGAATGGAGCTTGCAGG + Intronic
953678637 3:45022758-45022780 TTACCATGAATGGAGCTTGCAGG + Intronic
954679395 3:52334314-52334336 TTACCATGAATGGAGCCTGCAGG + Intronic
954758457 3:52856301-52856323 GAAACTAGAATGAATCCTGCAGG + Intronic
956036993 3:65104442-65104464 TTACCATGAATGGAGCTTGCAGG + Intergenic
956056581 3:65304961-65304983 TTACCATGAATGGAGCTTGCAGG + Intergenic
956963282 3:74428795-74428817 TTACCATGAATGGAGCTTGCGGG - Intronic
957474690 3:80708120-80708142 TTACCATGAATGGAGCTTGCAGG + Intergenic
957647233 3:82946737-82946759 TTACCATGAATAAAGCTTGCAGG + Intergenic
958168017 3:89902023-89902045 TTAACATGAATGGATCTTGCAGG + Intergenic
958546425 3:95558182-95558204 TGACCTTGAATGAAACTTGCAGG + Intergenic
959708977 3:109365633-109365655 TTACCCTGAATGAAGTCTGCAGG + Intergenic
959967207 3:112370124-112370146 TTACCATGAATGGAGCTTGCAGG - Intergenic
960357019 3:116665878-116665900 TTACCATGAATGGAGCTTGCAGG + Intronic
960480915 3:118189133-118189155 CTACCATGAATGAAGCTTGCAGG + Intergenic
960601799 3:119466401-119466423 TTACCATGAATGGAGCTTGCAGG - Intronic
961023906 3:123535157-123535179 TTACCATGAATGGAGCTTGCAGG - Intronic
962028861 3:131577628-131577650 TTACCATGAATGGAGCCTGCAGG + Intronic
962146867 3:132848811-132848833 TTTCCTTGAATGCACCCTGAAGG - Intergenic
962614600 3:137112517-137112539 TTACCATGAATGGAGCTTGCAGG - Intergenic
962670652 3:137704334-137704356 TTACCATGAATGGAGCTTGCAGG + Intergenic
963134955 3:141894144-141894166 TGACCTTGAATGGAGCTTGCAGG + Intronic
963660624 3:148123558-148123580 TTATCATGAATGAAACTTGCAGG + Intergenic
963875535 3:150470538-150470560 TTACCATGAATGGAGCTTGCAGG + Intergenic
964229480 3:154447368-154447390 TTACCATGAATGAAGCTTGCAGG - Intergenic
964749934 3:160045082-160045104 TTACCATGAATGAAACTTGCAGG - Intergenic
965555588 3:170014949-170014971 TTGCCGTGAATGGAGCCTGCAGG - Intergenic
965557633 3:170034398-170034420 TTACCATGAATGGAGCTTGCAGG + Intergenic
966063540 3:175788034-175788056 TTACCATGAATGAAGCTTGAAGG - Intronic
966438409 3:179916460-179916482 TTACCATGAATGAAACTTGCAGG + Intronic
966628057 3:182040498-182040520 TTACCATGAATGGAGCTTGCGGG + Intergenic
967849805 3:194073172-194073194 TTACCTTGAATGTGGCCAGCTGG - Intergenic
967938979 3:194751748-194751770 TTACCATGAATGGAGCTTGCAGG + Intergenic
969928295 4:10605893-10605915 TTACCATGAATGAAGCTTGCAGG + Intronic
970804944 4:20019787-20019809 TTACCATGAATGGACCTTGCAGG + Intergenic
971002016 4:22334100-22334122 TTACCGTGAATGGAGCTTGCAGG - Intergenic
971359118 4:25920710-25920732 TTACCTTGAATGAATCCTGCAGG - Intronic
972105162 4:35476057-35476079 TTACCGTGAATGGAGCTTGCAGG + Intergenic
972366444 4:38379866-38379888 TTACCATGAATGAAGCTTGCAGG + Intergenic
973725258 4:53769347-53769369 TTACCATGAATGAAGCTTGCAGG - Intronic
973900921 4:55470201-55470223 TCACCATGAATGAAACTTGCAGG - Intronic
974204746 4:58686797-58686819 TTACCATGAATGGATCTTGCAGG - Intergenic
974466254 4:62260161-62260183 TTACCTTCAGTGGATCATGCTGG - Intergenic
976277995 4:83297978-83298000 TCACTGTGAATTAATCCTGCTGG + Intronic
976803195 4:89016541-89016563 TTACCATGAATGGAGCTTGCAGG - Intronic
976834275 4:89352893-89352915 TTACCATGAATGGAGCCTGCAGG + Intergenic
977299229 4:95248957-95248979 TTACTATGAATGAAGCTTGCAGG - Intronic
977467126 4:97396798-97396820 TTAACCTGAATAAATCATGCTGG - Intronic
977655568 4:99517236-99517258 TATCCTTGAATGAATCCTCATGG + Intronic
977840981 4:101704181-101704203 TTACCTTGAATGGAGCTTGCAGG + Intronic
978484770 4:109239583-109239605 TTACCATGAATGGAGCTTGCAGG + Intronic
979632540 4:122920237-122920259 CTACCTTGAAGAACTCCTGCTGG - Intronic
979681133 4:123461289-123461311 TTACCATGAATGGAACTTGCAGG - Intergenic
980038466 4:127912334-127912356 TTACCATGAATGGAGCCTGCAGG + Intergenic
980408827 4:132388568-132388590 TTACCATGAATGAAGACTGCAGG - Intergenic
981166557 4:141565837-141565859 TTACCATGAATGAAGCTTGCAGG + Intergenic
981798854 4:148632622-148632644 TTACCATGAATGGAGCTTGCAGG + Intergenic
981943207 4:150309050-150309072 TTCCCATGAATGAAGCTTGCAGG - Intronic
982902275 4:161022469-161022491 TTACCATGAATGGAGCTTGCAGG + Intergenic
983003835 4:162457228-162457250 TTACCATGAATGGAGCTTGCAGG + Intergenic
983483519 4:168304973-168304995 TTACCATGAATGGAGCTTGCAGG - Intronic
983587671 4:169373355-169373377 TTACCATGAATGGAGCTTGCAGG + Intergenic
983606248 4:169589041-169589063 TTACCATGAATGGAGCTTGCTGG - Intronic
983700699 4:170590175-170590197 TTACCATGAATGGAGCTTGCAGG - Intergenic
984080246 4:175239051-175239073 TTACCATGAATGAAACTTTCAGG - Intergenic
984979500 4:185265490-185265512 TTACCATGAATGGAGCTTGCAGG + Intronic
985385181 4:189438551-189438573 TTACCATGAATGGAACTTGCAGG + Intergenic
986447457 5:7834614-7834636 TTACCATGAATGAAGCTTGCAGG - Intronic
986618334 5:9643450-9643472 TTACCATGAATGGAGCTTGCAGG + Intronic
987151220 5:15042338-15042360 TTACCATGAGTGAAGCTTGCAGG + Intergenic
987480242 5:18446503-18446525 TTACCATGAATGGAGCTTGCAGG + Intergenic
987987516 5:25167158-25167180 TTACCAGGAATGAAGCTTGCAGG + Intergenic
988661469 5:33274398-33274420 TTACCATGAATGGAGCTTGCAGG + Intergenic
988791712 5:34614478-34614500 TTACCATGAATGGAGCTTGCAGG - Intergenic
988842901 5:35100405-35100427 TTACCATGAATAAAGCTTGCAGG - Intronic
988960069 5:36361141-36361163 TTACCATGAATGGAGCTTGCAGG + Intergenic
989175326 5:38519275-38519297 TTACCGTGAATGGAGCTTGCAGG - Intronic
990089924 5:52030314-52030336 TTACCATGAATGAAGCTTACAGG + Intronic
990108847 5:52297679-52297701 TTACCATGAATGGAGCTTGCGGG + Intergenic
990362179 5:55031615-55031637 TTACCTTACAGGAATCCTTCTGG - Exonic
990854744 5:60251889-60251911 TTACCATGAATGAAGCTTGCAGG - Intronic
991203842 5:64026213-64026235 TTACTTTGAAGGTATCCTACTGG - Intergenic
991725956 5:69536164-69536186 TTACCATGAATGAAGCTTGTAGG + Intronic
991869000 5:71091703-71091725 TTACCATGAATGAAGCTTGTAGG - Intergenic
992065292 5:73102026-73102048 TCACCATGAATGAAGCTTGCAGG + Intergenic
992517926 5:77514912-77514934 TTACCATGAATGTAGCCTGAAGG + Intronic
993101179 5:83541583-83541605 TTTCCTTAAAAGAATCCTGTGGG - Exonic
993194695 5:84726175-84726197 TTACCATGAATAGATCTTGCAGG - Intergenic
994585245 5:101699999-101700021 TTACCATGAATGGAGCTTGCAGG - Intergenic
994818569 5:104617697-104617719 TTACCATGAATGAAACTTTCAGG + Intergenic
994953252 5:106493591-106493613 TAACCTTGAATGCATAGTGCTGG + Intergenic
995058836 5:107792211-107792233 TTACCATGAATGGAGCTTGCGGG + Intergenic
995115044 5:108469974-108469996 TAACCTTAAATGAATATTGCCGG - Intergenic
995254472 5:110030619-110030641 TTACCTTGTTTGAGTCCTCCTGG + Intergenic
995354362 5:111222124-111222146 TTACCATGAATGCAGCTTGCAGG - Intergenic
995720693 5:115128950-115128972 TTACCATGAATGGAGCTTGCAGG - Intronic
996431698 5:123387002-123387024 TTACCATGAATGCATCCTTTTGG - Intronic
996558357 5:124801813-124801835 TTATCTTGACTAAATCCTTCTGG - Intergenic
997168175 5:131684938-131684960 TTTGCTTGAAAGAATCCTTCAGG - Intronic
998212788 5:140213592-140213614 TTACCATGAATGGAGCCTACAGG - Intronic
998213667 5:140220869-140220891 GTAGCATGAATCAATCCTGCAGG - Intronic
998791539 5:145771079-145771101 TTACTGTGAATGAAACTTGCGGG - Intronic
999215170 5:149927241-149927263 TTAGCATGAATGGAGCCTGCGGG + Intronic
1001078514 5:168648793-168648815 TTACCGTGAATGGAGCTTGCAGG - Intergenic
1001153860 5:169256058-169256080 TTACCATGAATGGAGCTTGCAGG - Intronic
1001466445 5:171970986-171971008 TCACATTGTTTGAATCCTGCAGG + Intronic
1001609159 5:172986087-172986109 TTACCATGAATGGAGCTTGCAGG + Intronic
1001672622 5:173486685-173486707 TTACCCTGAATGGACACTGCTGG + Intergenic
1001887363 5:175305716-175305738 TTACCTTGAGTGGAGCTTGCCGG + Intergenic
1003458092 6:6302574-6302596 TTACCATGAATGGAACGTGCAGG + Intronic
1004524771 6:16396736-16396758 TTACCATGAATGGAGCTTGCAGG - Intronic
1004591086 6:17052555-17052577 TTACCATGAATGGAGCTTGCAGG - Intergenic
1004891385 6:20103974-20103996 TTACCATGAATGGAGCTTGCAGG - Intronic
1005105105 6:22215684-22215706 TTACCATGAATGGAGCTTGCAGG - Intergenic
1005279225 6:24253736-24253758 TTACCATGAATGGAGCTTGCAGG + Intronic
1005776733 6:29141024-29141046 TTACCATAAATGGATCTTGCAGG + Intergenic
1006063891 6:31446992-31447014 TTACCATGAATGGAGCTTGCAGG + Intergenic
1006660632 6:35640423-35640445 TTACCATGAATGGAACTTGCAGG + Intronic
1006998668 6:38287253-38287275 TTACCATGAATGGAGCTTGCAGG - Intronic
1007559195 6:42792077-42792099 TTACCATGAATGAAGCTTGGAGG + Intronic
1007714344 6:43846077-43846099 TTACCATGAATGGAGCTTGCAGG + Intergenic
1008067599 6:47066640-47066662 TTACTGTGAATGAAGCTTGCTGG - Intergenic
1008296155 6:49780688-49780710 TTACCATGAATGAAGCTTGTAGG + Intergenic
1008708129 6:54188137-54188159 TTGCCATGAATGGAGCCTGCAGG + Intronic
1008951557 6:57165894-57165916 TTACCCTGAATGGAGCTTGCAGG + Intronic
1009319683 6:62272022-62272044 TTACCATGAATGGAGCTTGCGGG - Intronic
1009949799 6:70382392-70382414 TTACCATGAATGGAGCATGCAGG - Intergenic
1011456852 6:87559832-87559854 TTACCATGAATGGAGCTTGCAGG - Intronic
1011886003 6:92096472-92096494 TTACCATAAATGGAGCCTGCAGG - Intergenic
1012077059 6:94702636-94702658 TTACCATGAATGGACCTTGCAGG + Intergenic
1012178377 6:96119209-96119231 TTACCATGAATGGAGCTTGCAGG - Intronic
1012236557 6:96823711-96823733 TTACCATGAATGGAGCTTGCAGG - Intronic
1012534004 6:100273846-100273868 TTACCATGAATGGAGCTTGCAGG - Intergenic
1012827125 6:104160836-104160858 TTACCATGAATGGAGCTTGCAGG + Intergenic
1012969631 6:105715000-105715022 TTACCATGAATGGAGCTTGCAGG + Intergenic
1014052948 6:116977216-116977238 TTTCCATGAATGAAGCTTGCAGG - Intergenic
1014093855 6:117438307-117438329 TTACCATGAATGCAGCTTGCAGG - Intronic
1014349641 6:120324158-120324180 TAACCTTCAATGACTACTGCTGG + Intergenic
1015424360 6:133048825-133048847 TTACCATGAATGGAACTTGCAGG - Intergenic
1015942732 6:138468183-138468205 TTACCATGAATGGAGCTTGCAGG - Intronic
1016085142 6:139904231-139904253 TTATCTTGAATTAATGCTGTAGG + Intergenic
1016399109 6:143659069-143659091 TTACCATGAATGGAGCTTGCAGG + Intronic
1016533266 6:145082298-145082320 TTACCATGAATAAATATTGCAGG - Intergenic
1017040630 6:150305814-150305836 ATACCTTGAATGATATCTGCAGG - Intergenic
1017669597 6:156757225-156757247 TTACCATGAATGGAGCTTGCAGG - Intergenic
1017863028 6:158416782-158416804 TTACCATGAATGGAGCTTGCAGG - Intronic
1018041642 6:159929380-159929402 TTACCACGAATGAAGCCTGCAGG - Intergenic
1018527798 6:164733520-164733542 TTACCATGAATGAAGCTTGCAGG - Intergenic
1018799191 6:167209681-167209703 TTATGTTGAATGAAGCCTTCGGG + Intergenic
1021314329 7:19127690-19127712 TTACCTTTAACGAATCCTGTTGG - Intergenic
1021496644 7:21282336-21282358 TTAGCATGAATGAAGCTTGCAGG - Intergenic
1021929748 7:25568376-25568398 TTACCATGACTGGAGCCTGCAGG - Intergenic
1021951058 7:25775499-25775521 TTACCATGAATGGAGCCTGCAGG - Intergenic
1023040090 7:36165171-36165193 TTGCCATGAATGGATCTTGCAGG - Intronic
1023223667 7:37947130-37947152 TTGCCATGAATGGAGCCTGCAGG - Intronic
1023263028 7:38377320-38377342 TTACCATGAATGGAGCTTGCAGG - Intergenic
1023803329 7:43853617-43853639 CTACCTAGAAGGAATTCTGCCGG + Intergenic
1026216631 7:68355275-68355297 TTACCATGAATGGAGCATGCAGG - Intergenic
1027475479 7:78625686-78625708 TTACCATGAATGGAGCTTGCAGG - Intronic
1028438881 7:90836026-90836048 TTACCATGAATGGAGCTTGCAGG + Intronic
1028636563 7:92995912-92995934 TTACCATGAATGGAGCTTGCAGG + Intergenic
1028699362 7:93759317-93759339 TTACCATGAATGGAGCTTGCAGG + Intronic
1028757891 7:94458978-94459000 TTACCATGAATGGAGCTTGCAGG - Intergenic
1028977268 7:96928094-96928116 TTACTATGAATGAAGCTTGCAGG - Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1030149905 7:106393802-106393824 TTACCATGAATGGAGCTTGCAGG - Intergenic
1030465169 7:109892148-109892170 TTACTATGAATGGAGCCTGCAGG + Intergenic
1030707681 7:112711699-112711721 TTACCATGAATGGATCTTGCGGG - Intergenic
1030767332 7:113427096-113427118 TTACCATGAATGGAGCTTGCAGG - Intergenic
1031091256 7:117357865-117357887 TTACCATGAATGAAGCTTGCAGG - Intergenic
1031191761 7:118561677-118561699 TTACTGTGAATGAAGCTTGCAGG + Intergenic
1031290248 7:119925382-119925404 TTACCTAGAATGAGTTCTGAGGG + Intergenic
1032124798 7:129185592-129185614 TTCCCTTGTGGGAATCCTGCTGG - Intergenic
1032565590 7:132939332-132939354 TTACCATGAATGGAGCTTGCAGG - Intronic
1032929539 7:136650577-136650599 TTACCATGAATGCAGCTTGCAGG + Intergenic
1032977870 7:137246136-137246158 TTACCGTGAATGGAGCTTGCAGG - Intronic
1033059555 7:138092804-138092826 TTACCATGAATGGAGCTTGCAGG + Intronic
1033108061 7:138548458-138548480 TTACCATGAATGGAGCTTGCAGG + Intronic
1033426420 7:141248707-141248729 TTACCATGAATGGAGCTTGCAGG + Intronic
1034279247 7:149840589-149840611 TTACCATGAATGGAGCTTGCAGG - Intronic
1034973843 7:155436631-155436653 TTCCCTTGGATAAATCCTCCAGG + Intergenic
1035358314 7:158293105-158293127 TGACCATGAATGGAGCCTGCAGG + Intronic
1036083704 8:5589208-5589230 TTACCATGAATGGAGCTTGCAGG + Intergenic
1036113628 8:5933839-5933861 TTACCATGAATGGAGCTTGCGGG - Intergenic
1037248422 8:16863740-16863762 TTACCATGAATGGAGCTTGCAGG - Intergenic
1037487549 8:19362974-19362996 TTACCATGAATGGAGCTTGCAGG - Intronic
1037593527 8:20334025-20334047 TTAACATGAATGAAGCTTGCAGG - Intergenic
1037975320 8:23206373-23206395 TTACCATGAATGGAGCTTGCAGG - Intronic
1039116727 8:34099491-34099513 TTACCATGAATGGAGCTTGCAGG - Intergenic
1039814104 8:41077202-41077224 TTACCGTGAATGAAGCTTGCAGG - Intergenic
1041369745 8:57146298-57146320 TCACCATGAATGAAGACTGCAGG - Intergenic
1041831035 8:62153585-62153607 TTATCATGAATGGAGCCTGCAGG - Intergenic
1042164038 8:65927967-65927989 TTACCGTGAATGGAGCTTGCAGG + Intergenic
1042310715 8:67376647-67376669 ATACCATGAATGGAGCCTGCAGG + Intergenic
1042462745 8:69090092-69090114 TTACCATGAATGGAGCTTGCAGG + Intergenic
1042519184 8:69692300-69692322 TTATCATGAATGGAGCCTGCAGG + Intronic
1043039431 8:75242643-75242665 TTACCATGAATGGAGCTTGCAGG - Intergenic
1043106354 8:76117048-76117070 TTACCATGAATGGAGCTTGCAGG + Intergenic
1043189281 8:77197100-77197122 TTACCATGAATGAAGTTTGCAGG - Intergenic
1043359475 8:79454641-79454663 TTACCGTGAATGGAGCTTGCAGG - Intergenic
1043360675 8:79468238-79468260 TTACCATGAAGGGATCTTGCAGG + Intergenic
1043755066 8:83993298-83993320 TTTCCTTGAATGCATCCTCTTGG + Intergenic
1043909547 8:85845614-85845636 TTACCATGAATGGAGCTTGCAGG - Intergenic
1043981892 8:86652248-86652270 TTACCATGAATGGAGCTTGCAGG + Intronic
1044116536 8:88342859-88342881 TTACCCTGAATGGAGCTTGCAGG + Intergenic
1044758999 8:95496983-95497005 CTACATTGTATGTATCCTGCTGG + Intergenic
1045247158 8:100453085-100453107 TTACCATGAATGGAGCTTGCAGG + Intergenic
1045484527 8:102620778-102620800 TTACCTTGAAAGGAGCTTGCAGG - Intergenic
1045634864 8:104173302-104173324 TTACCTAGAATTAATCTTTCTGG + Intronic
1046663085 8:116969808-116969830 TTACCATGAATGGAGCTTGCAGG + Intronic
1048995871 8:139793420-139793442 TTTCCTTGAAGAAATGCTGCTGG - Intronic
1050525818 9:6545454-6545476 TTACCATGAATGGAGCTTGCAGG + Intronic
1051075224 9:13225523-13225545 GTACCATGAATGGAGCCTGCAGG - Intronic
1051128237 9:13829861-13829883 TTACCATGAATGGAGCTTGCAGG + Intergenic
1051263931 9:15293044-15293066 TTACCATGAATGGAGCTTGCAGG - Intronic
1051328893 9:16002744-16002766 TTACCATGAATGGAGCTTGCAGG - Intronic
1051474936 9:17495770-17495792 TTACCATGAATGGAGCCTGTGGG - Intronic
1051647361 9:19281949-19281971 TTACCATGAATGGACCTTGCAGG + Intronic
1051834151 9:21316240-21316262 TTACCTTATATCAGTCCTGCTGG + Intergenic
1053049568 9:34948436-34948458 TTACCATGAATGGAGCTTGCAGG - Intergenic
1053402726 9:37840798-37840820 TTACCATGAATGGAGCTTGCAGG - Intronic
1053505478 9:38639472-38639494 TTACCATGAATGGAGCTTGCAGG - Intergenic
1054713482 9:68534578-68534600 TTATCTTGAGTGAATCCTCTAGG + Intergenic
1055342402 9:75298009-75298031 TTACCATGAATGGAGCTTGCAGG - Intergenic
1055393761 9:75851262-75851284 TTACCATGAATGAAGCATACAGG + Intergenic
1055464853 9:76554407-76554429 TTACCATGAATGGAGCTTGCAGG + Intergenic
1055832108 9:80392246-80392268 TTACCATGAATGTATCTTGCAGG + Intergenic
1056122865 9:83506569-83506591 TTACCATGAATGGAGCTTGCAGG + Intronic
1056242491 9:84662017-84662039 TTACCATGAATGGAGCTTGCAGG + Intergenic
1056645044 9:88404172-88404194 TTACCATGAATGGAGCTTGCAGG + Intronic
1057027141 9:91742831-91742853 TTACCATGAATGGAGCTTGCAGG - Intronic
1057494455 9:95549735-95549757 TTACCATGAATAAAGCTTGCAGG - Intergenic
1058018539 9:100065126-100065148 TTAACATGAATGAAACTTGCAGG - Intronic
1058318905 9:103605048-103605070 TTACCATGAATGAAGCTTGCAGG - Intergenic
1058479669 9:105378902-105378924 TCAACTTGAATGAATCTTGAGGG + Intronic
1059172693 9:112141021-112141043 TTACCATGAATGGAGCTTGCAGG + Intronic
1060200384 9:121648972-121648994 GGACCTGGAATCAATCCTGCTGG - Intronic
1060620985 9:125066388-125066410 TTACCATGAATGGAGCCTGCAGG - Intronic
1061407055 9:130398314-130398336 TTTCCTTGACTGAAGCCTCCAGG - Intronic
1062333597 9:136055290-136055312 TGTCCTTGTGTGAATCCTGCCGG - Intronic
1062663470 9:137653145-137653167 TTACCATGAATGGAGCTTGCAGG - Intronic
1203583041 Un_KI270746v1:31851-31873 TTACCTTGGATAAATTCTTCTGG + Intergenic
1185943770 X:4351751-4351773 TTACCATGAATGGAGCTTGCAGG + Intergenic
1186697327 X:12050224-12050246 TTACTATGAATGGAGCCTGCAGG - Intergenic
1187192615 X:17050029-17050051 TTACCATGAATGGAGCTTGCAGG - Intronic
1188269525 X:28121351-28121373 TTACCATGAATGGAGCTTGCAGG + Intergenic
1188594503 X:31881556-31881578 TTACCATGAATGGAGCTTGCAGG - Intronic
1189022302 X:37353582-37353604 TTACCATGAATAGAGCCTGCAGG - Intronic
1189158163 X:38781487-38781509 TTACCATGAATGGAGCTTGCAGG + Intergenic
1190574144 X:51816065-51816087 TTACCATGAATAAAGCTTGCAGG - Intronic
1191090228 X:56612550-56612572 TTACCATGAATGAAGCTTGTAGG + Intergenic
1192344863 X:70293782-70293804 TTACCGTGAATGGAGCTTGCAGG + Intronic
1193145388 X:78070732-78070754 TTACCTTGAATGGAGCCTACAGG + Intronic
1193318321 X:80091212-80091234 TTACCATGAATGACGCTTGCAGG - Intergenic
1193598010 X:83472045-83472067 TCACCTTGAATGACTCCTCTTGG - Intergenic
1193611576 X:83637864-83637886 TTACCATGAATGGAGCTTGCAGG + Intergenic
1193929837 X:87540123-87540145 TTACCATAAATGAAGCTTGCAGG + Intronic
1194565249 X:95478993-95479015 TTACCATGAATGGAACTTGCAGG + Intergenic
1194918725 X:99736829-99736851 TTATCATGAATGAAGCTTGCAGG - Intergenic
1195081544 X:101376142-101376164 TTACCTAAATTGAATCCTTCTGG - Intronic
1195296398 X:103482298-103482320 TTACCATGAATGGAGCTTGCAGG + Intergenic
1195551092 X:106172122-106172144 TTACCATGAATGGAGCTTGCAGG + Intronic
1195772658 X:108368377-108368399 TTACCATGAATGGAGCTTGCAGG + Intronic
1196568224 X:117233282-117233304 TTACCATGAATGGAGCTTGCAGG + Intergenic
1196641435 X:118067300-118067322 TTAGCATGAATGGAACCTGCAGG + Intronic
1197265473 X:124364891-124364913 TTACCATGAATGGAGCTTGCAGG - Intronic
1198067004 X:133108258-133108280 TTACCATGAATGGAGCTTGCAGG + Intergenic
1199335325 X:146612680-146612702 TTACCATGAGTGAAGCTTGCAGG + Intergenic
1199744641 X:150764310-150764332 TTACCTTGAATAAATCTCTCTGG - Intronic
1201638296 Y:16150348-16150370 TTACCATGAATGGAGCTTGCAGG + Intergenic